Rapid sequencing gDNA - barcoding (SQK-RBK004)


Overview

The fastest and simplest protocol for genomic DNA involving:

  • 10 mins library prep
  • high yield
  • fragmentation

For Research Use Only

This is a Legacy product This kit has now been discontinued and we recommend all customers upgrade to the latest chemistry for their relevant kit which is available on the Store.

Document version: RBK_9054_v2_revAF_14Aug2019

1. Overview of the protocol

IMPORTANT

This is a Legacy product

This kit has now been discontinued and we recommend all customers upgrade to the latest chemistry for their relevant kit which is available on the Store. For further information on please see the product update page.

Rapid Barcoding Kit features

This kit is recommended for users who:

  • Wish to multiplex samples to reduce price per sample
  • Need a PCR-free method of multiplexing to preserve additional information such as base modifications
  • Require a short preparation time
  • Have limited access to laboratory equipment

Introduction to the Rapid Barcoding Sequencing Kit

This protocol describes how to carry out rapid barcoding of genomic DNA using the Rapid Barcoding Sequencing Kit (SQK-RBK004).

Steps in the sequencing workflow:

Prepare for your experiment

You will need to:

  • Extract your DNA, and check its length, quantity and purity. The quality checks performed during the protocol are essential in ensuring experimental success.
  • Ensure you have your sequencing kit, the correct equipment and third-party reagents
  • Download the software for acquiring and analysing your data
  • Check your flow cell to ensure it has enough pores for a good sequencing run

Library preparation

You will need to:

  • Tagment your DNA using the Fragmentation Mix RB in the kit; this simultaneously attaches a pair of barcodes to the fragments
  • Pool the barcoded samples
  • Attach sequencing adapters supplied in the kit to the DNA ends
  • Prime the flow cell, and load your DNA library into the flow cell

RBK004 library prep workflow

Sequencing and analysis

You will need to:

  • Start a sequencing run using the MinKNOW software, which will collect raw data from the device and convert it into basecalled reads
  • Start the EPI2ME software and select a workflow for barcoding
IMPORTANT

Compatibility of this protocol

This protocol should only be used in combination with:

  • Rapid Barcoding Sequencing Kit (SQK-RBK004)
  • R9.4.1 (FLO-MIN106) flow cells
  • Flow Cell Wash Kit (EXP-WSH004)
  • RAP Top-Up Kit (EXP-RAP001)
  • Sequencing Auxiliary Kit (EXP-AUX001)

2. Equipment and consumables

Materials
  • ~400 ng high molecular weight genomic DNA per sample
  • Rapid Barcoding Sequencing Kit (SQK-RBK004)
  • Flow Cell Priming Kit (EXP-FLP002)

Consumables
  • 1.5 ml Eppendorf DNA LoBind tubes
  • 0.2 ml thin-walled PCR tubes
  • Nuclease-free water (e.g. ThermoFisher, AM9937)
  • Agencourt AMPure XP beads (optional) (Beckman Coulter™ cat # A63881)
  • Freshly prepared 70% ethanol in nuclease-free water (optional)
  • 10 mM Tris-HCl pH 8.0 with 50 mM NaCl (optional)

Equipment
  • Ice bucket with ice
  • Microfuge
  • Timer
  • Thermal cycler or heat blocks
  • P1000 pipette and tips
  • P200 pipette and tips
  • P100 pipette and tips
  • P20 pipette and tips
  • P2 pipette and tips
Optional equipment
  • Standard gel electrophoresis equipment
  • Agilent Bioanalyzer (or equivalent)
  • Qubit fluorometer (or equivalent for QC check)
  • Eppendorf 5424 centrifuge (or equivalent)
  • Magnetic rack
  • Hula mixer (gentle rotator mixer)

For this protocol, you will need ~400 ng high molecular weight genomic DNA

Input DNA

How to QC your input DNA

It is important that the input DNA meets the quantity and quality requirements. Using too little or too much DNA, or DNA of poor quality (e.g. highly fragmented or containing RNA or chemical contaminants) can affect your library preparation.

For instructions on how to perform quality control of your DNA sample, please read the Input DNA/RNA QC protocol.

Chemical contaminants

Depending on how the DNA is extracted from the raw sample, certain chemical contaminants may remain in the purified DNA, which can affect library preparation efficiency and sequencing quality. Read more about contaminants on the Contaminants page of the Community.

Rapid Barcoding Kit (SQK-RBK004) contents

rbk004 v1

Name Acronym Cap colour No. of vials Fill volume per vial (μl)
Fragmentation Mix RB01-RB12 Clear 12, each vial with a unique barcode 20
Rapid Adapter RAP Green 1 10
Loading Beads LB Pink 1 360
Sequencing Buffer SQB Red 1 300

Rapid Barcoding Kit sequences

Component Sequence
RB01 AAGAAAGTTGTCGGTGTCTTTGTG
RB02 TCGATTCCGTTTGTAGTCGTCTGT
RB03 GAGTCTTGTGTCCCAGTTACCAGG
RB04 TTCGGATTCTATCGTGTTTCCCTA
RB05 CTTGTCCAGGGTTTGTGTAACCTT
RB06 TTCTCGCAAAGGCAGAAAGTAGTC
RB07 GTGTTACCGTGGGAATGAATCCTT
RB08 TTCAGGGAACAAACCAAGTTACGT
RB09 AACTAGGCACAGCGAGTCTTGGTT
RB10 AAGCGTTGAAACCTTTGTCCTCTC
RB11 GTTTCATCTATCGGAGGGAATGGA
RB12 CAGGTAGAAAGAAGCAGAATCGGA
IMPORTANT

Please note that the Sequencing Tether (SQT) tube will NOT be used in this protocol.

Flow Cell Priming Kit contents (EXP-FLP002)

FLP

Name Acronym Cap colour No. of vials Fill volume per vial (μl)
Flush Buffer FB Blue 6 1,170
Flush Tether FLT Purple 1 200

The RAP Top-Up Kit (EXP-RAP001) is available to provide enough reagents for another six reactions depending on how the barcodes are used.

This kit contains reagents to be used with any remaining barcodes to load another six sequencing libraries.

EXP-RAP001 tubes

Reagent Acronym Cap colour No. of vials Fill volume per vial (µl)
Rapid Adapter RAP Green 1 10
Sequencing Tether SQT Purple 1 10
Loading Beads LB Pink 1 360
Sequencing Buffer SQB Red 1 300

3. Library preparation

Materials
  • 400 ng high molecular weight plasmid DNA
  • Fragmentation Mix RB01-12
  • Rapid Adapter (RAP)

Consumables
  • 0.2 ml thin-walled PCR tubes
  • Nuclease-free water (e.g. ThermoFisher, AM9937)
  • Agencourt AMPure XP beads (optional) (Beckman Coulter™ cat # A63881)
  • Freshly prepared 70% ethanol in nuclease-free water (optional)
  • 10 mM Tris-HCl pH 8.0 with 50 mM NaCl (optional)

Equipment
  • Thermal cycler or heat blocks
  • Microfuge
  • P10 pipette and tips
Optional equipment
  • Magnetic rack
  • Hula mixer (gentle rotator mixer)

Thaw kit components at room temperature, spin down briefly using a microfuge and mix by pipetting as indicated by the table below:

Reagent 1. Thaw at room temperature 2. Briefly spin down 3. Mix well by pipetting
Fragmentation Mix RB01-12 Not frozen
Rapid Adapter (RAP) Not frozen
Sequencing Buffer (SQB) ✓*
Loading Beads (LB) Mix by pipetting or vortexing immediately before use
Flush Buffer (FLB) - 1 tube ✓*
Flush Tether (FLT)

*Vortexing, followed by a brief spin in a microfuge, is recommended for Sequencing Buffer (SQB) and Flush Buffer (FLB).

Please note that the Sequencing Tether (SQT) tube will NOT be used in this protocol. It is provided in the kit for potential future product compatibility.

Prepare the DNA in nuclease-free water.

  • Transfer ~400 ng genomic DNA into a DNA LoBind tube
  • Adjust the volume to 7.5 μl with nuclease-free water
  • Mix by flicking the tube to avoid unwanted shearing
  • Spin down briefly in a microfuge

In a 0.2 ml thin-walled PCR tube, mix the following:

Reagent Volume
400 ng template DNA 7.5 μl
Fragmentation Mix RB01-12 (one for each sample) 2.5 μl
Total 10 μl

Mix gently by flicking the tube, and spin down.

Incubate the tube at 30°C for 1 minute and then at 80°C for 1 minute. Briefly put the tube on ice to cool it down.

Pool the barcoded samples in a 1.5 ml Eppendorf DNA LoBind tube.

We expect to have about ~10 µl per sample.

IMPORTANT

If barcoding four or more samples, increased throughput can be achieved through cleaning up and concentrating the pooled material using AMPure XP beads as outlined in Steps 6-17. Otherwise, for a more rapid sample preparation, transfer 10 μl of pooled sample from Step 6 into a clean 1.5 ml Eppendorf DNA LoBind tube, and proceed directly to Step 18.

Resuspend the AMPure XP beads by vortexing.

To the entire pooled barcoded sample from Step 6, add an equal volume of resuspended AMPure XP beads, and mix by flicking the tube.

Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.

Prepare 500 μl of fresh 70% ethanol in nuclease-free water.

Spin down the sample and pellet on a magnet. Keep the tube on the magnet, and pipette off the supernatant.

Keep the tube on the magnet and wash the beads with 200 µl of freshly prepared 70% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.

Repeat the previous step.

Spin down and place the tube back on the magnet. Pipette off any residual 70% ethanol. Briefly allow to dry.

Remove the tube from the magnetic rack and resuspend pellet in 10 µl of 10 mM Tris-HCl pH 8.0 with 50 mM NaCl. Incubate for 2 minutes at room temperature.

Pellet the beads on a magnet until the eluate is clear and colourless, for at least 1 minute.

Remove and retain 10 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.

  • Dispose of the pelleted beads

End of optional steps.

Add 1 µl of RAP to 10 µl of barcoded DNA.

Mix gently by flicking the tube, and spin down.

Incubate the reaction for 5 minutes at room temperature.

END OF STEP

The prepared library is used for loading into the flow cell. Store the library on ice until ready to load.

4. Priming and loading the SpotON Flow Cell

Materials
  • Flow Cell Priming Kit (EXP-FLP002)
  • Sequencing Buffer (SQB)
  • Loading Beads (LB)

Consumables
  • 1.5 ml Eppendorf DNA LoBind tubes
  • Nuclease-free water (e.g. ThermoFisher, AM9937)

Equipment
  • MinION device
  • SpotON Flow Cell
  • MinION and GridION Flow Cell Light Shield
  • P1000 pipette and tips
  • P100 pipette and tips
  • P20 pipette and tips
  • P10 pipette and tips
TIP

Priming and loading a flow cell

We recommend all new users watch the 'Priming and loading your flow cell' video before your first run.

Thaw the Sequencing Buffer (SQB), Loading Beads (LB), Flush Tether (FLT) and one tube of Flush Buffer (FB) at room temperature before mixing the reagents by vortexing, and spin down at room temperature.

To prepare the flow cell priming mix, add 30 µl of thawed and mixed Flush Tether (FLT) directly to the tube of thawed and mixed Flush Buffer (FB), and mix by vortexing at room temperature.

Open the MinION device lid and slide the flow cell under the clip.

Press down firmly on the flow cell to ensure correct thermal and electrical contact.

Flow Cell Loading Diagrams Step 1a

Flow Cell Loading Diagrams Step 1b

OPTIONAL ACTION

Complete a flow cell check to assess the number of pores available before loading the library.

This step can be omitted if the flow cell has been checked previously.

See the flow cell check instructions in the MinKNOW protocol for more information.

Slide the priming port cover clockwise to open the priming port.

Flow Cell Loading Diagrams Step 2

IMPORTANT

Take care when drawing back buffer from the flow cell. Do not remove more than 20-30 µl, and make sure that the array of pores are covered by buffer at all times. Introducing air bubbles into the array can irreversibly damage pores.

After opening the priming port, check for a small air bubble under the cover. Draw back a small volume to remove any bubbles:

  1. Set a P1000 pipette to 200 µl
  2. Insert the tip into the priming port
  3. Turn the wheel until the dial shows 220-230 µl, to draw back 20-30 µl, or until you can see a small volume of buffer entering the pipette tip

Note: Visually check that there is continuous buffer from the priming port across the sensor array.

Flow Cell Loading Diagrams Step 03 V5

Load 800 µl of the priming mix into the flow cell via the priming port, avoiding the introduction of air bubbles. Wait for five minutes. During this time, prepare the library for loading by following the steps below.

Flow Cell Loading Diagrams Step 04 V5

Thoroughly mix the contents of the Loading Beads (LB) tubes by vortexing.

In a new tube, prepare the library for loading as follows:

Reagent Volume per flow cell
Sequencing Buffer (SQB) 34 µl
Loading Beads (LB), mixed immediately before use 25.5 µl
Nuclease-free water 4.5 µl
DNA library 11 µl
Total 75 µl

Note: Load the library onto the flow cell immediately after adding the Sequencing Buffer (SQB) and Loading Beads (LB) because the fuel in the buffer will start to be consumed by the adapter.

IMPORTANT

The Loading Beads (LB) tube contains a suspension of beads. These beads settle very quickly. It is vital that they are mixed immediately before use.

Complete the flow cell priming:

  1. Gently lift the SpotON sample port cover to make the SpotON sample port accessible.
  2. Load 200 µl of the priming mix into the flow cell priming port (not the SpotON sample port), avoiding the introduction of air bubbles.

Flow Cell Loading Diagrams Step 5

Flow Cell Loading Diagrams Step 06 V5

Mix the prepared library gently by pipetting up and down just prior to loading.

Add 75 μl of the prepared library to the flow cell via the SpotON sample port in a dropwise fashion. Ensure each drop flows into the port before adding the next.

Flow Cell Loading Diagrams Step 07 V5

Gently replace the SpotON sample port cover, making sure the bung enters the SpotON port and close the priming port.

Step 8 update

Flow Cell Loading Diagrams Step 9

IMPORTANT

Install the light shield on your flow cell as soon as library has been loaded for optimal sequencing output.

We recommend leaving the light shield on the flow cell when library is loaded, including during any washing and reloading steps. The shield can be removed when the library has been removed from the flow cell.

Place the light shield onto the flow cell, as follows:

  1. Carefully place the leading edge of the light shield against the clip. Note: Do not force the light shield underneath the clip.

  2. Gently lower the light shield onto the flow cell. The light shield should sit around the SpotON cover, covering the entire top section of the flow cell.

J2264 - Light shield animation Flow Cell FAW optimised

CAUTION

The MinION Flow Cell Light Shield is not secured to the flow cell and careful handling is required after installation.

END OF STEP

Close the device lid and set up a sequencing run on MinKNOW.

5. Data acquisition and basecalling

How to start sequencing

Once you have loaded your flow cell, the sequencing run can be started on MinKNOW, our sequencing software that controls the device, data acquisition and real-time basecalling. For more detailed information on setting up and using MinKNOW, please see the MinKNOW protocol.

MinKNOW can be used and set up to sequence in multiple ways:

  • On a computer either directly or remotely connected to a sequencing device.
  • Directly on a GridION or PromethION 24/48 sequencing device.

For more information on using MinKNOW on a sequencing device, please see the device user manuals:


To start a sequencing run on MinKNOW:

1. Navigate to the start page and click Start sequencing.

2. Fill in your experiment details, such as name and flow cell position and sample ID.

3. Select the sequencing kit used in the library preparation on the Kit page.

4. Configure the sequencing and output parameters for your sequencing run or keep to the default settings on the Run configuration tab.

Note: If basecalling was turned off when a sequencing run was set up, basecalling can be performed post-run on MinKNOW. For more information, please see the MinKNOW protocol.

5. Click Start to initiate the sequencing run.

Data analysis after sequencing

After sequencing has completed on MinKNOW, the flow cell can be reused or returned, as outlined in the Flow cell reuse and returns section.

After sequencing and basecalling, the data can be analysed. For further information about options for basecalling and post-basecalling analysis, please refer to the Data Analysis document.

In the Downstream analysis section, we outline further options for analysing your data.

6. Flow cell reuse and returns

Materials
  • Flow Cell Wash Kit (EXP-WSH004)

After your sequencing experiment is complete, if you would like to reuse the flow cell, please follow the Flow Cell Wash Kit protocol and store the washed flow cell at +2°C to +8°C.

The Flow Cell Wash Kit protocol is available on the Nanopore Community.

TIP

We recommend you to wash the flow cell as soon as possible after you stop the run. However, if this is not possible, leave the flow cell on the device and wash it the next day.

Alternatively, follow the returns procedure to send the flow cell back to Oxford Nanopore.

Instructions for returning flow cells can be found here.

IMPORTANT

If you encounter issues or have questions about your sequencing experiment, please refer to the Troubleshooting Guide that can be found in the online version of this protocol.

7. Downstream analysis

Post-basecalling analysis

There are several options for further analysing your basecalled data:

1. EPI2ME workflows

For in-depth data analysis, Oxford Nanopore Technologies offers a range of bioinformatics tutorials and workflows available in EPI2ME. The platform provides a vehicle where workflows deposited in GitHub by our Research and Applications teams can be showcased with descriptive texts, functional bioinformatics code and example data.

2. Research analysis tools

Oxford Nanopore Technologies' Research division has created a number of analysis tools, which are available in the Oxford Nanopore GitHub repository. The tools are aimed at advanced users, and contain instructions for how to install and run the software. They are provided as-is, with minimal support.

3. Community-developed analysis tools

If a data analysis method for your research question is not provided in any of the resources above, please refer to the resource centre and search for bioinformatics tools for your application. Numerous members of the Nanopore Community have developed their own tools and pipelines for analysing nanopore sequencing data, most of which are available on GitHub. Please be aware that these tools are not supported by Oxford Nanopore Technologies, and are not guaranteed to be compatible with the latest chemistry/software configuration.

8. Issues during DNA/RNA extraction and library preparation

Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

We also have an FAQ section available on the Nanopore Community Support section.

If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

Low sample quality

Observation Possible cause Comments and actions
Low DNA purity (Nanodrop reading for DNA OD 260/280 is <1.8 and OD 260/230 is <2.0–2.2) The DNA extraction method does not provide the required purity The effects of contaminants are shown in the Contaminants document. Please try an alternative extraction method that does not result in contaminant carryover.

Consider performing an additional SPRI clean-up step.
Low RNA integrity (RNA integrity number <9.5 RIN, or the rRNA band is shown as a smear on the gel) The RNA degraded during extraction Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page.
RNA has a shorter than expected fragment length The RNA degraded during extraction Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page.

We recommend working in an RNase-free environment, and to keep your lab equipment RNase-free when working with RNA.

Low DNA recovery after AMPure bead clean-up

Observation Possible cause Comments and actions
Low recovery DNA loss due to a lower than intended AMPure beads-to-sample ratio 1. AMPure beads settle quickly, so ensure they are well resuspended before adding them to the sample.

2. When the AMPure beads-to-sample ratio is lower than 0.4:1, DNA fragments of any size will be lost during the clean-up.
Low recovery DNA fragments are shorter than expected The lower the AMPure beads-to-sample ratio, the more stringent the selection against short fragments. Please always determine the input DNA length on an agarose gel (or other gel electrophoresis methods) and then calculate the appropriate amount of AMPure beads to use. SPRI cleanup
Low recovery after end-prep The wash step used ethanol <70% DNA will be eluted from the beads when using ethanol <70%. Make sure to use the correct percentage.

9. Issues during the sequencing run

Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

We also have an FAQ section available on the Nanopore Community Support section.

If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

Fewer pores at the start of sequencing than after Flow Cell Check

Observation Possible cause Comments and actions
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check An air bubble was introduced into the nanopore array After the Flow Cell Check it is essential to remove any air bubbles near the priming port before priming the flow cell. If not removed, the air bubble can travel to the nanopore array and irreversibly damage the nanopores that have been exposed to air. The best practice to prevent this from happening is demonstrated in this video.
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check The flow cell is not correctly inserted into the device Stop the sequencing run, remove the flow cell from the sequencing device and insert it again, checking that the flow cell is firmly seated in the device and that it has reached the target temperature. If applicable, try a different position on the device (GridION/PromethION).
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check Contaminations in the library damaged or blocked the pores The pore count during the Flow Cell Check is performed using the QC DNA molecules present in the flow cell storage buffer. At the start of sequencing, the library itself is used to estimate the number of active pores. Because of this, variability of about 10% in the number of pores is expected. A significantly lower pore count reported at the start of sequencing can be due to contaminants in the library that have damaged the membranes or blocked the pores. Alternative DNA/RNA extraction or purification methods may be needed to improve the purity of the input material. The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

MinKNOW script failed

Observation Possible cause Comments and actions
MinKNOW shows "Script failed"
Restart the computer and then restart MinKNOW. If the issue persists, please collect the MinKNOW log files and contact Technical Support. If you do not have another sequencing device available, we recommend storing the flow cell and the loaded library at 4°C and contact Technical Support for further storage guidance.

Pore occupancy below 40%

Observation Possible cause Comments and actions
Pore occupancy <40% Not enough library was loaded on the flow cell Ensure you load the recommended amount of good quality library in the relevant library prep protocol onto your flow cell. Please quantify the library before loading and calculate mols using tools like the Promega Biomath Calculator, choosing "dsDNA: µg to pmol"
Pore occupancy close to 0 The Ligation Sequencing Kit was used, and sequencing adapters did not ligate to the DNA Make sure to use the NEBNext Quick Ligation Module (E6056) and Oxford Nanopore Technologies Ligation Buffer (LNB, provided in the sequencing kit) at the sequencing adapter ligation step, and use the correct amount of each reagent. A Lambda control library can be prepared to test the integrity of the third-party reagents.
Pore occupancy close to 0 The Ligation Sequencing Kit was used, and ethanol was used instead of LFB or SFB at the wash step after sequencing adapter ligation Ethanol can denature the motor protein on the sequencing adapters. Make sure the LFB or SFB buffer was used after ligation of sequencing adapters.
Pore occupancy close to 0 No tether on the flow cell Tethers are adding during flow cell priming (FLT/FCT tube). Make sure FLT/FCT was added to FB/FCF before priming.

Shorter than expected read length

Observation Possible cause Comments and actions
Shorter than expected read length Unwanted fragmentation of DNA sample Read length reflects input DNA fragment length. Input DNA can be fragmented during extraction and library prep.

1. Please review the Extraction Methods in the Nanopore Community for best practice for extraction.

2. Visualise the input DNA fragment length distribution on an agarose gel before proceeding to the library prep. DNA gel2 In the image above, Sample 1 is of high molecular weight, whereas Sample 2 has been fragmented.

3. During library prep, avoid pipetting and vortexing when mixing reagents. Flicking or inverting the tube is sufficient.

Large proportion of unavailable pores

Observation Possible cause Comments and actions
Large proportion of unavailable pores (shown as blue in the channels panel and pore activity plot)

image2022-3-25 10-43-25 The pore activity plot above shows an increasing proportion of "unavailable" pores over time.
Contaminants are present in the sample Some contaminants can be cleared from the pores by the unblocking function built into MinKNOW. If this is successful, the pore status will change to "sequencing pore". If the portion of unavailable pores stays large or increases:

1. A nuclease flush using the Flow Cell Wash Kit (EXP-WSH004) can be performed, or
2. Run several cycles of PCR to try and dilute any contaminants that may be causing problems.

Large proportion of inactive pores

Observation Possible cause Comments and actions
Large proportion of inactive/unavailable pores (shown as light blue in the channels panel and pore activity plot. Pores or membranes are irreversibly damaged) Air bubbles have been introduced into the flow cell Air bubbles introduced through flow cell priming and library loading can irreversibly damage the pores. Watch the Priming and loading your flow cell video for best practice
Large proportion of inactive/unavailable pores Certain compounds co-purified with DNA Known compounds, include polysaccharides, typically associate with plant genomic DNA.

1. Please refer to the Plant leaf DNA extraction method.
2. Clean-up using the QIAGEN PowerClean Pro kit.
3. Perform a whole genome amplification with the original gDNA sample using the QIAGEN REPLI-g kit.
Large proportion of inactive/unavailable pores Contaminants are present in the sample The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

Reduction in sequencing speed and q-score later into the run

Observation Possible cause Comments and actions
Reduction in sequencing speed and q-score later into the run For Kit 9 chemistry (e.g. SQK-LSK109), fast fuel consumption is typically seen when the flow cell is overloaded with library (please see the appropriate protocol for your DNA library to see the recommendation). Add more fuel to the flow cell by following the instructions in the MinKNOW protocol. In future experiments, load lower amounts of library to the flow cell.

Temperature fluctuation

Observation Possible cause Comments and actions
Temperature fluctuation The flow cell has lost contact with the device Check that there is a heat pad covering the metal plate on the back of the flow cell. Re-insert the flow cell and press it down to make sure the connector pins are firmly in contact with the device. If the problem persists, please contact Technical Services.

Failed to reach target temperature

Observation Possible cause Comments and actions
MinKNOW shows "Failed to reach target temperature" The instrument was placed in a location that is colder than normal room temperature, or a location with poor ventilation (which leads to the flow cells overheating) MinKNOW has a default timeframe for the flow cell to reach the target temperature. Once the timeframe is exceeded, an error message will appear and the sequencing experiment will continue. However, sequencing at an incorrect temperature may lead to a decrease in throughput and lower q-scores. Please adjust the location of the sequencing device to ensure that it is placed at room temperature with good ventilation, then re-start the process in MinKNOW. Please refer to this link for more information on MinION temperature control.

Guppy – no input .fast5 was found or basecalled

Observation Possible cause Comments and actions
No input .fast5 was found or basecalled input_path did not point to the .fast5 file location The --input_path has to be followed by the full file path to the .fast5 files to be basecalled, and the location has to be accessible either locally or remotely through SSH.
No input .fast5 was found or basecalled The .fast5 files were in a subfolder at the input_path location To allow Guppy to look into subfolders, add the --recursive flag to the command

Guppy – no Pass or Fail folders were generated after basecalling

Observation Possible cause Comments and actions
No Pass or Fail folders were generated after basecalling The --qscore_filtering flag was not included in the command The --qscore_filtering flag enables filtering of reads into Pass and Fail folders inside the output folder, based on their strand q-score. When performing live basecalling in MinKNOW, a q-score of 7 (corresponding to a basecall accuracy of ~80%) is used to separate reads into Pass and Fail folders.

Guppy – unusually slow processing on a GPU computer

Observation Possible cause Comments and actions
Unusually slow processing on a GPU computer The --device flag wasn't included in the command The --device flag specifies a GPU device to use for accelerate basecalling. If not included in the command, GPU will not be used. GPUs are counted from zero. An example is --device cuda:0 cuda:1, when 2 GPUs are specified to use by the Guppy command.

Last updated: 9/7/2023

Document options

MinION