This kit is highly recommended for users who:

• wish to multiplex up to 24 samples to reduce price per sample
• would like to identify and quantify full-length transcripts
• are looking for a faster and simpler method for cDNA synthesis: ~210 minutes library prep + variable time for PCR
• want to explore isoforms, splice variants and fusion transcripts using full-length cDNAs
• wish to start from total RNA
• have a low starting amount of RNA
• would like to generate high amounts of cDNA data

This protocol describes how to carry out sequencing of multiple cDNA samples using a strand-switching method and the PCR-cDNA Barcoding Kit (SQK-PCB111.24). There are 24 unique barcodes available, allowing the user to pool up to 24 different samples in one sequencing experiment. During the strand-switching step, a UMI is incorporated, before the double-stranded cDNA is amplified by PCR using primers containing 5' tags. The amplified and barcoded samples are then pooled together and the Rapid Sequencing Adapters are added to the pooled mix.

A control experiment can be completed first using RNA Control Sample (RCS) from the RNA Control Expansion (EXP-RCS001) as your input to troubleshoot your library preparation or to become familiar with the protocol.

Steps in the sequencing workflow:

Prepare for your experiment

You will need to:

• Extract your RNA, and check its length, quantity and purity The quality checks performed during the protocol are essential in ensuring experimental success
• Ensure you have your sequencing kit, the correct equipment and third-party reagents
• Download the software for acquiring and analysing your data
• Check your flow cell to ensure it has enough pores for a good sequencing run

**Library preparation**

You will need to:

• Using the strand-switching protocol, prepare full-length cDNAs from Poly(A)+ RNA (or total RNA) with the incorporation of the UMI
• Amplify the cDNAs by PCR, adding rapid attachment barcode primers during the PCR step
• Attach sequencing adapters to the PCR products
• Prime the flow cell, and load your cDNA library into the flow cell

Sequencing and analysis

You will need to:

• Start a sequencing run using the MinKNOW software, which will collect raw data from the device and convert it into basecalled reads
• Optional: Start the EPI2ME software and select a workflow for further analysis

It is important that the input RNA meets the quantity and quality requirements. Using too little or too much RNA, or RNA of poor quality (e.g. fragmented or containing chemical contaminants) can affect your library preparation.

For instructions on how to perform quality control of your RNA sample, please read the Input DNA/RNA QC protocol.

For further information on using RNA as input, please read the links below.

• Polyadenylation of non-poly(A) transcripts using E. coli poly(A) polymerase
• RNA contaminants
• RNA stability
• RNA Integrity Number (RIN)
• Enrichment of polyadenylated RNA molecules

These documents can also be found in the DNA/RNA Handling page.

We have validated and recommend the use of all the third-party reagents used in this protocol. Alternatives have not been tested by Oxford Nanopore Technologies.

For all third-party reagents, we recommend following the manufacturer's instructions to prepare the reagents for use.

Name	Acronym	Cap colour	No. of vials	Fill volume per vial (μl)
Strand Switching Primer II	SSPII	Violet	1	350
RT Primer	RTP	Yellow	1	200
cDNA RT Adapter	CRTA	Amber	1	200
Annealing Buffer	AB	Orange	1	200
Rapid Adapter T	RAP T	Green	1	10
RAP Dilution Buffer (or Adapter Buffer)	RDB (or ADB)	Clear	1	100
Elution Buffer	EB	Black	2	1,500
Short Fragment Buffer	SFB	White	4	7,500
Sequencing Buffer II	SBII	Red	1	500
Loading Beads II	LBII	Pink	1	360
Loading Solution	LS	White cap, pink label	1	400
Barcode Primers 1-24	BP01-24	White	24	10
Flush Buffer	FB	Blue	6	1,170
Flush Tether	FLT	White cap, purple label	1	200

The RNA Control Expansion (EXP-RCS001) provides users with RNA Control Sample (RCS) to replace their sample input when performing a control experiment for troubleshooting purposes in the cDNA-PCR Sequencing (SQK-PCS111) and the PCR-cDNA Barcoding Kit (SQK-PCB111.24).

Name	Acronym	Number of vials	Cap colour	Fill volume per vial (µl)
RNA Control Sample	RCS	3	Yellow	25

Below are the barcode primer sequences for PCR-cDNA Barcoding Kit (SQK-PCB109 and SQK-PCB111.24).

Component	Forward sequence	Reverse sequence
BP01	CAAGAAAGTTGTCGGTGTCTTTGTGAC	CAAGAAAGTTGTCGGTGTCTTTGTGTT
BP02	CTCGATTCCGTTTGTAGTCGTCTGTAC	CTCGATTCCGTTTGTAGTCGTCTGTTT
BP03	CGAGTCTTGTGTCCCAGTTACCAGGAC	CGAGTCTTGTGTCCCAGTTACCAGGTT
BP04	CTTCGGATTCTATCGTGTTTCCCTAAC	CTTCGGATTCTATCGTGTTTCCCTATT
BP05	CCTTGTCCAGGGTTTGTGTAACCTTAC	CCTTGTCCAGGGTTTGTGTAACCTTTT
BP06	CTTCTCGCAAAGGCAGAAAGTAGTCAC	CTTCTCGCAAAGGCAGAAAGTAGTCTT
BP07	CGTGTTACCGTGGGAATGAATCCTTAC	CGTGTTACCGTGGGAATGAATCCTTTT
BP08	CTTCAGGGAACAAACCAAGTTACGTAC	CTTCAGGGAACAAACCAAGTTACGTTT
BP09	CAACTAGGCACAGCGAGTCTTGGTTAC	CAACTAGGCACAGCGAGTCTTGGTTTT
BP10	CAAGCGTTGAAACCTTTGTCCTCTCAC	CAAGCGTTGAAACCTTTGTCCTCTCTT
BP11	CGTTTCATCTATCGGAGGGAATGGAAC	CGTTTCATCTATCGGAGGGAATGGATT
BP12	CCAGGTAGAAAGAAGCAGAATCGGAAC	CCAGGTAGAAAGAAGCAGAATCGGATT
BP13	CAGAACGACTTCCATACTCGTGTGAAC	CAGAACGACTTCCATACTCGTGTGATT
BP14	CAACGAGTCTCTTGGGACCCATAGAAC	CAACGAGTCTCTTGGGACCCATAGATT
BP15	CAGGTCTACCTCGCTAACACCACTGAC	CAGGTCTACCTCGCTAACACCACTGTT
BP16	CCGTCAACTGACAGTGGTTCGTACTAC	CCGTCAACTGACAGTGGTTCGTACTTT
BP17	CACCCTCCAGGAAAGTACCTCTGATAC	CACCCTCCAGGAAAGTACCTCTGATTT
BP18	CCCAAACCCAACAACCTAGATAGGCAC	CCCAAACCCAACAACCTAGATAGGCTT
BP19	CGTTCCTCGTGCAGTGTCAAGAGATAC	CGTTCCTCGTGCAGTGTCAAGAGATTT
BP20	CTTGCGTCCTGTTACGAGAACTCATAC	CTTGCGTCCTGTTACGAGAACTCATTT
BP21	CGAGCCTCTCATTGTCCGTTCTCTAAC	CGAGCCTCTCATTGTCCGTTCTCTATT
BP22	CACCACTGCCATGTATCAAAGTACGAC	CACCACTGCCATGTATCAAAGTACGTT
BP23	CCTTACTACCCAGTGAACCTCCTCGAC	CCTTACTACCCAGTGAACCTCCTCGTT
BP24	CGCATAGTTCTGCATGATGGGTTAGAC	CGCATAGTTCTGCATGATGGGTTAGTT

The PromethION device contains all the hardware required to control up to 24 (for the P24 model) or 48 (for the P48 model) sequencing experiments and acquire the data. The device is further enhanced with high performance GPU technology for real-time basecalling. Read more in the PromethION IT requirements document.

The PromethION 2 (P2) Solo is a device which directly connects into a GridION Mk1 or a stand-alone computer that meets the miminum specifications for real-time data streaming and analysis. Up to two PromethION flow cells can be can be run and each is independently addressable, meaning experiments can be run concurrently or individually. For information on the computer IT requirements, please see the PromethION 2 Solo IT requirements document.

MinKNOW

The MinKNOW software controls the nanopore sequencing device, collects sequencing data and basecalls in real time. You will be using MinKNOW for every sequencing experiment to sequence, basecall and demultiplex if your samples were barcoded.

For instructions on how to run the MinKNOW software, please refer to the MinKNOW protocol.

EPI2ME (optional)

The EPI2ME cloud-based platform performs further analysis of basecalled data, for example alignment to the Lambda genome, barcoding, or taxonomic classification. You will use the EPI2ME platform only if you would like further analysis of your data post-basecalling.

For instructions on how to create an EPI2ME account and install the EPI2ME Desktop Agent, please refer to this link.

We highly recommend that you check the number of pores in your flow cell prior to starting a sequencing experiment. This should be done within 12 weeks of purchasing for MinION/GridION/PromethION or within four weeks of purchasing Flongle Flow Cells. Oxford Nanopore Technologies will replace any flow cell with fewer than the number of pores in the table below, when the result is reported within two days of performing the flow cell check, and when the storage recommendations have been followed. To do the flow cell check, please follow the instructions in the Flow Cell Check document.

Flow cell	Minimum number of active pores covered by warranty
Flongle Flow Cell	50
MinION/GridION Flow Cell	800
PromethION Flow Cell	5000

We recommend using the Loading Beads II (LBII) for loading your library onto the flow cell for most sequencing experiments. However, if you have previously used water to load your library, you must use Loading Solution (LS) instead of water. Note: some customers have noticed that viscous libraries can be loaded more easily when not using Loading Beads II.

Once you have loaded your flow cell, the sequencing run can be started on MinKNOW, our sequencing software that controls the device, data acquisition and real-time basecalling. For more detailed information on setting up and using MinKNOW, please see the MinKNOW protocol.

MinKNOW can be used and set up to sequence in multiple ways:

• On a computer either direcly or remotely connected to a sequencing device.
• Directly on a GridION or PromethION 24/48 sequencing device.

For more information on using MinKNOW on a sequencing device, please see the device user manuals:

• PromethION 24/48 user manual
• PromethION 2 Solo user manual

---

To start a sequencing run on MinKNOW:

1. Navigate to the start page and click Start sequencing.

2. Fill in your experiment details, such as name and flow cell position and sample ID.

3. Select the sequencing kit used in the library preparation on the Kit page.

4. Configure the sequencing and output parameters for your sequencing run or keep to the default settings on the Run configuration tab.

Note: If basecalling was turned off when a sequencing run was set up, basecalling can be performed post-run on MinKNOW. For more information, please see the MinKNOW protocol.

5. Click Start to initiate the sequencing run.

After sequencing has completed on MinKNOW, the flow cell can be reused or returned, as outlined in the Flow cell reuse and returns section.

After sequencing and basecalling, the data can be analysed. For further information about options for basecalling and post-basecalling analysis, please refer to the Data Analysis document.

In the Downstream analysis section, we outline further options for analysing your data.

There are several options for further analysing your basecalled data:

1. EPI2ME workflows

For in-depth data analysis, Oxford Nanopore Technologies offers a range of bioinformatics tutorials and workflows available in EPI2ME. The platform provides a vehicle where workflows deposited in GitHub by our Research and Applications teams can be showcased with descriptive texts, functional bioinformatics code and example data.

2. Research analysis tools

Oxford Nanopore Technologies' Research division has created a number of analysis tools, which are available in the Oxford Nanopore GitHub repository. The tools are aimed at advanced users, and contain instructions for how to install and run the software. They are provided as-is, with minimal support.

3. Community-developed analysis tools

If a data analysis method for your research question is not provided in any of the resources above, please refer to the resource centre and search for bioinformatics tools for your application. Numerous members of the Nanopore Community have developed their own tools and pipelines for analysing nanopore sequencing data, most of which are available on GitHub. Please be aware that these tools are not supported by Oxford Nanopore Technologies, and are not guaranteed to be compatible with the latest chemistry/software configuration.

We also have an FAQ section available on the Nanopore Community Support section.

If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

We also have an FAQ section available on the Nanopore Community Support section.

If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.