PCR-cDNA Barcoding Kit (SQK-PCB111.24)

Oxford Nanopore Technologies
Document type icon

Protocol

PCR-cDNA Barcoding Kit (SQK-PCB111.24) VPCB_9155_v111_revL_18May2022

The fastest and simplest protocol for full-length cDNA sequencing

  • Offering highest yield
  • Higher yields than traditional cDNA synthesis
  • Splice variants and fusion transcripts
  • Multiplex up to 24 different samples
  • Compatible with R9.4.1 flow cells only

For Research Use Only

This is a Legacy product This kit is soon to be discontinued and we recommend all customers to upgrade to the latest chemistry for their relevant kit which is available on the Store. If customers require further support for any ongoing critical experiments using a Legacy product, please contact Customer Support via email: support@nanoporetech.com.

FOR RESEARCH USE ONLY

Overview

The fastest and simplest protocol for full-length cDNA sequencing

  • Offering highest yield
  • Higher yields than traditional cDNA synthesis
  • Splice variants and fusion transcripts
  • Multiplex up to 24 different samples
  • Compatible with R9.4.1 flow cells only

For Research Use Only

This is a Legacy product This kit is soon to be discontinued and we recommend all customers to upgrade to the latest chemistry for their relevant kit which is available on the Store. If customers require further support for any ongoing critical experiments using a Legacy product, please contact Customer Support via email: support@nanoporetech.com.

Document version: PCB_9155_v111_revL_18May2022

1. Overview of the protocol

IMPORTANTE

This is a Legacy product

This kit is soon to be discontinued and we recommend all customers to upgrade to the latest chemistry for their relevant kit which is available on the Store. If customers require further support for any ongoing critical experiments using a Legacy product, please contact Customer Support via email: support@nanoporetech.com. For further information on please see the product update page.

PCR-cDNA Barcoding Kit features:

This kit is highly recommended for users who:

  • wish to multiplex up to 24 samples to reduce price per sample
  • would like to identify and quantify full-length transcripts
  • are looking for a faster and simpler method for cDNA synthesis: ~210 minutes library prep + variable time for PCR
  • want to explore isoforms, splice variants and fusion transcripts using full-length cDNAs
  • wish to start from total RNA
  • have a low starting amount of RNA
  • would like to generate high amounts of cDNA data

Introduction to the PCR-cDNA Barcoding Kit protocol

This protocol describes how to carry out sequencing of multiple cDNA samples using a strand-switching method and the PCR-cDNA Barcoding Kit (SQK-PCB111.24). There are 24 unique barcodes available, allowing the user to pool up to 24 different samples in one sequencing experiment. During the strand-switching step, a UMI is incorporated, before the double-stranded cDNA is amplified by PCR using primers containing 5' tags. The amplified and barcoded samples are then pooled together and the Rapid Sequencing Adapters are added to the pooled mix.

A control experiment can be completed first using RNA Control Sample (RCS) from the RNA Control Expansion (EXP-RCS001) as your input to troubleshoot your library preparation or to become familiar with the protocol.

Steps in the sequencing workflow:

Prepare for your experiment

You will need to:

  • Extract your RNA, and check its length, quantity and purity The quality checks performed during the protocol are essential in ensuring experimental success
  • Ensure you have your sequencing kit, the correct equipment and third-party reagents
  • Download the software for acquiring and analysing your data
  • Check your flow cell to ensure it has enough pores for a good sequencing run

**Library preparation**

You will need to:

  • Using the strand-switching protocol, prepare full-length cDNAs from Poly(A)+ RNA (or total RNA) with the incorporation of the UMI
  • Amplify the cDNAs by PCR, adding rapid attachment barcode primers during the PCR step
  • Attach sequencing adapters to the PCR products
  • Prime the flow cell, and load your cDNA library into the flow cell

PCB111.24

Sequencing and analysis

You will need to:

  • Start a sequencing run using the MinKNOW software, which will collect raw data from the device and convert it into basecalled reads
  • Optional: Start the EPI2ME software and select a workflow for further analysis
IMPORTANTE

Compatibilities of this protocol

This protocol should only be used in combination with:

  • PCR-cDNA Barcoding Kit (SQK-PCB111.24)
  • R9.4.1 flow cells (FLO-PRO002)
  • Flow Cell Wash Kit (EXP-WSH004)
  • RNA Control Expansion (EXP-RCS001)

2. Equipment and consumables

Material
  • 4 ng enriched RNA (Poly(A)+ RNA or ribodepleted) or 200 ng total RNA
  • PCR-cDNA Barcoding Kit (SQK-PCB111.24)
Consumibles
  • Agencourt RNAClean XP beads (Beckman Coulter™, cat # A63987)
  • Agencourt AMPure XP beads (Beckman Coulter™ cat # A63881)
  • Lambda Exonuclease (NEB, Cat # M0262L)
  • NEBNext® Quick Ligation Reaction Buffer (NEB, B6058)
  • T4 DNA Ligase 2M U/ml (NEB, cat # M0202M)
  • 10 mM dNTP solution (e.g. NEB N0447)
  • LongAmp Hot Start Taq 2X Master Mix (NEB, M0533)
  • Maxima H Minus Reverse Transcriptase (200 U/µl) with 5x RT Buffer (ThermoFisher, cat # EP0751)
  • RNaseOUT™, 40 U/μl (Life Technologies, cat # 10777019)
  • USER (Uracil-Specific Excision Reagent) Enzyme (NEB, cat # M5505L)
  • Exonuclease I (NEB, Cat # M0293)
  • Nuclease-free water (e.g. ThermoFisher, AM9937)
  • Freshly prepared 70% ethanol in nuclease-free water
  • 1.5 ml Eppendorf DNA LoBind tubes
  • 0.2 ml thin-walled PCR tubes
  • Qubit RNA HS Assay Kit (ThermoFisher, cat # Q32852)
  • Qubit dsDNA HS Assay Kit (ThermoFisher, cat # Q32851)
  • Tubos de ensayo Qubit™ (Invitrogen Q32856)
Instrumental
  • Mezclador Hula (mezclador giratorio suave)
  • Separador magnético, adecuado para tubos Eppendorf de 1,5 ml
  • Microcentrífuga
  • Mezclador vórtex
  • Thermal cycler
  • Pipeta y puntas P1000
  • Pipeta y puntas P200
  • Pipeta y puntas P100
  • Pipeta y puntas P20
  • Pipeta y puntas P10
  • Pipeta y puntas P2
  • Cubeta con hielo
  • Temporizador
  • Fluorímetro Qubit (o equivalente para el control de calidad)
  • Agilent Bioanalyzer (or equivalent)

For this protocol, you will need 4 ng enriched RNA (Poly(A)+ RNA or ribodepleted) or 200 ng total RNA.

Input RNA

It is important that the input RNA meets the quantity and quality requirements. Using too little or too much RNA, or RNA of poor quality (e.g. fragmented or containing chemical contaminants) can affect your library preparation.

For instructions on how to perform quality control of your RNA sample, please read the Input DNA/RNA QC protocol.

For further information on using RNA as input, please read the links below.

These documents can also be found in the DNA/RNA Handling page.

Reactivos de otros fabricantes

Oxford Nanopore Technologies ha probado y recomienda el uso de todos los reactivos de otros fabricantes citados en este protocolo. No se han evaluado otras alternativas.

Se recomienda preparar estos reactivos siguiendo las instrucciones del fabricante.

PCR-cDNA Barcoding Kit (SQK-PCB111.24) contents

SQK-PCB111.24 2

Name Acronym Cap colour No. of vials Fill volume per vial (μl)
Strand Switching Primer II SSPII Violet 1 350
RT Primer RTP Yellow 1 200
cDNA RT Adapter CRTA Amber 1 200
Annealing Buffer AB Orange 1 200
Rapid Adapter T RAP T Green 1 10
RAP Dilution Buffer
(or Adapter Buffer)		 RDB
(or ADB)		 Clear 1 100
Elution Buffer EB Black 2 1,500
Short Fragment Buffer SFB White 4 7,500
Sequencing Buffer II SBII Red 1 500
Loading Beads II LBII Pink 1 360
Loading Solution LS White cap, pink label 1 400
Barcode Primers 1-24 BP01-24 White 24 10
Flush Buffer FB Blue 6 1,170
Flush Tether FLT White cap, purple label 1 200
IMPORTANTE

RAP Dilution Buffer (RDB) and Adapter Buffer (ADB) can be used interchangably with this kit.

As we move into the Legacy and Discontinuation phases for this kit, we have replaced some of the vials with our newer versions in recent production batches.

The original RAP Dilution Buffer (RDB) vials and our new Adapter Buffer (ADB) vials contain the same reagent and can be used interchangeably with this kit.

RNA Control Expansion (EXP-RCS001)

The RNA Control Expansion (EXP-RCS001) provides users with RNA Control Sample (RCS) to replace their sample input when performing a control experiment for troubleshooting purposes in the cDNA-PCR Sequencing (SQK-PCS111) and the PCR-cDNA Barcoding Kit (SQK-PCB111.24).

RCS001

Name Acronym Number of vials Cap colour Fill volume per vial (µl)
RNA Control Sample RCS 3 Yellow 25
IMPORTANTE

Rapid Adapter T (RAP T) used in this kit and protocol is not interchangeable with other sequencing adapters.

Barcode primer sequences

Below are the barcode primer sequences for PCR-cDNA Barcoding Kit (SQK-PCB109 and SQK-PCB111.24).

Component Forward sequence Reverse sequence
BP01 CAAGAAAGTTGTCGGTGTCTTTGTGAC CAAGAAAGTTGTCGGTGTCTTTGTGTT
BP02 CTCGATTCCGTTTGTAGTCGTCTGTAC CTCGATTCCGTTTGTAGTCGTCTGTTT
BP03 CGAGTCTTGTGTCCCAGTTACCAGGAC CGAGTCTTGTGTCCCAGTTACCAGGTT
BP04 CTTCGGATTCTATCGTGTTTCCCTAAC CTTCGGATTCTATCGTGTTTCCCTATT
BP05 CCTTGTCCAGGGTTTGTGTAACCTTAC CCTTGTCCAGGGTTTGTGTAACCTTTT
BP06 CTTCTCGCAAAGGCAGAAAGTAGTCAC CTTCTCGCAAAGGCAGAAAGTAGTCTT
BP07 CGTGTTACCGTGGGAATGAATCCTTAC CGTGTTACCGTGGGAATGAATCCTTTT
BP08 CTTCAGGGAACAAACCAAGTTACGTAC CTTCAGGGAACAAACCAAGTTACGTTT
BP09 CAACTAGGCACAGCGAGTCTTGGTTAC CAACTAGGCACAGCGAGTCTTGGTTTT
BP10 CAAGCGTTGAAACCTTTGTCCTCTCAC CAAGCGTTGAAACCTTTGTCCTCTCTT
BP11 CGTTTCATCTATCGGAGGGAATGGAAC CGTTTCATCTATCGGAGGGAATGGATT
BP12 CCAGGTAGAAAGAAGCAGAATCGGAAC CCAGGTAGAAAGAAGCAGAATCGGATT
BP13 CAGAACGACTTCCATACTCGTGTGAAC CAGAACGACTTCCATACTCGTGTGATT
BP14 CAACGAGTCTCTTGGGACCCATAGAAC CAACGAGTCTCTTGGGACCCATAGATT
BP15 CAGGTCTACCTCGCTAACACCACTGAC CAGGTCTACCTCGCTAACACCACTGTT
BP16 CCGTCAACTGACAGTGGTTCGTACTAC CCGTCAACTGACAGTGGTTCGTACTTT
BP17 CACCCTCCAGGAAAGTACCTCTGATAC CACCCTCCAGGAAAGTACCTCTGATTT
BP18 CCCAAACCCAACAACCTAGATAGGCAC CCCAAACCCAACAACCTAGATAGGCTT
BP19 CGTTCCTCGTGCAGTGTCAAGAGATAC CGTTCCTCGTGCAGTGTCAAGAGATTT
BP20 CTTGCGTCCTGTTACGAGAACTCATAC CTTGCGTCCTGTTACGAGAACTCATTT
BP21 CGAGCCTCTCATTGTCCGTTCTCTAAC CGAGCCTCTCATTGTCCGTTCTCTATT
BP22 CACCACTGCCATGTATCAAAGTACGAC CACCACTGCCATGTATCAAAGTACGTT
BP23 CCTTACTACCCAGTGAACCTCCTCGAC CCTTACTACCCAGTGAACCTCCTCGTT
BP24 CGCATAGTTCTGCATGATGGGTTAGAC CGCATAGTTCTGCATGATGGGTTAGTT

3. Computer requirements and software

PromethION 24/48 IT requirements

The PromethION device contains all the hardware required to control up to 24 (for the P24 model) or 48 (for the P48 model) sequencing experiments and acquire the data. The device is further enhanced with high performance GPU technology for real-time basecalling. Read more in the PromethION IT Requirements document.

PromethION 2 Solo IT requirements

The PromethION 2 (P2) Solo is a device which directly connects into a GridION Mk1 or a stand-alone computer that meets the miminum specifications for real-time data streaming and analysis. Up to two PromethION flow cells can be can be run and each is independently addressable, meaning experiments can be run concurrently or individually. For information on the computer IT requirements, please see the PromethION 2 Solo IT requirements document.

Software for nanopore sequencing

MinKNOW

The MinKNOW software controls the nanopore sequencing device, collects sequencing data and basecalls in real time. You will be using MinKNOW for every sequencing experiment to sequence, basecall and demultiplex if your samples were barcoded.

For instructions on how to run the MinKNOW software, please refer to the MinKNOW protocol.

EPI2ME (optional)

The EPI2ME cloud-based platform performs further analysis of basecalled data, for example alignment to the Lambda genome, barcoding, or taxonomic classification. You will use the EPI2ME platform only if you would like further analysis of your data post-basecalling.

For instructions on how to create an EPI2ME account and install the EPI2ME Desktop Agent, please refer to the EPI2ME Platform protocol.

Verificar la celda de flujo

Antes de empezar el experimento de secuenciación, recomendamos verificar el número de poros disponibles, presentes en la celda de flujo. La comprobación deberá realizarse en los primeros tres meses desde su adquisición, si se trata de celdas de flujo MinION, GridION o PromethION, y en las primeras cuatro semanas tras la compra de celdas de flujo Flongle. Oxford Nanopore Technologies sustituirá cualquier celda de flujo con un número de poros inferior al indicado en la tabla siguiente, siempre y cuando el resultado se notifique dentro de los dos días siguientes a la comprobación y se hayan seguido las instrucciones de almacenamiento. Para verificar la celda de flujo, siga las instrucciones del documento Flow Cell Check.

Celda de flujo Número mínimo de poros activos cubierto por la garantía
Flongle 50
MinION/GridION 800
PromethION 5000

4. Reverse transcription and strand-switching

Material
  • 4 ng enriched RNA (Poly(A)+ RNA or ribodepleted) or 200 ng total RNA
  • cDNA RT Adapter (CRTA)
  • Annealing Buffer (AB)
  • Short Fragment Buffer (SFB)
  • RT Primer (RTP)
  • Strand Switching Primer II (SSPII)
Consumibles
  • Nuclease-free water (e.g. ThermoFisher, cat # AM9937)
  • NEBNext® Quick Ligation Reaction Buffer (NEB, B6058)
  • T4 DNA Ligase 2M U/ml (NEB, cat # M0202M)
  • Lambda Exonuclease (NEB, Cat # M0262L)
  • USER (Uracil-Specific Excision Reagent) Enzyme (NEB, cat # M5505L)
  • Agencourt RNAClean XP beads (Beckman Coulter™, cat # A63987)
  • 10 mM dNTP solution (e.g. NEB cat # N0447)
  • Maxima H Minus Reverse Transcriptase (200 U/µl) with 5x RT Buffer (ThermoFisher, cat # EP0751)
  • RNaseOUT™, 40 U/μl (Life Technologies, cat # 10777019)
  • 1.5 ml Eppendorf DNA LoBind tubes
  • 0.2 ml thin-walled PCR tubes
  • Qubit RNA HS Assay Kit (ThermoFisher, cat # Q32852)
  • Tubos de ensayo Qubit™ (Invitrogen Q32856)
Instrumental
  • Microcentrífuga
  • Thermal cycler
  • Pipeta y puntas P1000
  • Pipeta y puntas P200
  • Pipeta y puntas P100
  • Pipeta y puntas P20
  • Pipeta y puntas P10
  • Pipeta y puntas P2
  • Fluorímetro Qubit (o equivalente para el control de calidad)

Thaw the following reagents, then spin down briefly using a microfuge and mix as indicated in the table below. Then place the reagents on ice.

Reagent 1. Thaw at room temperature 2. Briefly spin down 3. Mix well by pipetting
cDNA RT Adapter (CRTA) ✓ ✓ ✓
Annealing Buffer (AB) ✓ ✓ ✓
Short Fragment Buffer (SFB) ✓ ✓ ✓
RT Primer (RTP) ✓ ✓ ✓
Strand Switching Primer II (SSPII) ✓ ✓ ✓
NEBNext® Quick Ligation Reaction Buffer ✓ ✓ Mix by vortexing
T4 DNA Ligase 2M U/ml Not frozen ✓ ✓
RNaseOUT Not frozen ✓ ✓
Lambda Exonuclease Not frozen ✓ ✓
Uracil-Specific Excision Reagent (USER) Not frozen ✓ ✓
10 mM dNTP solution ✓ ✓ ✓
Maxima H Minus Reverse Transcriptase Not frozen ✓ ✓
Maxima H Minus 5x RT Buffer ✓ ✓ Mix by vortexing
IMPORTANTE

It is important that the NEBNext Quick Ligation Reaction Buffer is mixed well by vortexing.

Check for any visible precipitate; vortexing for at least 30 seconds may be required to solubilise all precipitate.

MEDIDA OPCIONAL

To run a control experiment, replace your sample input with 10 μl diluted RNA Control Sample (RCS) from the RNA Control Expansion (EXP-RCS001) as follows:

  • Thaw the RNA Control Sample (RCS) at room temperature, briefly spin down and mix well by pipetting.
  • Dilute the RNA Control Sample (RCS) in a 1.5 ml Eppendorf DNA LoBind tube as follows:
Reagent Volume
RNA Control Sample (RCS) 1 μl
Nuclease-free water 14 μl
Total 15 μl

Note: This will provide enough volume for 3 samples, adjust your volumes accordingly for the number of samples you wish to run in your control experiment.

  • Mix thoroughly by pipetting 10-20 times and briefly spin down.
  • Take forward 4 μl of the diluted RNA Control Sample (RCS) per sample and make up each volume to 10 μl with nuclease-free water as follows:
Reagent Volume
Diluted RNA Control Sample (RCS) 4 μl
Nuclease-free water 6 μl
Total volume per sample 10 μl
  • Mix by flicking the tube and spin down.
  • Use the 10 μl of diluted RNA Control Sample (RCS) as your RNA input.

For each sample, prepare the RNA in nuclease-free water.

  • Transfer 4 ng Poly(A)+ RNA, or 200 ng total RNA into a 1.5 ml Eppendorf DNA LoBind tube
  • Adjust the volume up to 10 µl with nuclease-free water
  • Mix by flicking the tube to avoid unwanted shearing
  • Spin down briefly in a microfuge

Prepare the following in a 0.2 ml PCR tube per sample:

Reagent Volume
RNA 10 µl
cDNA RT Adapter (CRTA) 1 µl
Annealing Buffer (AB) 1 µl
Total volume 12 µl
CONSEJO

The cDNA RT Adapter (CRTA) is a double stranded adapter with a poly(T) overhang which anneals to the very end of the poly(A) tail of the RNA strand. This ensures that the full length of the RNA is reverse transcribed and that the poly(A) length can be estimated accurately. Annealing Buffer (AB) has been included to improve CRTA ligation.

Mix gently by flicking the tubes, and spin down.

Incubate the reactions in the thermal cycler at 60°C for 5 mins, then cool for 10 minutes at room temperature.

To each of the 0.2 ml PCR tubes containing you RNA sample(s), add the following:

Reaction Volume
RNA sample (from previous step) 12 µl
NEBNext® Quick Ligation Reaction Buffer 3.6 µl
T4 DNA Ligase 2M U/ml 1.4 µl
RNaseOUT 1 µl
Total volume (including all reagents) 18 µl

Ensure the components are thoroughly mixed by flicking the tubes and spin down.

Incubate for 10 minutes at room temperature.

To each of the 0.2 ml PCR tubes, add the following:

Reagent Volume
RNA sample (from previous step) 18 µl
Lambda Exonuclease 1 µl
USER (Uracil-Specific Excision Reagent) 1 µl
Total volume (including all reagents) 20 µl
CONSEJO

The Lambda Exonuclease and Uracil-Specific Excision Reagent (USER) are third-party reagents used in the preparation of the reverse transcription step. Lambda Exonuclease and USER digest the bottom strand of the ligated CRTA so that the RT Primer (RTP) can bind the CRTA sequence as a primer for the reverse transcription of the RNA.

Ensure the components are thoroughly mixed by flicking the tubes and spin down.

Incubate for 15 minutes at 37°C in the thermal cycler.

Transfer each sample to clean 1.5 ml Eppendorf DNA LoBind tubes.

Resuspend the RNase-free XP beads by vortexing.

Add 36 µl of resuspended RNase-free XP beads to each reaction and mix gently by flicking the tubes.

Incubar en el mezclador Hula (o mezclador giratorio suave) durante 5 minutos a temperatura ambiente.

Spin down the samples and pellet on a magnet. Keep the tubes on the magnet, and pipette off the supernatant.

Keep the tubes on the magnet and wash the beads with 100 µl of Short Fragment Buffer (SFB) without disturbing the pellet. Remove the SFB using a pipette and discard.

Repeat the previous step.

Spin down and place the tubes back on the magnet. Pipette off any residual buffer. Briefly allow to dry for ~30 seconds, but do not dry the pellet to the point of cracking.

Remove the tubes from the magnetic rack and resuspend each pellet in 12 µl of nuclease-free water.

Incubate at room temperature for 10 minutes.

Pellet the beads on a magnet until the eluate is clear and colourless.

Remove and retain 12 µl of eluate into a clean 0.2 ml thin-walled PCR tube per sample.

To each of the 0.2 ml PCR tubes, add the following:

Reagents Volume
Eluted sample (from previous step) 12 µl
RT Primer (RTP) 1 µl
dNTPs (10 mM) 1 µl
Total volume (including all reagents) 14 µl
CONSEJO

RT Primer (RTP) is a single stranded primer and binds upstream of the poly(A) tail of the RNA transcript to prime for reverse transcription.

Ensure the components are thoroughly mixed by flicking the tubes and spin down.

Incubate the reaction for 15 minutes at room temperature.

To each of the 0.2 ml PCR tubes, add the following:

Reagents Volume
RT primed sample (from previous step) 14 µl
Maxima H Minus 5x RT Buffer 4.5 µl
RNaseOUT 1 µl
Strand Switching Primer II (SSPII) 2 µl
Total (including all reagents) 21.5 µl
CONSEJO

Strand Switching Primer II (SSPII) base pairs to the deoxycytidine present at the 5' end of the first cDNA strand synthesised. This allows the reverse transcriptase to "strand-switch" for synthesis of the second cDNA strand.

Mix gently by flicking the tubes, and spin down.

Incubate at 42°C for 2 minutes in the thermal cycler.

Add 1 µl of Maxima H Minus Reverse Transcriptase to each tube. The total volume will be 22.5 µl per tube.

Mix gently by flicking the tubes, and spin down.

Incubate using the following protocol using a thermal cycler:

Cycle step Temperature Time No. of cycles
Reverse transcription and strand-switching 42°C 90 mins 1
Heat inactivation 85°C 5 mins 1
Hold 4°C ∞
FIN DEL PROCESO

Take your samples forward into the next step. However, at this point it is also possible to store the sample at -20°C overnight.

5. Selecting for full-length transcripts by PCR

Material
  • Barcode Primers (BP01-24)
  • Elution Buffer (EB)
Consumibles
  • Nuclease-free water (e.g. ThermoFisher, cat # AM9937)
  • LongAmp Hot Start Taq 2X Master Mix (NEB, M0533)
  • Exonuclease I (NEB, Cat # M0293)
  • Agencourt AMPure XP beads (Beckman Coulter™ cat # A63881)
  • Freshly prepared 70% ethanol in nuclease-free water
  • 0.2 ml PCR tubes
  • Tubos de 1,5 ml Eppendorf DNA LoBind
  • Qubit dsDNA HS Assay Kit (Invitrogen Q32851) (kit de ensayo ADNbc alta sensibilidad)
  • Tubos de ensayo Qubit™ (Invitrogen Q32856)
Instrumental
  • Thermal cycler
  • Mezclador vórtex
  • Mezclador Hula (mezclador giratorio suave)
  • Separador magnético, adecuado para tubos Eppendorf de 1,5 ml
  • Cubeta con hielo
  • Pipeta y puntas P1000
  • Pipeta y puntas P200
  • Pipeta y puntas P100
  • Pipeta y puntas P20
  • Pipeta y puntas P10
  • Pipeta y puntas P2
  • Fluorímetro Qubit (o equivalente para el control de calidad)
  • Agilent Bioanalyzer (or equivalent)
IMPORTANTE

This kit enables multiplexing of up to 24 samples. The default method allows you to perform one 25 µl PCR reaction per sample. If multiplexing two or three samples, however, two separate PCR reactions per sample should be performed; if running just one sample, four separate PCR reactions should be performed as per the cDNA-PCR Sequencing Kit protocol (SQK-PCS111). These recommendations aim to ensure that enough PCR product is generated for optimal flow cell performance.

Reverse transcriptase is a PCR inhibitor and the reverse-transcribed sample must be diluted enough for PCR to take place.

Note: Use one set of Barcode Primers per sample.

Thaw the following reagents, then spin down briefly using a microfuge and mix as indicated in the table below. Then place the reagents on ice.

Reagent 1. Thaw at room temperature 2. Briefly spin down 3. Mix well by pipetting
Barcode Primers (BP01 - BP24) ✓ ✓ ✓
Elution Buffer (EB) ✓ ✓ ✓
LongAmp Hot Start Taq 2X Master Mix ✓ ✓ ✓
Exonuclease I Not frozen ✓ ✓

Spin down the reverse-transcribed RNA samples.

Prepare a separate 0.2 ml PCR tube for each sample and add 5 μl of reverse-transcribed RNA per tube.

IMPORTANTE

Only 5 µl of the reverse-transcribed sample is to be taken forward. Do NOT use all the 22.5 µl of the reverse transcription reaction in a single PCR reaction.

In each of the 0.2 ml PCR tubes containing reverse-transcribed RNA sample, prepare the following reaction at room temperature:

Reagent Volume
Reverse-transcribed sample (from previous step) 5 μl
Unique Barcode Primer (BP01-24) 0.75 μl
Nuclease-free water 6.75 μl
2x LongAmp Hot Start Taq Master Mix 12.5 μl
Total (including all reagents) 25 μl

Mix gently by pipetting.

Amplify using the following cycling conditions.

Cycle step Temperature Time No. of cycles
Initial denaturation 95°C 30 secs 1
Denaturation 95°C 15 secs 10-18*
Annealing 62°C 15 secs 10-18*
Extension 65°C 60 secs per kb 10-18*
Final extension 65°C 6 mins 1
Hold 4°C ∞

*We recommend 14 cycles as a starting point. However, the number of cycles can be adjusted between the values shown according to experimental needs.

For further information, please read The effect of varying the number of PCR cycles in the PCR-cDNA Sequencing Kit document.

Add 1 μl Exonuclease I directly to each PCR tube. Mix by pipetting.

CONSEJO

Exonuclease I is added to remove any excess primers which have not successfully annealed.

Incubate the reactions at 37°C for 15 minutes, followed by 80°C for 15 minutes in the thermal cycler.

Transfer each sample to a clean 1.5 ml Eppendorf DNA LoBind tube.

Resuspend the AMPure XP beads by vortexing.

Add 20 µl of resuspended AMPure XP beads to each 1.5 ml Eppendorf DNA LoBind tube.

Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.

Prepare 5 ml of fresh 70% ethanol in nuclease-free water.

Spin down the samples and pellet on a magnet. Keep the tubes on the magnet, and pipette off the supernatant.

Keep the tubes on the magnet and wash the beads with 200 µl of freshly-prepared 70% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.

Repetir el paso anterior.

Spin down and place the tubes back on the magnet. Pipette off any residual ethanol. Allow to dry for ~30 seconds, but do not dry the pellets to the point of cracking.

Remove the tubes from the magnetic rack and resuspend each pellet in 12 µl of Elution Buffer (EB).

Incubate at room temperature for 10 minutes.

Pellet the beads on the magnet until the eluate is clear and colourless.

Remove and retain 12 µl of each eluate into a separate clean 1.5 ml Eppendorf DNA LoBind tube.

  • Remove and retain the eluate which contains the cDNA library in a clean 1.5 ml Eppendorf DNA LoBind tube
  • Dispose of the pelleted beads

For each sample, analyse 1 µl of the amplified cDNA for size, quantity and quality using a Qubit fluorometer and Agilent Bioanalyzer (or equivalent) for a QC check.

IMPORTANTE

Sometimes a high-molecular weight product is visible in the wells of the gel when the PCR products are run, instead of the expected smear. These libraries are typically associated with poor sequencing performance. We have found that repeating the PCR with fewer cycles can remedy this.

Pool together equimolar samples of the amplified cDNA barcoded samples to a total of 15 – 25 fmols and make the volume up to 23 µl in Elution Buffer (EB).

Mass Molarity if fragment length = 0.5 kb Molarity if fragment length = 1.5 kb Molarity if fragment length = 3 kb
5 ng 16 fmol 5 fmol 3 fmol
10 ng 32 fmol 11 fmol 5 fmol
15 ng 49 fmol 16 fmol 8 fmol
20 ng 65 fmol 22 fmol 11 fmol
25 ng 81 fmol 27 fmol 13 fmol
50 ng 154 fmol 51 fmol 26 fmol

If the quantity of amplified cDNA is above 25 fmol, the remaining cDNA can be frozen and stored for another sequencing experiment (in this case, library preparation would start from the Adapter Addition step). We recommend avoiding multiple freeze-thaw cycles to prevent DNA degradation.

The sequencing adapter used in Kit 11 chemistry has a higher capture rate, enabling lower flow cell loading amounts to give optimal pore occupancy.

CONSEJO

Library storage recommendations

We recommend storing libraries in Eppendorf DNA LoBind tubes at -20°C for short term storage or repeated use, for example, re-loading flow cells between washes. For single use and long term storage of more than 3 months, we recommend storing libraries at -80°C in Eppendorf DNA LoBind tubes.

6. Adapter addition

Material
  • Rapid Adapter T (RAP T)
  • Elution Buffer (EB)
  • RAP Dilution Buffer (RDB) or Adapter Buffer (ADB)
Consumibles
  • 1.5 ml Eppendorf DNA LoBind tubes
Instrumental
  • Microcentrífuga
  • Cubeta con hielo
  • Pipeta y puntas P1000
  • Pipeta y puntas P200
  • Pipeta y puntas P100
  • Pipeta y puntas P20
  • Pipeta y puntas P10
  • Pipeta y puntas P2
IMPORTANTE

The Rapid Adapter T (RAP T) used in this kit and protocol is not interchangeable with other sequencing adapters.

This kit and protocol is only compatible with Rapid Adapter T (RAP T).

Rapid Adapter T (RAP T) is a new sequencing adapter for Kit 11 chemistry and is higher capture, enabling lower flow cell loading amounts and contains fuel fix technology, enabling users to run long experiments without the need for fuel addition during the run. Therefore, sequencing adapters from other kits and chemistries are not compatible with this kit or protocol.

Spin down the Rapid Adapter T (RAP T) and place on ice.

Thaw the RAP Dilution Buffer (RDB) or Adapter Buffer (ADB) at room temperature, spin down briefly using a microfuge and mix by pipetting before storing on ice.

In a fresh 1.5 ml Eppendorf DNA LoBind tube, dilute Rapid Adapter T (RAP T):

Reagent Volume
Rapid Adapter T (RAP T) 1.2 µl
RAP Dilution Buffer (RDB) or Adapter Buffer (ADB) 6.8 µl
Total 8 µl

Mix well by pipetting and spin down.

Add 1 µl of the diluted Rapid Adapter T (RAP T) to the amplified cDNA library, making the final volume up 24 µl.

Mix well by pipetting and spin down.

Incubate the reaction for 5 minutes at room temperature.

FIN DEL PROCESO

The prepared library is used for loading onto the flow cell. Store the library on ice until ready to load.

CONSEJO

Recomendaciones de guardado de la biblioteca

Se recomienda guardar las bibliotecas en tubos Eppendorf DNA LoBind a 4 ⁰C, durante periodos de tiempo cortos o en caso de uso repetido, por ejemplo, para recargar celdas de flujo entre lavados. Para uso individual y para conservar a largo plazo por periodos de más de 3 meses, se recomienda guardar las bibliotecas a -80 ⁰C en tubos Eppendorf DNA LoBind.

7. Priming and loading the flow cell

Material
  • Flush Buffer (FB)
  • Flush Tether (FLT)
  • Loading Beads II (LBII)
  • Sequencing Buffer II (SBII)
  • Loading Solution (LS)
Consumibles
  • Celda de flujo PromethION
  • Tubos de 1,5 ml Eppendorf DNA LoBind
Instrumental
  • PromethION 2 Solo device
  • Dispositivo PromethION 24/48
  • PromethION Flow Cell Light Shield
  • Pipeta y puntas P1000
  • Pipeta y puntas P200
  • Pipeta y puntas P20

Using the Loading Solution

We recommend using the Loading Beads II (LBII) for loading your library onto the flow cell for most sequencing experiments. However, if you have previously used water to load your library, you must use Loading Solution (LS) instead of water. Note: some customers have noticed that viscous libraries can be loaded more easily when not using Loading Beads II.

Thaw the Sequencing Buffer II (SBII), Loading Beads II (LBII) or Loading Solution (LS, if using), Flush Tether (FLT) and Flush Buffer (FB) at room temperature before mixing the reagents by vortexing, and spin down the SBII and FLT at room temperature.

To prepare the flow cell priming mix, add 30 µl of thawed and mixed Flush Tether (FLT) directly to the tube of thawed and mixed Flush Buffer (FB), and mix by vortexing.

IMPORTANTE

Una vez sacadas de la nevera, esperar 20 minutos antes de insertar las celdas de flujo en el dispositivo y así darles tiempo a que estén a temperatura ambiente. En entornos húmedos se puede formar condensación. Inspeccione las clavijas doradas del conector, situadas en la parte superior e inferior de la celda de flujo, en busca de condensación y si la hubiera, límpiela con una toallita sin pelusa. Procure que la almohadilla térmica (color negro) esté enganchada en la parte posterior.

For PromethION 2 Solo, load the flow cell(s) as follows:

  1. Place the flow cell flat on the metal plate.

  2. Slide the flow cell into the docking port until the gold pins or green board cannot be seen.

J2068 FC-into-P2-animation V5

For the PromethION 24/48, load the flow cell(s) into the docking ports:

  1. Line up the flow cell with the connector horizontally and vertically before smoothly inserting into position.
  2. Press down firmly onto the flow cell and ensure the latch engages and clicks into place.

Step 1a V3

Step 1B

IMPORTANTE

Insertion of the flow cells at the wrong angle can cause damage to the pins on the PromethION and affect your sequencing results. If you find the pins on a PromethION position are damaged, please contact support@nanoporetech.com for assistance.

Screenshot 2021-04-08 at 12.08.37

Slide the inlet port cover clockwise to open.

Prom loading 2

IMPORTANTE

Tenga cuidado a la hora de extraer el tampón. No retire más de 20-30 μl y asegúrese de que el tampón cubra la matriz de poros en todo momento. La introducción de burbujas de aire en la matriz puede dañar los poros de manera irreversible.

After opening the inlet port, draw back a small volume to remove any air bubbles:

  1. Set a P1000 pipette tip to 200 µl.
  2. Insert the tip into the inlet port.
  3. Turn the wheel until the dial shows 220-230 µl, or until you see a small volume of buffer entering the pipette tip.

Step 3 v1

Load 500 µl of the priming mix into the flow cell via the inlet port, avoiding the introduction of air bubbles. Wait five minutes. During this time, prepare the library for loading using the next steps in the protocol.

Step 4 v1

Thoroughly mix the contents of the Loading Beads II (LBII) by pipetting.

IMPORTANTE

The Loading Beads II (LBII) tube contains a suspension of beads. These beads settle very quickly. It is vital that they are mixed immediately before use.

In a new tube, prepare the library for loading as follows:

Reagent Volume per flow cell
Sequencing Buffer II (SBII) 75 µl
Loading Beads II (LBII) thoroughly mixed before use, or Loading Solution (LS), if using 51 µl
DNA library 24 µl
Total 150 µl

Complete the flow cell priming by slowly loading 500 µl of the priming mix into the inlet port.

Step 5 v1

Mezclar la biblioteca pipeteando suavemente, justo antes de cargar.

Using a P1000, insert the pipette tip into the inlet port and add 150 µl of library.

Step 6 v2

Close the valve to seal the inlet port.

Step 7 V2

IMPORTANTE

Para obtener resultados de secuenciación óptimos, instale la pantalla protectora justo después de cargar la biblioteca.

Recomendamos poner la pantalla protectora en la celda de flujo y dejarla puesta mientras la biblioteca esté cargada, incluyendo los lavados y pasos de recarga. Retirar la pantalla cuando se haya extraído la biblioteca de la celda de flujo.

If the light shield has been removed from the flow cell, install the light shield as follows:

  1. Align the inlet port cut out of the light shield with the inlet port cover on the flow cell. The leading edge of the light shield should sit above the flow cell ID.
  2. Firmly press the light shield around the inlet port cover. The inlet port clip will click into place underneath the inlet port cover.

J2264 - Light shield animation PromethION Flow Cell 8a FAW

J2264 - Light shield animation PromethION Flow Cell 8b FAW

FIN DEL PROCESO

Close the PromethION lid when ready to start a sequencing run on MinKNOW.

Wait a minimum of 10 minutes after loading the flow cells onto the PromethION before initiating any experiments. This will help to increase the sequencing output.

8. Data acquisition and basecalling

How to start sequencing

Once you have loaded your flow cell, the sequencing run can be started on MinKNOW, our sequencing software that controls the device, data acquisition and real-time basecalling. For more detailed information on setting up and using MinKNOW, please see the MinKNOW protocol.

MinKNOW can be used and set up to sequence in multiple ways:

  • On a computer either direcly or remotely connected to a sequencing device.
  • Directly on a GridION, MinION Mk1C or PromethION 24/48 sequencing device.

For more information on using MinKNOW on a sequencing device, please see the device user manuals:

To start a sequencing run on MinKNOW:

1. Navigate to the start page and click Start sequencing.

2. Fill in your experiment details, such as name and flow cell position and sample ID.

3. Select the sequencing kit used in the library preparation on the Kit page.

4. Configure the sequencing and output parameters for your sequencing run or keep to the default settings on the Run configuration tab.

Note: If basecalling was turned off when a sequencing run was set up, basecalling can be performed post-run on MinKNOW. For more information, please see the MinKNOW protocol.

5. Click Start on the Review page to start the sequencing run.

Análisis de datos tras la secuenciación

Una vez la secuenciación ha finalizado, la celda de flujo se puede reutilizar o devolver, como se indica en la sección Reutilización y devoluciones de celdas de flujo.

Tras la secuenciación y la identificación de bases, se puede proceder a analizar los datos. Si desea más información sobre las opciones de identificación de bases y de análisis posterior, consulte el documento Data Analysis.

En la sección Downstream analysis/Análisis posterior, le presentamos otras opciones para analizar los datos.

9. Reutilización y devoluciones de las celdas de flujo

Material
  • Flow Cell Wash Kit (EXP-WSH004) (kit de lavado de celda de flujo)

Si al terminar el experimento desea volver a usar la celda de flujo, siga las instrucciones del protocolo Flow Cell Wash Kit y guarde la celda de flujo lavada a 2-8 ⁰C.

El protocolo Flow Cell Wash Kit está disponible en la comunidad Nanopore.

CONSEJO

Una vez terminado el experimento, recomendamos lavar la celda de flujo cuanto antes. Si no es posible, se puede dejar en el dispositivo y lavar al día siguiente.

Otra posibilidad es seguir el procedimiento de devolución para lavar la celda de flujo y enviarla a Oxford Nanopore.

Aquí puede encontrar las instrucciones para devolver celdas de flujo.

Nota: Antes de proceder a su devolución, las celdas de flujo deben lavarse con agua desionizada.

IMPORTANTE

Ante cualquier duda o pregunta acerca del experimento de secuenciación, consulte la guía de resolución de problemas, Troubleshooting Guide, que se encuentra en la versión en línea de este protocolo.

10. Análisis posterior

Análisis posterior a la identificación de bases

Existen varias opciones para completar el análisis de los datos de bases identificadas:

1. Plataforma EPI2ME

La plataforma EPI2ME es un servicio de análisis de datos, alojado en la red, desarrollado por Metrichor Ltd., filial de Oxford Nanopore Technologies. EPI2ME ofrece una serie de procesos de análisis, p. ej., de identificación metagenómica, identificación de especies a partir de un código (barcoding), alineación e identificación de variantes estructurales. El análisis no requiere equipo ni capacidad computacional extra y proporciona un informe fácil de interpretar con los resultados. Para obtener información sobre cómo realizar un proceso de análisis en EPI2ME, siga las instrucciones del protocolo, empezando por la sección "Starting data analysis".

2. EPI2ME Labs, tutoriales y procesos de trabajo

Para realizar un análisis de datos más exhaustivo, Oxford Nanopore Technologies ofrece una serie de tutoriales y procesos de trabajo de bioinformática, disponibles en EPI2ME Labs, que encontrará en la sección del mismo nombre de la comunidad Nanopore. La plataforma proporciona un espacio donde los proyectos que depositan en GitHub nuestros equipos de Investigación y Aplicaciones, se pueden exponer con textos descriptivos, código bioinformático funcional y datos de ejemplo.

3. Herramientas de análisis para la investigación

El departamento de Investigación de Oxford Nanopore Technologies ha creado una serie de herramientas de análisis que están disponibles en el repositorio Oxford Nanopore de GitHub. Las herramientas están diseñadas para usuarios avanzados y contienen instrucciones sobre cómo instalar y ejecutar el programa. Estas herramientas están públicamente disponibles y cuentan con un mantenimiento mínimo.

4. Herramientas de análisis desarrolladas por la comunidad

Si no se proporciona en ninguno de los recursos anteriores un método de análisis que responda a las necesidades de investigación requeridas, puede consultar la sección Bioinformatics del centro de recursos Resource Centre. Varios miembros de la comunidad Nanopore han desarrollado sus propias herramientas y segmentaciones para analizar datos de secuenciación por nanoporos. La mayoría de ellos está disponible en GitHub. Nótese que Oxford Nanopore Technologies no desarrolla ni mantiene esas herramientas y no garantiza que sean compatibles con la última configuración de química/software.

11. Problemas durante la extracción de ADN/ARN y la preparación de bibliotecas

A continuación hay una lista de los problemas más frecuentes, con algunas posibles causas y soluciones propuestas.

También disponemos de una página de preguntas frecuentes, FAQ, en la sección Support de la comunidad Nanopore.

Si ha probado las soluciones propuestas y continúa teniendo problemas, póngase en contacto con el departamento de asistencia técnica, bien por correo electrónico (support@nanoporetech.com) o a través del Live Chat de la comunidad Nanopore.

Baja calidad de la muestra

Observación Posible causa Comentarios y acciones recomendadas
Baja pureza del ADN (la lectura del Nanodrop para ADN OD 260/280 es <1,8 y OD 260/230 es <2,0-2,2) El método de extracción de ADN no proporciona la pureza necesaria Los efectos de los contaminantes se muestran en la página Contaminants. Pruebe con un método de extracción alternativo que no provoque el arrastre de contaminantes.

Considere realizar un paso adicional de limpieza SPRI.
Baja integridad del ARN (número de integridad del ARN <9,5 RIN o la banda ARNr se muestra como una mancha en el gel). El ARN se degradó durante la extracción Probar un método de extracción de ARN diferente. Encontrará más información sobre RIN en la página RNA Integrity Number. Asimismo, dispone de información adicional en la página DNA/RNA Handling.
El ARN tiene una longitud de fragmento más corta de lo esperado El ARN se degradó durante la extracción Probar un método de extracción de ARN diferente. Encontrará más información sobre RIN en la página RNA Integrity Number. Asimismo, dispone de información adicional en la página DNA/RNA Handling.

Cuando se trabaje con ARN, recomendamos que el espacio de trabajo y el instrumental de laboratorio estén libres de ribonucleasas.

Escasa recuperación de ADN tras la limpieza con microesferas magnéticas AMPure

Observación Posible causa Comentarios y acciones recomendadas
Escasa recuperación Pérdida de ADN debido a una proporción de microesferas magnéticas AMPure por muestra inferior a lo previsto. 1. Las microesferas magnéticas AMPure precipitan con rapidez; antes de añadirlas a la muestra hay que asegurarse de que estén bien resuspendidas.

2. Si la proporción de microesferas por muestra es inferior a 0.4:1, los fragmentos de ADN, sean del tamaño que sean, se perderán durante la limpieza.
Escasa recuperación Los fragmentos de ADN son más cortos de lo esperado Cuanto menor sea la proporción de microesferas magnéticas AMPure por muestra, más rigurosa será la selección de fragmentos largos frente a los cortos. Determinar siempre la longitud de la muestra de ADN en un gel de agarosa u otros métodos de electroforesis en gel, y, a continuación, calcular la cantidad adecuada de microesferas magnéticas que se debe utilizar. SPRI cleanup
Escasa recuperación tras la preparación de extremos El paso de lavado utilizó etanol a <70 % Cuando se utilice etanol a <70 %, el ADN se eluirá de las microesferas magnéticas. Asegúrese de utilizar el porcentaje correcto.

12. Issues during the sequencing run

A continuación hay una lista de los problemas más frecuentes, con algunas posibles causas y soluciones propuestas.

También disponemos de una página de preguntas frecuentes, FAQ, en la sección Support de la comunidad Nanopore.

Si ha probado las soluciones propuestas y continúa teniendo problemas, póngase en contacto con el departamento de asistencia técnica, bien por correo electrónico (support@nanoporetech.com) o a través del Live Chat de la comunidad Nanopore.

Menos poros al inicio de la secuenciación que después de verificar la celda de flujo

Observación Posible causa Comentarios y acciones recomendadas
MinKNOW presentó al inicio de la secuenciación un número de poros inferior al indicado durante la comprobación de la celda de flujo Se introdujo una burbuja de aire en la matriz de nanoporos Tras comprobar el número de poros presente en la celda de flujo, es imprescindible quitar las burbujas que haya cerca del puerto de cebado. Si no se quitan, pueden desplazarse a la matriz de nanoporos y dañar de manera irreversible los nanoporos expuestos al aire. En este vídeo se muestran algunas buenas prácticas para evitar que esto ocurra.
MinKNOW presentó al inicio de la secuenciación un número de poros inferior al indicado durante la comprobación de la celda de flujo La celda de flujo no está colocada correctamente Detener el ciclo de secuenciación, quitar la celda de flujo del dispositivo e insertarla de nuevo. Comprobar que está firmemente asentada en el dispositivo y que ha alcanzado la temperatura deseada. Si procede, probar con una posición diferente del dispositivo (GriION/PromethION).
MinKNOW presentó al inicio de la secuenciación un número de poros inferior al indicado durante la comprobación de la celda de flujo La presencia de contaminantes en la biblioteca ha dañado o bloqueado los poros El número de poros resultante tras la comprobación de la celda de flujo se realiza usando el control de calidad de las moléculas de ADN presentes en el tampón de almacenamiento de la celda de flujo. Al inicio de la secuenciación, se utiliza la misma biblioteca para estimar el número de poros activos. Por este motivo, se estima que puede haber una variabilidad del 10 % en el número de poros detectados. Tener un número de poros considerablemente inferior al inicio de la secuenciación puede deberse a la presencia de contaminantes en la biblioteca que hayan dañado las membranas o bloqueado los poros. Para mejorar la pureza del material de entrada tal vez sea necesario usar métodos de purificación o extracción de ADN/ARN alternativos. Los efectos de los contaminantes están descritos en la página Contaminants. Se recomienda, probar con un método de extracción alternativo que no provoque el arrastre de contaminantes.

Error en el script de MinKNOW

Observación Posible causa Comentarios y acciones recomendadas
MinKNOW muestra el mensaje "Error en el script"
Reiniciar el ordenador y reiniciar MinKNOW. Si el problema continúa, reúna los archivos de registro MinKNOW log files y contacte con el servicio de asistencia técnica. Si no dispone de otro dispositivo de secuenciación, recomendamos que guarde la celda de flujo con la biblioteca cargada a 4 °C y contacte con el servicio de asistencia técnica para recibir recomendaciones de almacenamiento adicionales.

Pore occupancy below 40%

Observation Possible cause Comments and actions
Pore occupancy <40% Not enough library was loaded on the flow cell Ensure you load the recommended amount of good quality library in the relevant library prep protocol onto your flow cell. Please quantify the library before loading and calculate mols using tools like the Promega Biomath Calculator, choosing "dsDNA: µg to pmol"
Pore occupancy close to 0 The Ligation Sequencing Kit was used, and sequencing adapters did not ligate to the DNA Make sure to use the NEBNext Quick Ligation Module (E6056) and Oxford Nanopore Technologies Ligation Buffer (LNB, provided in the sequencing kit) at the sequencing adapter ligation step, and use the correct amount of each reagent. A Lambda control library can be prepared to test the integrity of the third-party reagents.
Pore occupancy close to 0 The Ligation Sequencing Kit was used, and ethanol was used instead of LFB or SFB at the wash step after sequencing adapter ligation Ethanol can denature the motor protein on the sequencing adapters. Make sure the LFB or SFB buffer was used after ligation of sequencing adapters.
Pore occupancy close to 0 No tether on the flow cell Tethers are adding during flow cell priming (FLT/FCT tube). Make sure FLT/FCT was added to FB/FCF before priming.

Longitud de lectura más corta de lo esperado

Observación Posible causa Comentarios y acciones recomendadas
Longitud de lectura más corta de lo esperado Fragmentación no deseada de la muestra de ADN La longitud de lectura refleja la longitud del fragmento de la muestra de ADN. La muestra de ADN se puede fragmentar durante la extracción de la preparación de la biblioteca.

1. Consulte la sección de buenas prácticas de los métodos de extracción en la página Extraction Methods de la comunidad Nanopore.

2. Visualizar la distribución de la longitud de los fragmentos de las muestras de ADN en un gel de agarosa antes de proceder a la preparación de la biblioteca. DNA gel2 En la imagen superior, la muestra 1 contiene alto peso molecular, mientras que la muestra 2 se ha fragmentado.

3. Durante la preparación de la biblioteca, evitar pipetear y agitar en vórtex cuando se mezclen los reactivos. Dar suaves golpes con el dedo o invertir el vial es suficiente.

Gran proporción de poros no disponibles

Observación Posible causa Comentarios y acciones recomendadas
Gran proporción de poros no disponibles (se muestran en azul oscuro en el panel de canales y en el gráfico de actividad de poros)

image2022-3-25 10-43-25 Conforme pasa el tiempo, el gráfico de actividad de poros de arriba muestra una proporción creciente de poros no disponibles.		 Hay contaminantes presentes en la muestra Algunos contaminantes se pueden eliminar de los poros mediante la función de desbloqueo incorporada en MinKNOW. Si funciona, el estado de los poros cambiará a "sequencing pores" (secuenciación de poros). Si la porción poros no disponibles se mantiene elevada o aumenta, pruebe una de las siguientes opciones:

1. Realizar un enjuague de nucleasa con el kit de lavado Flow Cell Wash Kit (EXP-WSH004)
2. Realizar varios ciclos de PCR para intentar diluir cualquier contaminante que pueda estar causando problemas.

Gran proporción de poros inactivos

Observación Posible causa Comentarios y acciones recomendadas
Gran proporción de poros inactivos/no disponibles (se muestran en azul claro en el panel de canales y en el gráfico de actividad de poros. Los poros o membranas están dañados de manera irreversible) Se han introducido burbujas de aire en la celda de flujo Las burbujas de aire introducidas durante el cebado de la celda y la carga de la biblioteca pueden dañar los poros de forma permanente. Para conocer las buenas prácticas de cebado y carga de la celda de flujo, ver el vídeo Priming and loading your flow cell
Gran proporción de poros inactivos/no disponibles Ciertos compuestos copurificados con ADN Compuestos conocidos, incluidos los polisacáridos, se asocian generalmente con el ADN genómico de las plantas.

1. Consulte la página Plant leaf DNA extraction method.
2. Limpiar usando el kit QIAGEN PowerClean Pro.
3. Realizar una amplificación del genoma completo con la muestra original de ADNg utilizando el kit QIAGEN REPLI-g.
Gran proporción de poros inactivos/no disponibles Hay contaminantes presentes en la muestra Los efectos de los contaminantes se muestran en la página Contaminants. Probar con un método de extracción alternativo que no provoque el arrastre de contaminantes.

Reducción de la velocidad de secuenciación y del índice de calidad Qscore en una fase avanzada de la secuenciación

Observación Posible causa Comentarios y acciones recomendadas
Reducción de la velocidad de secuenciación y el índice de calidad Qscore en una fase avanzada de la secuenciación En la química del kit 9 (p. ej., SQK-LSK109), cuando la celda de flujo está sobrecargada con la biblioteca se observa un consumo rápido de combustible (consulte el protocolo correspondiente a su biblioteca de ADN para ver las recomendaciones) Añadir más combustible a la celda de flujo, siguiendo las instrucciones en el protocolo de MinKNOW. En futuros experimentos, cargar cantidades menores de biblioteca en la celda de flujo.

Fluctuación de la temperatura

Observación Posible causa Comentarios y acciones recomendadas
Fluctuación de la temperatura La celda de flujo ha perdido contacto con el dispositivo Comprobar que una almohadilla térmica cubra la placa metálica de la parte posterior de la celda de flujo. Reinsertar la celda de flujo y presionar para asegurarse de que las clavijas del conector están bien conectadas al dispositivo. Si el problema continúa, contacte con el servicio de asistencia técnica.

Error al intentar alcanzar la temperatura deseada

Observación Posible causa Comentarios y acciones recomendadas
MinKNOW muestra el mensaje "Error al intentar alcanzar la temperatura deseada" El dispositivo ha sido colocado en un lugar a una temperatura ambiente inferior a la media o en un lugar con escasa ventilación (lo que provoca el sobrecalientamiento de las celdas de flujo). MinKNOW tiene un tiempo predeterminado para que las celdas de flujo alcancen la temperatura fijada. Una vez acabado el tiempo, aparece un mensaje de error, pero el experimento de secuenciación continua. Secuenciar a una temperatura incorrecta puede llevar a una disminución en el rendimiento y a generar un índice de calidad Qscore menor. Corrija la ubicación del dispositivo de secuenciación para asegurarse de que se encuentra a temperatura ambiente y con buena ventilación; a continuación, reinicie el proceso en MinKNOW. Para obtener más información sobre el control de temperatura de MinKNOW Mk 1B, consulte la sección de preguntas frecuentes, FAQ.

Guppy – no input .fast5 was found or basecalled

Observation Possible cause Comments and actions
No input .fast5 was found or basecalled input_path did not point to the .fast5 file location The --input_path has to be followed by the full file path to the .fast5 files to be basecalled, and the location has to be accessible either locally or remotely through SSH.
No input .fast5 was found or basecalled The .fast5 files were in a subfolder at the input_path location To allow Guppy to look into subfolders, add the --recursive flag to the command

Guppy – no Pass or Fail folders were generated after basecalling

Observation Possible cause Comments and actions
No Pass or Fail folders were generated after basecalling The --qscore_filtering flag was not included in the command The --qscore_filtering flag enables filtering of reads into Pass and Fail folders inside the output folder, based on their strand q-score. When performing live basecalling in MinKNOW, a q-score of 7 (corresponding to a basecall accuracy of ~80%) is used to separate reads into Pass and Fail folders.

Guppy – unusually slow processing on a GPU computer

Observation Possible cause Comments and actions
Unusually slow processing on a GPU computer The --device flag wasn't included in the command The --device flag specifies a GPU device to use for accelerate basecalling. If not included in the command, GPU will not be used. GPUs are counted from zero. An example is --device cuda:0 cuda:1, when 2 GPUs are specified to use by the Guppy command.

Last updated: 3/7/2024

Document options

PromethION