Main menu

PCR-cDNA Barcoding Kit (SQK-PCB111.24) (PCB_9155_v111_revM_11Mar2026)


Document options

PromethIONEnglish

Document options

PromethION
Language:

Overview

The fastest and simplest protocol for full-length cDNA sequencing

  • Offering highest yield
  • Higher yields than traditional cDNA synthesis
  • Splice variants and fusion transcripts
  • Multiplex up to 24 different samples
  • Compatible with R9.4.1 flow cells only

For Research Use Only

Document version: PCB_9155_v111_revM_11Mar2026

1. Overview of the protocol

This is a Legacy product.

This product has been discontinued. Should you require any assistance or have questions, please contact our Customer Support: support@nanoporetech.com.

PCR-cDNA Barcoding Kit features:

This kit is highly recommended for users who:

  • wish to multiplex up to 24 samples to reduce price per sample
  • would like to identify and quantify full-length transcripts
  • are looking for a faster and simpler method for cDNA synthesis: ~210 minutes library prep + variable time for PCR
  • want to explore isoforms, splice variants and fusion transcripts using full-length cDNAs
  • wish to start from total RNA
  • have a low starting amount of RNA
  • would like to generate high amounts of cDNA data

Introduction to the PCR-cDNA Barcoding Kit protocol

This protocol describes how to carry out sequencing of multiple cDNA samples using a strand-switching method and the PCR-cDNA Barcoding Kit (SQK-PCB111.24). There are 24 unique barcodes available, allowing the user to pool up to 24 different samples in one sequencing experiment. During the strand-switching step, a UMI is incorporated, before the double-stranded cDNA is amplified by PCR using primers containing 5' tags. The amplified and barcoded samples are then pooled together and the Rapid Sequencing Adapters are added to the pooled mix.

A control experiment can be completed first using RNA Control Sample (RCS) from the RNA Control Expansion (EXP-RCS001) as your input to troubleshoot your library preparation or to become familiar with the protocol.

Steps in the sequencing workflow:

Prepare for your experiment

You will need to:

  • Extract your RNA, and check its length, quantity and purity The quality checks performed during the protocol are essential in ensuring experimental success
  • Ensure you have your sequencing kit, the correct equipment and third-party reagents
  • Download the software for acquiring and analysing your data
  • Check your flow cell to ensure it has enough pores for a good sequencing run

**Library preparation**

You will need to:

  • Using the strand-switching protocol, prepare full-length cDNAs from Poly(A)+ RNA (or total RNA) with the incorporation of the UMI
  • Amplify the cDNAs by PCR, adding rapid attachment barcode primers during the PCR step
  • Attach sequencing adapters to the PCR products
  • Prime the flow cell, and load your cDNA library into the flow cell

PCB111.24

Sequencing and analysis

You will need to:

  • Start a sequencing run using the MinKNOW software, which will collect raw data from the device and convert it into basecalled reads
  • Optional: Start the EPI2ME software and select a workflow for further analysis

Compatibilities of this protocol

This protocol should only be used in combination with:

  • PCR-cDNA Barcoding Kit (SQK-PCB111.24)
  • R9.4.1 flow cells (FLO-PRO002)
  • Flow Cell Wash Kit (EXP-WSH004)
  • RNA Control Expansion (EXP-RCS001)

2. Equipment and consumables

Materials
  • 4 ng enriched RNA (Poly(A)+ RNA or ribodepleted) or 200 ng total RNA
  • PCR-cDNA Barcoding Kit (SQK-PCB111.24)

Consumables
  • Agencourt RNAClean XP beads (Beckman Coulter®, A63987)
  • Agencourt AMPure XP beads (Beckman Coulter™, A63881)
  • Lambda Exonuclease (NEB, M0262L)
  • NEBNext® Quick Ligation Reaction Buffer (NEB, B6058)
  • T4 DNA Ligase 2M U/ml (NEB, M0202M)
  • 10 mM dNTP solution (e.g. NEB N0447)
  • LongAmp Hot Start Taq 2X Master Mix (NEB, M0533)
  • Maxima H Minus Reverse Transcriptase (200 U/µl) with 5x RT Buffer (ThermoFisher, EP0751)
  • RNaseOUT™, 40 U/μl (Life Technologies,10777019)
  • USER (Uracil-Specific Excision Reagent) Enzyme (NEB, M5505L)
  • Exonuclease I (NEB, Cat # M0293)
  • Nuclease-free water (e.g. Thermo Scientific, AM9937)
  • Freshly prepared 70% ethanol in nuclease-free water
  • 1.5 ml Eppendorf DNA LoBind tubes
  • 0.2 ml thin-walled PCR tubes
  • Qubit™ RNA HS Assay Kit (ThermoFisher, Q32852)
  • Qubit™ dsDNA HS Assay Kit (ThermoFisher, Q32851)
  • Qubit™ Assay Tubes (Invitrogen, Q32856)

Equipment
  • Hula mixer (gentle rotator mixer)
  • Magnetic separation rack, suitable for 1.5 ml Eppendorf tubes
  • Microfuge
  • Vortex mixer
  • Thermal cycler
  • P1000 pipette and tips
  • P200 pipette and tips
  • P100 pipette and tips
  • P20 pipette and tips
  • P10 pipette and tips
  • P2 pipette and tips
  • Ice bucket with ice
  • Timer
  • Qubit™ fluorometer (or equivalent for QC check)
  • Agilent Bioanalyzer (or equivalent)

For this protocol, you will need 4 ng enriched RNA (Poly(A)+ RNA or ribodepleted) or 200 ng total RNA.

Input RNA

It is important that the input RNA meets the quantity and quality requirements. Using too little or too much RNA, or RNA of poor quality (e.g. fragmented or containing chemical contaminants) can affect your library preparation.

For instructions on how to perform quality control of your RNA sample, please read the Input DNA/RNA QC protocol.

For further information on using RNA as input, please read the links below.

These documents can also be found in the DNA/RNA Handling page.

Third-party reagents

We have validated and recommend the use of all the third-party reagents used in this protocol. Alternatives have not been tested by Oxford Nanopore Technologies.

For all third-party reagents, we recommend following the manufacturer's instructions to prepare the reagents for use.

PCR-cDNA Barcoding Kit (SQK-PCB111.24) contents

SQK-PCB111.24 2

Name Acronym Cap colour No. of vials Fill volume per vial (μl)
Strand Switching Primer II SSPII Violet 1 350
RT Primer RTP Yellow 1 200
cDNA RT Adapter CRTA Amber 1 200
Annealing Buffer AB Orange 1 200
Rapid Adapter T RAP T Green 1 10
RAP Dilution Buffer
(or Adapter Buffer)
RDB
(or ADB)
Clear 1 100
Elution Buffer EB Black 2 1,500
Short Fragment Buffer SFB White 4 7,500
Sequencing Buffer II SBII Red 1 500
Loading Beads II LBII Pink 1 360
Loading Solution LS White cap, pink label 1 400
Barcode Primers 1-24 BP01-24 White 24 10
Flush Buffer FB Blue 6 1,170
Flush Tether FLT White cap, purple label 1 200

RAP Dilution Buffer (RDB) and Adapter Buffer (ADB) can be used interchangably with this kit.

As we move into the Legacy and Discontinuation phases for this kit, we have replaced some of the vials with our newer versions in recent production batches.

The original RAP Dilution Buffer (RDB) vials and our new Adapter Buffer (ADB) vials contain the same reagent and can be used interchangeably with this kit.

RNA Control Expansion (EXP-RCS001)

The RNA Control Expansion (EXP-RCS001) provides users with RNA Control Sample (RCS) to replace their sample input when performing a control experiment for troubleshooting purposes in the cDNA-PCR Sequencing (SQK-PCS111) and the PCR-cDNA Barcoding Kit (SQK-PCB111.24).

RCS001

Name Acronym Number of vials Cap colour Fill volume per vial (µl)
RNA Control Sample RCS 3 Yellow 25

Rapid Adapter T (RAP T) used in this kit and protocol is not interchangeable with other sequencing adapters.

Barcode primer sequences

Below are the barcode primer sequences for PCR-cDNA Barcoding Kit (SQK-PCB109 and SQK-PCB111.24).

  • PCR-cDNA Barcoding Kit (SQK-PCB109 and SQK-PCB111.24): __BP01-24
  • PCR Barcoding Kit (SQK-PBK004): BP01-12
Component Sequence
BP01 AAGAAAGTTGTCGGTGTCTTTGTG
BP02 TCGATTCCGTTTGTAGTCGTCTGT
BP03 GAGTCTTGTGTCCCAGTTACCAGG
BP04 TTCGGATTCTATCGTGTTTCCCTA
BP05 CTTGTCCAGGGTTTGTGTAACCTT
BP06 TTCTCGCAAAGGCAGAAAGTAGTC
BP07 GTGTTACCGTGGGAATGAATCCTT
BP08 TTCAGGGAACAAACCAAGTTACGT
BP09 AACTAGGCACAGCGAGTCTTGGTT
BP10 AAGCGTTGAAACCTTTGTCCTCTC
BP11 GTTTCATCTATCGGAGGGAATGGA
BP12 CAGGTAGAAAGAAGCAGAATCGGA
BP13 AGAACGACTTCCATACTCGTGTGA
BP14 AACGAGTCTCTTGGGACCCATAGA
BP15 AGGTCTACCTCGCTAACACCACTG
BP16 CGTCAACTGACAGTGGTTCGTACT
BP17 ACCCTCCAGGAAAGTACCTCTGAT
BP18 CCAAACCCAACAACCTAGATAGGC
BP19 GTTCCTCGTGCAGTGTCAAGAGAT
BP20 TTGCGTCCTGTTACGAGAACTCAT
BP21 GAGCCTCTCATTGTCCGTTCTCTA
BP22 ACCACTGCCATGTATCAAAGTACG
BP23 CTTACTACCCAGTGAACCTCCTCG
BP24 GCATAGTTCTGCATGATGGGTTAG

3. Computer requirements and software

PromethION 24/48 IT requirements

The PromethION device contains all the hardware required to control up to 24 (for the P24 model) or 48 (for the P48 model) sequencing experiments and acquire the data. The device is further enhanced with high performance GPU technology for real-time basecalling. Read more in the PromethION IT requirements document.

PromethION 2 Solo IT requirements

The PromethION 2 (P2) Solo is a device which directly connects into a GridION Mk1 or a stand-alone computer that meets the miminum specifications for real-time data streaming and analysis. Up to two PromethION flow cells can be can be run and each is independently addressable, meaning experiments can be run concurrently or individually. For information on the computer IT requirements, please see the PromethION 2 Solo IT requirements document.

Software for nanopore sequencing

MinKNOW

The MinKNOW software controls the nanopore sequencing device, collects sequencing data and basecalls in real time. You will be using MinKNOW for every sequencing experiment to sequence, basecall and demultiplex if your samples were barcoded.

For instructions on how to run the MinKNOW software, please refer to the MinKNOW protocol.

EPI2ME (optional)

The EPI2ME cloud-based platform performs further analysis of basecalled data, for example alignment to the Lambda genome, barcoding, or taxonomic classification. You will use the EPI2ME platform only if you would like further analysis of your data post-basecalling.

For instructions on how to create an EPI2ME account and install the EPI2ME Desktop Agent, please refer to this link.

Check your flow cell

We highly recommend that you check the number of pores in your flow cell prior to starting a sequencing experiment. This should be done within 12 weeks of purchasing for MinION/GridION/PromethION or within four weeks of purchasing Flongle Flow Cells. Oxford Nanopore Technologies will replace any flow cell with fewer than the number of pores in the table below, when the result is reported within two days of performing the flow cell check, and when the storage recommendations have been followed. To do the flow cell check, please follow the instructions in the Flow Cell Check document.

Flow cell Minimum number of active pores covered by warranty
Flongle Flow Cell 50
MinION/GridION Flow Cell 800
PromethION Flow Cell 5000

4. Reverse transcription and strand-switching

Materials
  • 4 ng enriched RNA (Poly(A)+ RNA or ribodepleted) or 200 ng total RNA
  • cDNA RT Adapter (CRTA)
  • Annealing Buffer (AB)
  • S Fragment Buffer (SFB)
  • RT Primer (RTP)
  • Strand Switching Primer II (SSPII)

Consumables
  • Nuclease-free water (e.g. ThermoFisher, AM9937)
  • NEBNext® Quick Ligation Reaction Buffer (NEB, B6058)
  • T4 DNA Ligase 2M U/ml (NEB, M0202M)
  • Lambda Exonuclease (NEB, M0262L)
  • USER (Uracil-Specific Excision Reagent) Enzyme (NEB, M5505L)
  • Agencourt RNAClean XP beads (Beckman Coulter®, A63987)
  • 10 mM dNTP solution (e.g. NEB, N0447)
  • Maxima H Minus Reverse Transcriptase (200 U/µl) with 5x RT Buffer (ThermoFisher, EP0751)
  • RNaseOUT™, 40 U/μl (Life Technologies,10777019)
  • 1.5 ml Eppendorf DNA LoBind tubes
  • 0.2 ml thin-walled PCR tubes
  • Qubit™ RNA HS Assay Kit (ThermoFisher, Q32852)
  • Qubit™ Assay Tubes (Invitrogen, Q32856)

Equipment
  • Microfuge
  • Thermal cycler
  • P1000 pipette and tips
  • P200 pipette and tips
  • P100 pipette and tips
  • P20 pipette and tips
  • P10 pipette and tips
  • P2 pipette and tips
  • Qubit™ fluorometer (or equivalent for QC check)

Thaw the following reagents, then spin down briefly using a microfuge and mix as indicated in the table below. Then place the reagents on ice.

Reagent 1. Thaw at room temperature 2. Briefly spin down 3. Mix well by pipetting
cDNA RT Adapter (CRTA)
Annealing Buffer (AB)
Short Fragment Buffer (SFB)
RT Primer (RTP)
Strand Switching Primer II (SSPII)
NEBNext® Quick Ligation Reaction Buffer Mix by vortexing
T4 DNA Ligase 2M U/ml Not frozen
RNaseOUT Not frozen
Lambda Exonuclease Not frozen
Uracil-Specific Excision Reagent (USER) Not frozen
10 mM dNTP solution
Maxima H Minus Reverse Transcriptase Not frozen
Maxima H Minus 5x RT Buffer Mix by vortexing

It is important that the NEBNext Quick Ligation Reaction Buffer is mixed well by vortexing.

Check for any visible precipitate; vortexing for at least 30 seconds may be required to solubilise all precipitate.

To run a control experiment, replace your sample input with 10 μl diluted RNA Control Sample (RCS) from the RNA Control Expansion (EXP-RCS001) as follows:

  • Thaw the RNA Control Sample (RCS) at room temperature, briefly spin down and mix well by pipetting.
  • Dilute the RNA Control Sample (RCS) in a 1.5 ml Eppendorf DNA LoBind tube as follows:
Reagent Volume
RNA Control Sample (RCS) 1 μl
Nuclease-free water 14 μl
Total 15 μl

Note: This will provide enough volume for 3 samples, adjust your volumes accordingly for the number of samples you wish to run in your control experiment.

  • Mix thoroughly by pipetting 10-20 times and briefly spin down.
  • Take forward 4 μl of the diluted RNA Control Sample (RCS) per sample and make up each volume to 10 μl with nuclease-free water as follows:
Reagent Volume
Diluted RNA Control Sample (RCS) 4 μl
Nuclease-free water 6 μl
Total volume per sample 10 μl
  • Mix by flicking the tube and spin down.
  • Use the 10 μl of diluted RNA Control Sample (RCS) as your RNA input.

For each sample, prepare the RNA in nuclease-free water.

  • Transfer 4 ng Poly(A)+ RNA, or 200 ng total RNA into a 1.5 ml Eppendorf DNA LoBind tube
  • Adjust the volume up to 10 µl with nuclease-free water
  • Mix by flicking the tube to avoid unwanted shearing
  • Spin down briefly in a microfuge

Prepare the following in a 0.2 ml PCR tube per sample:

Reagent Volume
RNA 10 µl
cDNA RT Adapter (CRTA) 1 µl
Annealing Buffer (AB) 1 µl
Total volume 12 µl

The cDNA RT Adapter (CRTA) is a double stranded adapter with a poly(T) overhang which anneals to the very end of the poly(A) tail of the RNA strand. This ensures that the full length of the RNA is reverse transcribed and that the poly(A) length can be estimated accurately. Annealing Buffer (AB) has been included to improve CRTA ligation.

Mix gently by flicking the tubes, and spin down.

Incubate the reactions in the thermal cycler at 60°C for 5 mins, then cool for 10 minutes at room temperature.

To each of the 0.2 ml PCR tubes containing you RNA sample(s), add the following:

Reaction Volume
RNA sample (from previous step) 12 µl
NEBNext® Quick Ligation Reaction Buffer 3.6 µl
T4 DNA Ligase 2M U/ml 1.4 µl
RNaseOUT 1 µl
Total volume (including all reagents) 18 µl

Ensure the components are thoroughly mixed by flicking the tubes and spin down.

Incubate for 10 minutes at room temperature.

To each of the 0.2 ml PCR tubes, add the following:

Reagent Volume
RNA sample (from previous step) 18 µl
Lambda Exonuclease 1 µl
USER (Uracil-Specific Excision Reagent) 1 µl
Total volume (including all reagents) 20 µl

The Lambda Exonuclease and Uracil-Specific Excision Reagent (USER) are third-party reagents used in the preparation of the reverse transcription step. Lambda Exonuclease and USER digest the bottom strand of the ligated CRTA so that the RT Primer (RTP) can bind the CRTA sequence as a primer for the reverse transcription of the RNA.

Ensure the components are thoroughly mixed by flicking the tubes and spin down.

Incubate for 15 minutes at 37°C in the thermal cycler.

Transfer each sample to clean 1.5 ml Eppendorf DNA LoBind tubes.

Resuspend the RNase-free XP beads by vortexing.

Add 36 µl of resuspended RNase-free XP beads to each reaction and mix gently by flicking the tubes.

Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.

Spin down the samples and pellet on a magnet. Keep the tubes on the magnet, and pipette off the supernatant.

Keep the tubes on the magnet and wash the beads with 100 µl of Short Fragment Buffer (SFB) without disturbing the pellet. Remove the SFB using a pipette and discard.

Repeat the previous step.

Spin down and place the tubes back on the magnet. Pipette off any residual buffer. Briefly allow to dry for ~30 seconds, but do not dry the pellet to the point of cracking.

Remove the tubes from the magnetic rack and resuspend each pellet in 12 µl of nuclease-free water.

Incubate at room temperature for 10 minutes.

Pellet the beads on a magnet until the eluate is clear and colourless.

Remove and retain 12 µl of eluate into a clean 0.2 ml thin-walled PCR tube per sample.

To each of the 0.2 ml PCR tubes, add the following:

Reagents Volume
Eluted sample (from previous step) 12 µl
RT Primer (RTP) 1 µl
dNTPs (10 mM) 1 µl
Total volume (including all reagents) 14 µl

RT Primer (RTP) is a single stranded primer and binds upstream of the poly(A) tail of the RNA transcript to prime for reverse transcription.

Ensure the components are thoroughly mixed by flicking the tubes and spin down.

Incubate the reaction for 15 minutes at room temperature.

To each of the 0.2 ml PCR tubes, add the following:

Reagents Volume
RT primed sample (from previous step) 14 µl
Maxima H Minus 5x RT Buffer 4.5 µl
RNaseOUT 1 µl
Strand Switching Primer II (SSPII) 2 µl
Total (including all reagents) 21.5 µl

Strand Switching Primer II (SSPII) base pairs to the deoxycytidine present at the 5' end of the first cDNA strand synthesised. This allows the reverse transcriptase to "strand-switch" for synthesis of the second cDNA strand.

Mix gently by flicking the tubes, and spin down.

Incubate at 42°C for 2 minutes in the thermal cycler.

Add 1 µl of Maxima H Minus Reverse Transcriptase to each tube. The total volume will be 22.5 µl per tube.

Mix gently by flicking the tubes, and spin down.

Incubate using the following protocol using a thermal cycler:

Cycle step Temperature Time No. of cycles
Reverse transcription and strand-switching 42°C 90 mins 1
Heat inactivation 85°C 5 mins 1
Hold 4°C

Take your samples forward into the next step. However, at this point it is also possible to store the sample at -20°C overnight.

5. Selecting for full-length transcripts by PCR

Materials
  • Barcode Primers (BP01-24)
  • Elution Buffer (EB)

Consumables
  • Nuclease-free water (e.g. ThermoFisher, AM9937)
  • LongAmp Hot Start Taq 2X Master Mix (NEB, M0533)
  • Exonuclease I (NEB, Cat # M0293)
  • Agencourt AMPure XP beads (Beckman Coulter™, A63881)
  • Freshly prepared 70% ethanol in nuclease-free water
  • 0.2 ml PCR tubes
  • 1.5 ml Eppendorf DNA LoBind tubes
  • Qubit dsDNA HS Assay Kit (Invitrogen, Q32851)
  • Qubit™ Assay Tubes (Invitrogen, Q32856)

Equipment
  • Thermal cycler
  • Vortex mixer
  • Hula mixer (gentle rotator mixer)
  • Magnetic separation rack, suitable for 1.5 ml Eppendorf tubes
  • Ice bucket with ice
  • P1000 pipette and tips
  • P200 pipette and tips
  • P100 pipette and tips
  • P20 pipette and tips
  • P10 pipette and tips
  • P2 pipette and tips
  • Qubit™ fluorometer (or equivalent for QC check)
  • Agilent Bioanalyzer (or equivalent)

This kit enables multiplexing of up to 24 samples. The default method allows you to perform one 25 µl PCR reaction per sample. If multiplexing two or three samples, however, two separate PCR reactions per sample should be performed; if running just one sample, four separate PCR reactions should be performed as per the cDNA-PCR Sequencing Kit protocol (SQK-PCS111). These recommendations aim to ensure that enough PCR product is generated for optimal flow cell performance.

Reverse transcriptase is a PCR inhibitor and the reverse-transcribed sample must be diluted enough for PCR to take place.

Note: Use one set of Barcode Primers per sample.

Thaw the following reagents, then spin down briefly using a microfuge and mix as indicated in the table below. Then place the reagents on ice.

Reagent 1. Thaw at room temperature 2. Briefly spin down 3. Mix well by pipetting
Barcode Primers (BP01 - BP24)
Elution Buffer (EB)
LongAmp Hot Start Taq 2X Master Mix
Exonuclease I Not frozen

Spin down the reverse-transcribed RNA samples.

Prepare a separate 0.2 ml PCR tube for each sample and add 5 μl of reverse-transcribed RNA per tube.

Only 5 µl of the reverse-transcribed sample is to be taken forward. Do NOT use all the 22.5 µl of the reverse transcription reaction in a single PCR reaction.

In each of the 0.2 ml PCR tubes containing reverse-transcribed RNA sample, prepare the following reaction at room temperature:

Reagent Volume
Reverse-transcribed sample (from previous step) 5 μl
Unique Barcode Primer (BP01-24) 0.75 μl
Nuclease-free water 6.75 μl
2x LongAmp Hot Start Taq Master Mix 12.5 μl
Total (including all reagents) 25 μl

Mix gently by pipetting.

Amplify using the following cycling conditions.

Cycle step Temperature Time No. of cycles
Initial denaturation 95°C 30 secs 1
Denaturation 95°C 15 secs 10-18*
Annealing 62°C 15 secs 10-18*
Extension 65°C 60 secs per kb 10-18*
Final extension 65°C 6 mins 1
Hold 4°C

*We recommend 14 cycles as a starting point. However, the number of cycles can be adjusted between the values shown according to experimental needs.

For further information, please read The effect of varying the number of PCR cycles in the PCR-cDNA Sequencing Kit document.

Add 1 μl Exonuclease I directly to each PCR tube. Mix by pipetting.

Exonuclease I is added to remove any excess primers which have not successfully annealed.

Incubate the reactions at 37°C for 15 minutes, followed by 80°C for 15 minutes in the thermal cycler.

Transfer each sample to a clean 1.5 ml Eppendorf DNA LoBind tube.

Resuspend the AMPure XP beads by vortexing.

Add 20 µl of resuspended AMPure XP beads to each 1.5 ml Eppendorf DNA LoBind tube.

Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.

Prepare 5 ml of fresh 70% ethanol in nuclease-free water.

Spin down the samples and pellet on a magnet. Keep the tubes on the magnet, and pipette off the supernatant.

Keep the tubes on the magnet and wash the beads with 200 µl of freshly-prepared 70% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.

Repeat the previous step.

Spin down and place the tubes back on the magnet. Pipette off any residual ethanol. Allow to dry for ~30 seconds, but do not dry the pellets to the point of cracking.

Remove the tubes from the magnetic rack and resuspend each pellet in 12 µl of Elution Buffer (EB).

Incubate at room temperature for 10 minutes.

Pellet the beads on the magnet until the eluate is clear and colourless.

Remove and retain 12 µl of each eluate into a separate clean 1.5 ml Eppendorf DNA LoBind tube.

  • Remove and retain the eluate which contains the cDNA library in a clean 1.5 ml Eppendorf DNA LoBind tube
  • Dispose of the pelleted beads

For each sample, analyse 1 µl of the amplified cDNA for size, quantity and quality using a Qubit fluorometer and Agilent Bioanalyzer (or equivalent) for a QC check.

Sometimes a high-molecular weight product is visible in the wells of the gel when the PCR products are run, instead of the expected smear. These libraries are typically associated with poor sequencing performance. We have found that repeating the PCR with fewer cycles can remedy this.

Pool together equimolar samples of the amplified cDNA barcoded samples to a total of 15 – 25 fmols and make the volume up to 23 µl in Elution Buffer (EB).

Mass Molarity if fragment length = 0.5 kb Molarity if fragment length = 1.5 kb Molarity if fragment length = 3 kb
5 ng 16 fmol 5 fmol 3 fmol
10 ng 32 fmol 11 fmol 5 fmol
15 ng 49 fmol 16 fmol 8 fmol
20 ng 65 fmol 22 fmol 11 fmol
25 ng 81 fmol 27 fmol 13 fmol
50 ng 154 fmol 51 fmol 26 fmol

If the quantity of amplified cDNA is above 25 fmol, the remaining cDNA can be frozen and stored for another sequencing experiment (in this case, library preparation would start from the Adapter Addition step). We recommend avoiding multiple freeze-thaw cycles to prevent DNA degradation.

The sequencing adapter used in Kit 11 chemistry has a higher capture rate, enabling lower flow cell loading amounts to give optimal pore occupancy.

Library storage recommendations

We recommend storing libraries in Eppendorf DNA LoBind tubes at -20°C for short term storage or repeated use, for example, re-loading flow cells between washes. For single use and long term storage of more than 3 months, we recommend storing libraries at -80°C in Eppendorf DNA LoBind tubes.

6. Adapter addition

Materials
  • Rapid Adapter T (RAP T)
  • Elution Buffer (EB)
  • RAP Dilution Buffer (RDB) or Adapter Buffer (ADB)

Consumables
  • 1.5 ml Eppendorf DNA LoBind tubes

Equipment
  • Microfuge
  • Ice bucket with ice
  • P1000 pipette and tips
  • P200 pipette and tips
  • P100 pipette and tips
  • P20 pipette and tips
  • P10 pipette and tips
  • P2 pipette and tips

The Rapid Adapter T (RAP T) used in this kit and protocol is not interchangeable with other sequencing adapters.

This kit and protocol is only compatible with Rapid Adapter T (RAP T).

Rapid Adapter T (RAP T) is a new sequencing adapter for Kit 11 chemistry and is higher capture, enabling lower flow cell loading amounts and contains fuel fix technology, enabling users to run long experiments without the need for fuel addition during the run. Therefore, sequencing adapters from other kits and chemistries are not compatible with this kit or protocol.

Spin down the Rapid Adapter T (RAP T) and place on ice.

Thaw the RAP Dilution Buffer (RDB) or Adapter Buffer (ADB) at room temperature, spin down briefly using a microfuge and mix by pipetting before storing on ice.

In a fresh 1.5 ml Eppendorf DNA LoBind tube, dilute Rapid Adapter T (RAP T):

Reagent Volume
Rapid Adapter T (RAP T) 1.2 µl
RAP Dilution Buffer (RDB) or Adapter Buffer (ADB) 6.8 µl
Total 8 µl

Mix well by pipetting and spin down.

Add 1 µl of the diluted Rapid Adapter T (RAP T) to the amplified cDNA library, making the final volume up 24 µl.

Mix well by pipetting and spin down.

Incubate the reaction for 5 minutes at room temperature.

The prepared library is used for loading onto the flow cell. Store the library on ice until ready to load.

Library storage recommendations

We recommend storing libraries in Eppendorf DNA LoBind tubes at 4°C for short-term storage or repeated use, for example, re-loading flow cells between washes. For single use and long-term storage of more than 3 months, we recommend storing libraries at -80°C in Eppendorf DNA LoBind tubes.

7. Priming and loading the flow cell

Materials
  • Flush Buffer (FB)
  • Flush Tether (FLT)
  • Loading Beads II (LBII)
  • Sequencing Buffer II (SBII)
  • Loading Solution (LS)

Consumables
  • PromethION Flow Cells
  • 1.5 ml Eppendorf DNA LoBind tubes

Equipment
  • PromethION 2 Solo or PromethION 24/48 device
  • PromethION device
  • PromethION Flow Cell Light Shield
  • P1000 pipette and tips
  • P200 pipette and tips
  • P20 pipette and tips

Using the Loading Solution

We recommend using the Loading Beads II (LBII) for loading your library onto the flow cell for most sequencing experiments. However, if you have previously used water to load your library, you must use Loading Solution (LS) instead of water. Note: some customers have noticed that viscous libraries can be loaded more easily when not using Loading Beads II.

Thaw the Sequencing Buffer II (SBII), Loading Beads II (LBII) or Loading Solution (LS, if using), Flush Tether (FLT) and Flush Buffer (FB) at room temperature before mixing the reagents by vortexing, and spin down the SBII and FLT at room temperature.

To prepare the flow cell priming mix, add 30 µl of thawed and mixed Flush Tether (FLT) directly to the tube of thawed and mixed Flush Buffer (FB), and mix by vortexing.

After taking flow cells out of the fridge, wait 20 minutes before inserting the flow cell into the PromethION for the flow cell to come to room temperature. Condensation can form on the flow cell in humid environments. Inspect the gold connector pins on the top and underside of the flow cell for condensation and wipe off with a lint-free wipe if any is observed. Ensure the heat pad (black pad) is present on the underside of the flow cell.

For PromethION 2 Solo, load the flow cell(s) as follows:

  1. Place the flow cell flat on the metal plate.

  2. Slide the flow cell into the docking port until the gold pins or green board cannot be seen.

J2068 FC-into-P2-animation V5

For the PromethION 24/48, load the flow cell(s) into the docking ports:

  1. Line up the flow cell with the connector horizontally and vertically before smoothly inserting into position.
  2. Press down firmly onto the flow cell and ensure the latch engages and clicks into place.

Step 1a V3

Step 1B

Insertion of the flow cells at the wrong angle can cause damage to the pins on the PromethION and affect your sequencing results. If you find the pins on a PromethION position are damaged, please contact support@nanoporetech.com for assistance.

Screenshot 2021-04-08 at 12.08.37

Slide the inlet port cover clockwise to open.

Prom loading 2

Take care when drawing back buffer from the flow cell. Do not remove more than 20-30 µl, and make sure that the array of pores are covered by buffer at all times. Introducing air bubbles into the array can irreversibly damage pores.

After opening the inlet port, draw back a small volume to remove any air bubbles:

  1. Set a P1000 pipette tip to 200 µl.
  2. Insert the tip into the inlet port.
  3. Turn the wheel until the dial shows 220-230 µl, or until you see a small volume of buffer entering the pipette tip.

Step 3 v1

Load 500 µl of the priming mix into the flow cell via the inlet port, avoiding the introduction of air bubbles. Wait five minutes. During this time, prepare the library for loading using the next steps in the protocol.

Step 4 v1

Thoroughly mix the contents of the Loading Beads II (LBII) by pipetting.

The Loading Beads II (LBII) tube contains a suspension of beads. These beads settle very quickly. It is vital that they are mixed immediately before use.

In a new tube, prepare the library for loading as follows:

Reagent Volume per flow cell
Sequencing Buffer II (SBII) 75 µl
Loading Beads II (LBII) thoroughly mixed before use, or Loading Solution (LS), if using 51 µl
DNA library 24 µl
Total 150 µl

Complete the flow cell priming by slowly loading 500 µl of the priming mix into the inlet port.

Step 5 v1

Mix the prepared library gently by pipetting up and down just prior to loading.

Using a P1000, insert the pipette tip into the inlet port and add 150 µl of library.

Step 6 v2

Close the valve to seal the inlet port.

Step 7 V2

Install the light shield on your flow cell as soon as library has been loaded for optimal sequencing output.

We recommend leaving the light shield on the flow cell when library is loaded, including during any washing and reloading steps. The shield can be removed when the library has been removed from the flow cell.

If the light shield has been removed from the flow cell, install the light shield as follows:

  1. Align the inlet port cut out of the light shield with the inlet port cover on the flow cell. The leading edge of the light shield should sit above the flow cell ID.
  2. Firmly press the light shield around the inlet port cover. The inlet port clip will click into place underneath the inlet port cover.

J2264 - Light shield animation PromethION Flow Cell 8a FAW

J2264 - Light shield animation PromethION Flow Cell 8b FAW

Close the PromethION lid when ready to start a sequencing run on MinKNOW.

Wait a minimum of 10 minutes after loading the flow cells onto the PromethION before initiating any experiments. This will help to increase the sequencing output.

8. Data acquisition and basecalling

How to start sequencing

Once you have loaded your flow cell, the sequencing run can be started on MinKNOW, our sequencing software that controls the device, data acquisition and real-time basecalling. For more detailed information on setting up and using MinKNOW, please see the MinKNOW protocol.

MinKNOW can be used and set up to sequence in multiple ways:

  • On a computer either direcly or remotely connected to a sequencing device.
  • Directly on a GridION or PromethION 24/48 sequencing device.

For more information on using MinKNOW on a sequencing device, please see the device user manuals:


To start a sequencing run on MinKNOW:

1. Navigate to the start page and click Start sequencing.

2. Fill in your experiment details, such as name and flow cell position and sample ID.

3. Select the sequencing kit used in the library preparation on the Kit page.

4. Configure the sequencing and output parameters for your sequencing run or keep to the default settings on the Run configuration tab.

Note: If basecalling was turned off when a sequencing run was set up, basecalling can be performed post-run on MinKNOW. For more information, please see the MinKNOW protocol.

5. Click Start to initiate the sequencing run.

Data analysis after sequencing

After sequencing has completed on MinKNOW, the flow cell can be reused or returned, as outlined in the Flow cell reuse and returns section.

After sequencing and basecalling, the data can be analysed. For further information about options for basecalling and post-basecalling analysis, please refer to the Data Analysis document.

In the Downstream analysis section, we outline further options for analysing your data.

9. Flow cell reuse and returns

Materials
  • Flow Cell Wash Kit (EXP-WSH004)

After your sequencing experiment is complete, if you would like to reuse the flow cell, please follow the Flow Cell Wash Kit protocol and store the washed flow cell at +2°C to +8°C.

The Flow Cell Wash Kit protocol is available on the Nanopore Community.

We recommend you to wash the flow cell as soon as possible after you stop the run. However, if this is not possible, leave the flow cell on the device and wash it the next day.

Alternatively, follow the returns procedure to send the flow cell back to Oxford Nanopore.

Instructions for returning flow cells can be found here.

If you encounter issues or have questions about your sequencing experiment, please refer to the Troubleshooting Guide that can be found in the online version of this protocol.

10. Downstream analysis

Post-basecalling analysis

There are several options for further analysing your basecalled data:

1. EPI2ME workflows

For in-depth data analysis, Oxford Nanopore Technologies offers a range of bioinformatics tutorials and workflows available in EPI2ME. The platform provides a vehicle where workflows deposited in GitHub by our Research and Applications teams can be showcased with descriptive texts, functional bioinformatics code and example data.

2. Research analysis tools

Oxford Nanopore Technologies' Research division has created a number of analysis tools, which are available in the Oxford Nanopore GitHub repository. The tools are aimed at advanced users, and contain instructions for how to install and run the software. They are provided as-is, with minimal support.

3. Community-developed analysis tools

If a data analysis method for your research question is not provided in any of the resources above, please refer to the resource centre and search for bioinformatics tools for your application. Numerous members of the Nanopore Community have developed their own tools and pipelines for analysing nanopore sequencing data, most of which are available on GitHub. Please be aware that these tools are not supported by Oxford Nanopore Technologies, and are not guaranteed to be compatible with the latest chemistry/software configuration.

11. Issues during DNA/RNA extraction and library preparation

Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

We also have an FAQ section available on the Nanopore Community Support section.

If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

Low sample quality

Observation Possible cause Comments and actions
Low DNA purity (Nanodrop reading for DNA OD 260/280 is <1.8 and OD 260/230 is <2.0–2.2) The DNA extraction method does not provide the required purity The effects of contaminants are shown in the Contaminants document. Please try an alternative extraction method that does not result in contaminant carryover.

Consider performing an additional SPRI clean-up step.
Low RNA integrity (RNA integrity number <9.5 RIN, or the rRNA band is shown as a smear on the gel) The RNA degraded during extraction Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page.
RNA has a shorter than expected fragment length The RNA degraded during extraction Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page.

We recommend working in an RNase-free environment, and to keep your lab equipment RNase-free when working with RNA.

Low DNA recovery after AMPure bead clean-up

Observation Possible cause Comments and actions
Low recovery DNA loss due to a lower than intended AMPure beads-to-sample ratio 1. AMPure beads settle quickly, so ensure they are well resuspended before adding them to the sample.

2. When the AMPure beads-to-sample ratio is lower than 0.4:1, DNA fragments of any size will be lost during the clean-up.
Low recovery DNA fragments are shorter than expected The lower the AMPure beads-to-sample ratio, the more stringent the selection against short fragments. Please always determine the input DNA length on an agarose gel (or other gel electrophoresis methods) and then calculate the appropriate amount of AMPure beads to use. SPRI cleanup
Low recovery after end-prep The wash step used ethanol <70% DNA will be eluted from the beads when using ethanol <70%. Make sure to use the correct percentage.

12. Issues during the sequencing run

Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

We also have an FAQ section available on the Nanopore Community Support section.

If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

Fewer pores at the start of sequencing than after Flow Cell Check

Observation Possible cause Comments and actions
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check An air bubble was introduced into the nanopore array After the Flow Cell Check it is essential to remove any air bubbles near the priming port before priming the flow cell. If not removed, the air bubble can travel to the nanopore array and irreversibly damage the nanopores that have been exposed to air. The best practice to prevent this from happening is demonstrated in this video.
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check The flow cell is not correctly inserted into the device Stop the sequencing run, remove the flow cell from the sequencing device and insert it again, checking that the flow cell is firmly seated in the device and that it has reached the target temperature. If applicable, try a different position on the device (GridION/PromethION).
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check Contaminations in the library damaged or blocked the pores The pore count during the Flow Cell Check is performed using the QC DNA molecules present in the flow cell storage buffer. At the start of sequencing, the library itself is used to estimate the number of active pores. Because of this, variability of about 10% in the number of pores is expected. A significantly lower pore count reported at the start of sequencing can be due to contaminants in the library that have damaged the membranes or blocked the pores. Alternative DNA/RNA extraction or purification methods may be needed to improve the purity of the input material. The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

MinKNOW script failed

Observation Possible cause Comments and actions
MinKNOW shows "Script failed"
Restart the computer and then restart MinKNOW. If the issue persists, please collect the MinKNOW log files and contact Technical Support. If you do not have another sequencing device available, we recommend storing the flow cell and the loaded library at 4°C and contact Technical Support for further storage guidance.

Pore occupancy below 40%

Observation Possible cause Comments and actions
Pore occupancy <40% Not enough library was loaded on the flow cell Ensure you load the recommended amount of good quality library in the relevant library prep protocol onto your flow cell. Please quantify the library before loading and calculate mols using tools like the Promega Biomath Calculator, choosing "dsDNA: µg to pmol"
Pore occupancy close to 0 The Ligation Sequencing Kit was used, and sequencing adapters did not ligate to the DNA Make sure to use the NEBNext Quick Ligation Module (E6056) and Oxford Nanopore Technologies Ligation Buffer (LNB, provided in the sequencing kit) at the sequencing adapter ligation step, and use the correct amount of each reagent. A Lambda control library can be prepared to test the integrity of the third-party reagents.
Pore occupancy close to 0 The Ligation Sequencing Kit was used, and ethanol was used instead of LFB or SFB at the wash step after sequencing adapter ligation Ethanol can denature the motor protein on the sequencing adapters. Make sure the LFB or SFB buffer was used after ligation of sequencing adapters.
Pore occupancy close to 0 No tether on the flow cell Tethers are adding during flow cell priming (FLT/FCT tube). Make sure FLT/FCT was added to FB/FCF before priming.

Shorter than expected read length

Observation Possible cause Comments and actions
Shorter than expected read length Unwanted fragmentation of DNA sample Read length reflects input DNA fragment length. Input DNA can be fragmented during extraction and library prep.

1. Please review the Extraction Methods in the Nanopore Community for best practice for extraction.

2. Visualise the input DNA fragment length distribution on an agarose gel before proceeding to the library prep. DNA gel2 In the image above, Sample 1 is of high molecular weight, whereas Sample 2 has been fragmented.

3. During library prep, avoid pipetting and vortexing when mixing reagents. Flicking or inverting the tube is sufficient.

Large proportion of unavailable pores

Observation Possible cause Comments and actions
Large proportion of unavailable pores (shown as blue in the channels panel and pore activity plot)

image2022-3-25 10-43-25 The pore activity plot above shows an increasing proportion of "unavailable" pores over time.
Contaminants are present in the sample Some contaminants can be cleared from the pores by the unblocking function built into MinKNOW. If this is successful, the pore status will change to "sequencing pore". If the portion of unavailable pores stays large or increases:

1. A nuclease flush using the Flow Cell Wash Kit (EXP-WSH004) can be performed, or
2. Run several cycles of PCR to try and dilute any contaminants that may be causing problems.

Large proportion of inactive pores

Observation Possible cause Comments and actions
Large proportion of inactive/unavailable pores (shown as light blue in the channels panel and pore activity plot. Pores or membranes are irreversibly damaged) Air bubbles have been introduced into the flow cell Air bubbles introduced through flow cell priming and library loading can irreversibly damage the pores. Watch the Priming and loading your flow cell video for best practice
Large proportion of inactive/unavailable pores Certain compounds co-purified with DNA Known compounds, include polysaccharides, typically associate with plant genomic DNA.

1. Please refer to the Plant leaf DNA extraction method.
2. Clean-up using the QIAGEN PowerClean Pro kit.
3. Perform a whole genome amplification with the original gDNA sample using the QIAGEN REPLI-g kit.
Large proportion of inactive/unavailable pores Contaminants are present in the sample The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

Reduction in sequencing speed and q-score later into the run

Observation Possible cause Comments and actions
Reduction in sequencing speed and q-score later into the run For Kit 9 chemistry (e.g. SQK-LSK109), fast fuel consumption is typically seen when the flow cell is overloaded with library (please see the appropriate protocol for your DNA library to see the recommendation). Add more fuel to the flow cell by following the instructions in the MinKNOW protocol. In future experiments, load lower amounts of library to the flow cell.

Temperature fluctuation

Observation Possible cause Comments and actions
Temperature fluctuation The flow cell has lost contact with the device Check that there is a heat pad covering the metal plate on the back of the flow cell. Re-insert the flow cell and press it down to make sure the connector pins are firmly in contact with the device. If the problem persists, please contact Technical Services.

Failed to reach target temperature

Observation Possible cause Comments and actions
MinKNOW shows "Failed to reach target temperature" The instrument was placed in a location that is colder than normal room temperature, or a location with poor ventilation (which leads to the flow cells overheating) MinKNOW has a default timeframe for the flow cell to reach the target temperature. Once the timeframe is exceeded, an error message will appear and the sequencing experiment will continue. However, sequencing at an incorrect temperature may lead to a decrease in throughput and lower q-scores. Please adjust the location of the sequencing device to ensure that it is placed at room temperature with good ventilation, then re-start the process in MinKNOW. Please refer to this link for more information on MinION temperature control.

Guppy – no input .fast5 was found or basecalled

Observation Possible cause Comments and actions
No input .fast5 was found or basecalled input_path did not point to the .fast5 file location The --input_path has to be followed by the full file path to the .fast5 files to be basecalled, and the location has to be accessible either locally or remotely through SSH.
No input .fast5 was found or basecalled The .fast5 files were in a subfolder at the input_path location To allow Guppy to look into subfolders, add the --recursive flag to the command

Guppy – no Pass or Fail folders were generated after basecalling

Observation Possible cause Comments and actions
No Pass or Fail folders were generated after basecalling The --qscore_filtering flag was not included in the command The --qscore_filtering flag enables filtering of reads into Pass and Fail folders inside the output folder, based on their strand q-score. When performing live basecalling in MinKNOW, a q-score of 7 (corresponding to a basecall accuracy of ~80%) is used to separate reads into Pass and Fail folders.

Guppy – unusually slow processing on a GPU computer

Observation Possible cause Comments and actions
Unusually slow processing on a GPU computer The --device flag wasn't included in the command The --device flag specifies a GPU device to use for accelerate basecalling. If not included in the command, GPU will not be used. GPUs are counted from zero. An example is --device cuda:0 cuda:1, when 2 GPUs are specified to use by the Guppy command.
Oxford Nanopore Technologies, the Wheel icon, AmPORE-TB, EPI2ME, GridION, MinION, MinKNOW, PromethION, P2 Solo, and P2 are registered trademarks or the subject of trademark applications of Oxford Nanopore Technologies plc in various countries. Information contained herein may be protected by copyright, patents or patents pending of Oxford Nanopore Technologies plc. All other brands and names contained are the property of their respective owners. Oxford Nanopore Technologies products are RUO. Products labelled/branded as Oxford Nanopore Diagnostics may be RUO or may be regulated as in‐vitro diagnostic devices in some jurisdictions, please check individual product labelling. ONT plc is a member of the producer compliance scheme run by ERP UK Ltd, who manage the submission of documentation in support of WEEE compliance for ONT plc’s manufacture and supply of Electrical and Electronic equipment in the UK. ONT’s WEEE PRN is WEE/MM3828AA.

Last updated: 5/7/2026

Getting started

Buy a MinION starter pack Nanopore store Sequencing service providers Channel partners

Quick links

Intellectual property Cookie policy Corporate reporting Privacy policy Terms, conditions and policies Modern slavery policy Accessibility

About Oxford Nanopore

Contact us News Media resources & contacts Investor centre Careers BSI 27001 accreditationBSI 90001 accreditationBSI mark of trust
English flag