Direct RNA sequencing - sequence-specific (SQK-RNA004)
MinION: Protocol
Direct RNA sequencing - sequence-specific (SQK-RNA004) V DSS_9197_v4_revB_20Sep2023
This protocol:
- is for selecting RNA targets of your choice for sequencing native RNA.
- uses total RNA as starting input material.
- requires no fragmentation.
- takes ~2 hours for library preparation.
For Research Use Only
This is an Early Access product.
For more information about our Early Access programmes, please see this article on product release phases.
FOR RESEARCH USE ONLY
Contents
Introduction to the protocol
Library preparation
Sequencing and data analysis
Troubleshooting
Overview
This protocol:
- is for selecting RNA targets of your choice for sequencing native RNA.
- uses total RNA as starting input material.
- requires no fragmentation.
- takes ~2 hours for library preparation.
For Research Use Only
This is an Early Access product.
For more information about our Early Access programmes, please see this article on product release phases.
1. Overview of the protocol
IMPORTANT
This is an Early Access product
For more information about our Early Access programmes, please see this article on product release phases.
Please ensure you always use the most recent version of the protocol.
Direct RNA Sequencing Kit features
This kit is highly recommended for users who:
- are exploring attributes of native RNA such as modified bases.
- would like to remove RT or PCR bias.
- have transcripts that are difficult to reverse transcribe.
Introduction to the sequence-specific Direct RNA Sequencing protocol
This protocol describes how to carry out sequence-specific sequencing of native RNA using the Direct RNA Sequencing Kit (SQK-RNA004). Starting from total RNA, a second complementary cDNA strand is synthesised for stability by reverse transcription with a custom-ordered sequence targeted reverse transcription adapter. Sequencing adapters are then attached to the RNA-cDNA hybrid for sequencing on either MinION or PromethION RNA Flow Cells (FLO-MIN004RA / FLO-PRO004RA respectively). Please note, the complementary cDNA strand is not sequenced, but improves the RNA sequencing output.
This protocol is designed for sequencing specific RNA (e.g. 16 rRNA) but cannot target specific mRNA of interest. To proceed with this protocol, you will need to order custom oligos, including one that is complementary to the 3' end of the target RNA sequence. These oligos will replace the Reverse Transcription Adapter (RTA) normally used for direct RNA sequencing. For further information on how to design custom RTA, please see the Equipment and Consumables section. Below are the oligo sequences required, with the RNA 3' end-specific sequences in parenthesis:
| Oligo A: 5’- /5PHOS/GGCTTCTTCTTGCTCTTAGGTAGTAGGTTC |
| Oligo B: 5’-GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGAAGAAGCC(TTTTTTTTTT) |
We recommend a control experiment using the RNA Control Strand (RCS) is completed first to become familiar with the technology.
Steps in the sequencing workflow:
Prepare for your experiment
You will need to:
- Extract your RNA, and check its length, quantity and purity. The quality checks performed during the protocol are essential in ensuring experimental success.
- Ensure you have your sequencing kit, the correct equipment and third-party reagents
- Download the software for acquiring and analysing your data
- Check your flow cell(s) to ensure it has enough pores for a good sequencing run
Library preparation
The table below is an overview of the steps required in the library preparation, including timings and stopping points.
| Library preparation | Process | Time | Stop option |
|---|---|---|---|
| Reverse transcription | Synthesise the complementary strand of the RNA with your custom-ordered adapter | ~85 minutes | At this stage the RT-RNA can be stored at -80°C for later use. Please note, this is the only pause point in this protocol. |
| Adapter ligation and clean-up | Attach the sequencing adapters to the RNA-cDNA hybrid ends | 45 minutes | Attach sequencing adapters to the ends of the RNA-cDNA hybrid. We strongly recommend sequencing your library as soon as it is adapted. |
| Priming and loading the flow cell | Prime the flow cell and load the prepared library for sequencing | 5 minutes |
Sequencing and analysis
You will need to:
- Start a sequencing run using the MinKNOW software, which will collect raw data from the device and basecall the reads
IMPORTANT
Unlike DNA, RNA is translocated through the nanopore in the 3'-5' direction. However, the basecalling algorithms automatically flip the data, and the reads are displayed 5'-3'.
IMPORTANT
Compatibility of this protocol
This protocol should only be used in combination with:
- Direct RNA Sequencing Kit (SQK-RNA004)
- MinION RNA Flow Cell (FLO-MIN004RA)
- Flow Cell Wash Kit (EXP-WSH004) - Flow Cell Wash Kit (EXP-WSH004) is compatible for removing library between washes but will not remove RNA-related blocking of nanopores.
- MinION Mk1B - MinION Mk1B IT requirements document
- MinION Mk1C - MinION Mk1C IT requirements document
- GridION - GridION IT requirements document
2. Equipment and consumables
Materials
- 1 µg of total RNA in 8.5 µl
- Custom-ordered sequence targeted reverse transcription adapter
- Direct RNA Sequencing Kit (SQK-RNA004)
Consumables
- Induro® Reverse Transcriptase (NEB, M0681)
- 10 mM dNTP solution (e.g. NEB, cat # N0447)
- NEBNext® Quick Ligation Reaction Buffer (NEB, B6058)
- T4 DNA Ligase 2M U/ml (NEB, cat # M0202M)
- Murine RNase Inhibitor (NEB, M0314)
- Agencourt RNAClean XP beads (Beckman Coulter™, cat # A63987)
- Nuclease-free water (e.g. ThermoFisher, AM9937)
- Freshly prepared 70% ethanol in nuclease-free water
- 0.2 ml thin-walled PCR tubes
- 1.5 ml Eppendorf DNA LoBind tubes
- Qubit RNA HS Assay Kit (ThermoFisher, cat # Q32852)
- Qubit 1x dsDNA BR Assay Kit (ThermoFisher, cat # Q33265)
- Qubit™ Assay Tubes (Invitrogen, Q32856)
Equipment
- Hula mixer (gentle rotator mixer)
- Magnetic rack, suitable for 1.5 ml Eppendorf tubes
- Microfuge
- Vortex mixer
- Ice bucket with ice
- Timer
- Thermal cycler
- Qubit fluorometer (or equivalent for QC check)
- P1000 pipette and tips
- P200 pipette and tips
- P100 pipette and tips
- P20 pipette and tips
- P10 pipette and tips
- P2 pipette and tips
- Eppendorf 5424 centrifuge (or equivalent)
For this protocol, you will need 1 µg of total RNA in 8.5 µl
Input RNA
It is important that the input RNA meets the quantity and quality requirements. Using too little or too much RNA, or RNA of poor quality (e.g. fragmented or containing chemical contaminants) can affect your library preparation.
For instructions on how to perform quality control of your RNA sample, please read the Input DNA/RNA QC protocol.
For further information on using RNA as input, please read the links below.
- Polyadenylation of non-poly(A) transcripts using E. coli poly(A) polymerase
- RNA contaminants
- RNA stability
- RNA Integrity Number (RIN)
- Enrichment of polyadenylated RNA molecules
These documents can also be found in the DNA/RNA Handling page.
Custom-ordered sequence targeted reverse transcription adapter sequence
The Reverse Transcription Adapter (RTA) supplied in the Direct RNA Sequencing kit is designed to ligate to any RNA with a poly(A) tail. However, users can customise their own RTA to target a specific RNA via the 3' end (for example, to only ligate to 16S rRNA). It is important to note that custom RTA can only target the 3’ end of RNA and cannot be used to enriched specific RNA with a poly(A) tail, see the picture below for more details.
To perform this protocol, you will need to order oligo A and a specific version of oligo B. In oligo B you will need to replace the 10(T) sequence with 10 bases complementary to the 3' end of your target RNA sequence. Both oligo A and oligo B are DNA.
Anneal oligo A and oligo B 1:1 at 1.4 µM in buffer (10 mM Tris-HCl pH 7.5, 50 mM NaCl) by heating to 95º C for 2 minutes and letting them cool down slowly (0.1º C/sec). This directly replaces RTA in the protocol.
| Sequences: |
|---|
| Oligo A: 5’- /5PHOS/GGCTTCTTCTTGCTCTTAGGTAGTAGGTTC |
| Oligo B: 5’-GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGAAGAAGCC(TTTTTTTTTT) |
Replace the 10(T) sequence with 10 bases complementary to the 3' end of your target RNA sequence. All oligos should be HPLC purified.
Third-party reagents
We have validated and recommend the use of all the third-party reagents used in this protocol. Alternatives have not been tested by Oxford Nanopore Technologies.
For all third-party reagents, we recommend following the manufacturer's instructions to prepare the reagents for use.
Check your flow cell
We highly recommend that you check the number of pores in your flow cell prior to starting a sequencing experiment. This should be done within 12 weeks of purchasing for MinION/GridION/PromethION or within four weeks of purchasing Flongle Flow Cells. Oxford Nanopore Technologies will replace any flow cell with fewer than the number of pores in the table below, when the result is reported within two days of performing the flow cell check, and when the storage recommendations have been followed. To do the flow cell check, please follow the instructions in the Flow Cell Check document.
| Flow cell | Minimum number of active pores covered by warranty |
|---|---|
| Flongle Flow Cell | 50 |
| MinION/GridION Flow Cell | 800 |
| PromethION Flow Cell | 5000 |
Direct RNA Sequencing Kit (SQK-RNA004) contents:
| Name | Acronym | Cap colour | No. of vials | Fill volume per vial (μl) |
|---|---|---|---|---|
| RT Adapter | RTA | Blue | 1 | 10 |
| RNA Ligation Adapter | RLA | Green | 1 | 45 |
| RNA CS | RCS | Yellow | 1 | 25 |
| Wash Buffer | WSB | Orange | 2 | 1,200 |
| RNA Elution Buffer | REB | Black | 1 | 300 |
| Library Solution | LIS | White cap, pink label | 1 | 600 |
| Sequencing Buffer | SB | Red | 1 | 700 |
| RNA Flush Tether | RFT | Pink | 1 | 200 |
| Flow Cell Flush | FCF | White | 1 | 8,000 |
Note: The RNA CS (RCS) is the calibration strand and contains the Enolase II from YHR174W, extracted from the yeast saccharomyces cerevisiae. The reference FASTA files for the yeast is available here.
3. Library preparation
Materials
- 1 µg of total RNA in 8.5 µl
- Custom-ordered sequence targeted reverse transcription adapter
- Wash Buffer (WSB)
- RNA Ligation Adapter (RLA)
- RNA Elution Buffer (REB)
Consumables
- Agencourt RNAClean XP beads (Beckman Coulter™, cat # A63987)
- Induro Reverse Transcriptase and 5 Induro RT Reaction Buffer (NEB, M0681)
- 10 mM dNTP solution (e.g. NEB, cat # N0447)
- NEBNext® Quick Ligation Reaction Buffer (NEB, B6058)
- T4 DNA Ligase 2M U/ml (NEB, cat # M0202M)
- Murine RNase Inhibitor (NEB, M0314)
- Nuclease-free water (e.g. ThermoFisher, AM9937)
- Freshly prepared 70% ethanol in nuclease-free water
- 0.2 ml thin-walled PCR tubes
- 1.5 ml Eppendorf DNA LoBind tubes
- Qubit 1x dsDNA HS Assay Kit (ThermoFisher, Q33230)
- Qubit RNA HS Assay Kit (ThermoFisher, cat # Q32852)
- Qubit™ Assay Tubes (Invitrogen, Q32856)
Equipment
- Hula mixer (gentle rotator mixer)
- Thermal cycler
- Magnetic rack
- Qubit fluorometer (or equivalent for QC check)
- Ice bucket with ice
- P1000 pipette and tips
- P200 pipette and tips
- P100 pipette and tips
- P20 pipette and tips
- P10 pipette and tips
- P2 pipette and tips
Prepare the NEBNext Quick Ligation Reaction Buffer and T4 DNA Ligase according to the manufacturer's instructions, and place on ice:
Thaw the reagents at room temperature.
Spin down the reagent tubes for 5 seconds.
Ensure the reagents are fully mixed by performing 10 full volume pipette mixes. Note: Do NOT vortex the T4 DNA Ligase.
The NEBNext Quick Ligation Reaction Buffer may have a little precipitate. Allow the mixture to come to room temperature and pipette the buffer up and down several times to break up the precipitate, followed by vortexing the tube for several seconds to ensure the reagent is thoroughly mixed.
IMPORTANT
We do not recommend using the Quick T4 Ligase for this protocol. We have found that the T4 DNA Ligase (2M U/ml - NEB M0202M) works better. It needs to be used in combination with the Quick Ligation Reaction Buffer (NEB B6058).
Spin down the custom-ordered sequence targeted reverse transcription adapter and RNA Ligation Adapter (RLA), pipette mix and place on ice.
Thaw the Wash Buffer (WSB) and RNA Elution Buffer (REB) at room temperature and mix by vortexing. Then spin down and place on ice.
Prepare the RNA in nuclease-free water:
- Transfer 1 µg of total RNA into a 0.2 ml thin-walled PCR tube.
- Adjust the volume to 8.5 μl with nuclease-free water.
- Mix thoroughly by flicking the tube to avoid unwanted shearing.
- Spin down briefly in a microfuge.
In the same 0.2 ml thin-walled PCR tube, combine the reagents in the following order:
| Reagent | Volume |
|---|---|
| RNA | 8.5 µl |
| NEBNext Quick Ligation Reaction Buffer | 3 µl |
| Murine RNase Inhibitor | 1 µl |
| Custom-ordered reverse transcription adapter | 1 µl |
| T4 DNA Ligase | 1.5 µl |
| Total | 15 µl |
Mix by pipetting and spin down.
Incubate the reaction for 10 minutes at room temperature.
In a clean 1.5 ml DNA LoBind Eppendorf tube, combine the following reagents together to make the reverse transcription master mix:
| Reagent | Volume |
|---|---|
| Nuclease-free water | 13 µl |
| 10 mM dNTPs | 2 µl |
| 5x Induro RT reaction buffer | 8 µl |
| Total | 23 µl |
Transfer the reverse transcriptase master mix to the 0.2 ml PCR tube containing your adapter-ligated RNA and mix by pipetting.
Add 2 µl of Induro Reverse Transcriptase to the reaction and mix by pipetting.
Place the tube in a thermal cycler and incubate at 60°C for 30 minutes, then 70°C for 10 minutes, and bring the sample to 4°C before proceeding to the next step.
Transfer the sample to a clean 1.5 ml Eppendorf DNA LoBind tube.
Resuspend the stock of Agencourt RNAClean XP beads by vortexing.
Add 72 µl of resuspended Agencourt RNAClean XP beads to the reverse transcription reaction and mix by pipetting.
Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.
Prepare 200 μl of fresh 70% ethanol in nuclease-free water.
Spin down the sample and pellet on a magnet. Keep the tube on the magnet, and pipette off the supernatant when clear and colourless.
Keeping the tube on magnet, wash the beads with 150 µl of freshly prepared 70% ethanol, as described below:
- Add 150 µl of freshly prepared 70% ethanol to the tube and ensure the beads are pelleted on one side of the tube.
- Keeping the magnetic rack on the benchtop, rotate the tube by 180°. Wait for the beads to migrate towards the magnet and to form a pellet.
- Rotate the tube 180° again (back to the starting position), and wait for the beads to pellet again.
Carefully remove the 70% ethanol using a pipette and discard.
Spin down and place the tube back on the magnet until the eluate is clear and colourless. Keep the tube(s) on the magnet and pipette off any residual ethanol.
Remove the tube from the magnetic rack and resuspend the pellet in 23 µl nuclease-free water. Incubate for 5 minutes at room temperature.
Pellet the beads on a magnet until the eluate is clear and colourless.
Remove and retain 23 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.
OPTIONAL ACTION
At this stage the RT-RNA sample can be stored at -80°C for later use.
Please note, this is the only pause point in this protocol.
In the same 1.5 ml Eppendorf DNA LoBind tube, combine the reagents in the following order:
| Reagent | Volume |
|---|---|
| RT-RNA sample | 23 µl |
| NEBNext Quick Ligation Reaction Buffer | 8 µl |
| RNA Ligation Adapter (RLA) | 6 µl |
| T4 DNA Ligase | 3 µl |
| Total | 40 µl |
Mix by pipetting.
Incubate the reaction for 10 minutes at room temperature.
Resuspend the stock of Agencourt RNAClean XP beads by vortexing.
Add 16 µl of resuspended Agencourt RNAClean XP beads to the reaction and mix by pipetting.
Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.
Spin down the sample and pellet on a magnet. Keep the tube on the magnet for 5 minutes, and pipette off the supernatant when clear and colourless.
Add 150 μl of the Wash Buffer (WSB) to the beads. Close the tube lid and resuspend the beads by flicking the tube. Return the tube to the magnetic rack, allow the beads to pellet for 5 minutes and pipette off the supernatant when clear and colourless.
Repeat the previous step.
IMPORTANT
Agitating the beads results in a more efficient removal of free adapter, compared to adding the wash buffer and immediately aspirating.
Spin down the tube and replace onto the magnetic rack until the beads have pelleted to pipette off any remaining Wash Buffer (WSB).
Remove the tube from the magnetic rack and resuspend the pellet in 13 µl RNA Elution Buffer (REB) by the gently flicking the tube. Incubate for 10 minutes at room temperature.
Pellet the beads on a magnet for 5 minutes until the eluate is clear and colourless.
Remove and retain 13 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.
Quantify 1 µl of reverse-transcribed and adapted RNA using the Qubit fluorometer DNA HS assay.
The recovery aim in the final eluate is > 30 ng.
Recovery quantities can vary between different inputs and library preparations. However, we always recommend taking forward the full volume of RNA library for the best sequencing results.
END OF STEP
The reverse-transcribed and adapted RNA is now ready for loading into the flow cell.
IMPORTANT
The RNA library must be sequenced immediately and cannot be stored for later use.
4. Priming and loading the MinION and GridION flow cell
Materials
- Library Solution (LIS)
- Sequencing Buffer (SB)
- RNA Flush Tether (RFT)
- Flow Cell Flush (FCF)
Consumables
- MinION and GridION Flow Cell
- Nuclease-free water (e.g. ThermoFisher, AM9937)
- 1.5 ml Eppendorf DNA LoBind tubes
Equipment
- MinION or GridION device
- MinION and GridION Flow Cell Light Shield
- P1000 pipette and tips
- P100 pipette and tips
- P20 pipette and tips
- P10 pipette and tips
IMPORTANT
Please note, this kit is only compatible with RNA flow cells (FLO-MIN004RA).
TIP
Priming and loading a flow cell
We recommend all new users watch the 'Priming and loading your flow cell' video before your first run.
Thaw the Sequencing Buffer (SB), Library Solution (LIS), RNA Flush Tether (RFT) and Flow Cell Flush (FCF) at room temperature. Mix by vortexing and spin down.
To prepare the flow cell priming mix in a clean 1.5 ml Eppendorf DNA LoBind tube, combine the following reagents. Mix by vortexing and spin down at room temperature.
| Reagent | Volume per flow cell |
|---|---|
| RNA Flush Tether (RFT) | 30 µl |
| Flow Cell Flush (FCF) | 1,170 µl |
| Total | 1,200 µl |
Open the MinION or GridION device lid and slide the flow cell under the clip. Press down firmly on the flow cell to ensure correct thermal and electrical contact.
OPTIONAL ACTION
Complete a flow cell check to assess the number of pores available before loading the library.
This step can be omitted if the flow cell has been checked previously.
See the flow cell check instructions in the MinKNOW protocol for more information.
Slide the flow cell priming port cover clockwise to open the priming port.
IMPORTANT
Take care when drawing back buffer from the flow cell. Do not remove more than 20-30 µl, and make sure that the array of pores are covered by buffer at all times. Introducing air bubbles into the array can irreversibly damage pores.
After opening the priming port, check for a small air bubble under the cover. Draw back a small volume to remove any bubbles:
- Set a P1000 pipette to 200 µl
- Insert the tip into the priming port
- Turn the wheel until the dial shows 220-230 µl, to draw back 20-30 µl, or until you can see a small volume of buffer entering the pipette tip
Note: Visually check that there is continuous buffer from the priming port across the sensor array.
Load 800 µl of the priming mix into the flow cell via the priming port, avoiding the introduction of air bubbles. Wait for five minutes. During this time, prepare the library for loading by following the steps below.
In a new 1.5 ml Eppendorf DNA LoBind tube, prepare the library for loading as follows:
| Reagent | Volume per flow cell |
|---|---|
| Sequencing Buffer (SB) | 37.5 µl |
| Library Solution (LIS) | 25.5 µl |
| RNA library | 12 µl |
| Total | 75 µl |
Complete the flow cell priming:
- Gently lift the SpotON sample port cover to make the SpotON sample port accessible.
- Load 200 µl of the priming mix into the flow cell priming port (not the SpotON sample port), avoiding the introduction of air bubbles.
Mix the prepared library gently by pipetting up and down just prior to loading.
Add 75 μl of the prepared library to the flow cell via the SpotON sample port in a dropwise fashion. Ensure each drop flows into the port before adding the next.
Gently replace the SpotON sample port cover, making sure the bung enters the SpotON port and close the priming port.
IMPORTANT
Install the light shield on your flow cell as soon as library has been loaded for optimal sequencing output.
We recommend leaving the light shield on the flow cell when library is loaded, including during any washing and reloading steps. The shield can be removed when the library has been removed from the flow cell.
Place the light shield onto the flow cell, as follows:
Carefully place the leading edge of the light shield against the clip. Note: Do not force the light shield underneath the clip.
Gently lower the light shield onto the flow cell. The light shield should sit around the SpotON cover, covering the entire top section of the flow cell.
CAUTION
The MinION Flow Cell Light Shield is not secured to the flow cell and careful handling is required after installation.
END OF STEP
Close the device lid and set up a sequencing run on MinKNOW.
5. Data acquisition and basecalling
How to start sequencing
Once you have loaded your flow cell, the sequencing run can be started on MinKNOW, our sequencing software that controls the device, data acquisition and real-time basecalling. For more detailed information on setting up and using MinKNOW, please see the MinKNOW protocol.
MinKNOW can be used and set up to sequence in multiple ways:
- On a computer either directly or remotely connected to a sequencing device.
- Directly on a GridION, MinION Mk1C or PromethION 24/48 sequencing device.
For more information on using MinKNOW on a sequencing device, please see the device user manuals:
To start a sequencing run on MinKNOW:
1. Navigate to the start page and click Start sequencing.
2. Fill in your experiment details, such as name and flow cell position and sample ID.
3. Select the sequencing kit used in the library preparation on the Kit page.
4. Configure the sequencing and output parameters for your sequencing run or keep to the default settings on the Run configuration tab.
Note: If basecalling was turned off when a sequencing run was set up, basecalling can be performed post-run on MinKNOW. For more information, please see the MinKNOW protocol.
5. Click Start to initiate the sequencing run.
Data analysis after sequencing
After sequencing has completed on MinKNOW, the flow cell can be reused or returned, as outlined in the Flow cell reuse and returns section.
After sequencing and basecalling, the data can be analysed. For further information about options for basecalling and post-basecalling analysis, please refer to the Data Analysis document.
In the Downstream analysis section, we outline further options for analysing your data.
6. Flow cell reuse and returns
Materials
- Flow Cell Wash Kit (EXP-WSH004) or Flow Cell Wash Kit XL (EXP-WSH004-XL)
IMPORTANT
Our Flow Cell Wash Kit (EXP-WSH004 or EXP-WSH004-XL) is compatible with RNA Flow Cells and the Direct RNA Sequencing Kit (SQK-RNA004).
However, please be aware that:
- The wash kit doesn’t work as nuclease flush for Direct RNA sequencing: it won’t recover blocked pores.
- It works as a flush to reload new sample: it will wash off most of the library from the array and remove all adapter from the remaining sample, preventing it from being captured and sequencing. This will allow subsequent library loads.
After your sequencing experiment is complete, if you would like to reuse the flow cell, please follow the Flow Cell Wash Kit protocol and store the washed flow cell at 2-8°C.
The Flow Cell Wash Kit protocol is available on the Nanopore Community.
TIP
We recommend you to wash the flow cell as soon as possible after you stop the run. However, if this is not possible, leave the flow cell on the device and wash it the next day.
Alternatively, follow the returns procedure to flush out the flow cell ready to send back to Oxford Nanopore.
Instructions for returning flow cells can be found here.
Note: All flow cells must be flushed with deionised water before returning the product.
IMPORTANT
If you encounter issues or have questions about your sequencing experiment, please refer to the Troubleshooting Guide that can be found in the online version of this protocol.
7. Downstream analysis
Post-basecalling analysis
There are several options for further analysing your basecalled data:
1. EPI2ME workflows
For in-depth data analysis, Oxford Nanopore Technologies offers a range of bioinformatics tutorials and workflows available in EPI2ME. The platform provides a vehicle where workflows deposited in GitHub by our Research and Applications teams can be showcased with descriptive texts, functional bioinformatics code and example data.
2. Research analysis tools
Oxford Nanopore Technologies' Research division has created a number of analysis tools, which are available in the Oxford Nanopore GitHub repository. The tools are aimed at advanced users, and contain instructions for how to install and run the software. They are provided as-is, with minimal support.
3. Community-developed analysis tools
If a data analysis method for your research question is not provided in any of the resources above, please refer to the resource centre and search for bioinformatics tools for your application. Numerous members of the Nanopore Community have developed their own tools and pipelines for analysing nanopore sequencing data, most of which are available on GitHub. Please be aware that these tools are not supported by Oxford Nanopore Technologies, and are not guaranteed to be compatible with the latest chemistry/software configuration.
8. Issues during RNA extraction and library preparation
Below is a list of the most commonly encountered issues, with some suggested causes and solutions.
We also have an FAQ section available on the Nanopore Community Support section.
If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.
Low sample quality
| Observation | Possible cause | Comments and actions |
|---|---|---|
| Low RNA integrity (RNA integrity number <9.5 RIN, or the rRNA band is shown as a smear on the gel) | The RNA degraded during extraction | Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page. |
| RNA has a shorter than expected fragment length | The RNA degraded during extraction | Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page. We recommend working in an RNase-free environment, and to keep your lab equipment RNase-free when working with RNA. |
9. Issues during an RNA sequencing run
Below is a list of the most commonly encountered issues, with some suggested causes and solutions.
We also have an FAQ section available on the Nanopore Community Support section.
If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.
Fewer pores at the start of sequencing than after Flow Cell Check
| Observation | Possible cause | Comments and actions |
|---|---|---|
| MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check | An air bubble was introduced into the nanopore array | After the Flow Cell Check it is essential to remove any air bubbles near the priming port before priming the flow cell. If not removed, the air bubble can travel to the nanopore array and irreversibly damage the nanopores that have been exposed to air. The best practice to prevent this from happening is demonstrated in this video. |
| MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check | The flow cell is not correctly inserted into the device | Stop the sequencing run, remove the flow cell from the sequencing device and insert it again, checking that the flow cell is firmly seated in the device and that it has reached the target temperature. If applicable, try a different position on the device (GridION/PromethION). |
| MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check | Contaminations in the library damaged or blocked the pores | The pore count during the Flow Cell Check is performed using the QC DNA molecules present in the flow cell storage buffer. At the start of sequencing, the library itself is used to estimate the number of active pores. Because of this, variability of about 10% in the number of pores is expected. A significantly lower pore count reported at the start of sequencing can be due to contaminants in the library that have damaged the membranes or blocked the pores. Alternative RNA extraction or purification methods may be needed to improve the purity of the input material. The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover. |
MinKNOW script failed
| Observation | Possible cause | Comments and actions |
|---|---|---|
| MinKNOW shows "Script failed" | Restart the computer and then restart MinKNOW. If the issue persists, please collect the MinKNOW log files and contact Technical Support. If you do not have another sequencing device available, we recommend storing the flow cell and the loaded library at 4°C and contact Technical Support for further storage guidance. |
Pore occupancy below 40%
| Observation | Possible cause | Comments and actions |
|---|---|---|
| Pore occupancy <40% | Not enough library was loaded on the flow cell | Ensure you load the recommended amount of good quality library in the relevant library prep protocol onto your flow cell. Please quantify the library before loading and calculate mols using tools like the NEBio Calculator, choosing "RNA ss: mass to moles" |
| Pore occupancy close to 0 | No tether on the flow cell | Tethers are adding during flow cell priming (FCT tube). Make sure Flow Cell Tether (FCT) was added to Flow Cell Flush (FCF) before priming. |
Large proportion of inactive pores
| Observation | Possible cause | Comments and actions |
|---|---|---|
| Large proportion of inactive/unavailable pores (shown as light blue in the channels panel and pore activity plot. Pores or membranes are irreversibly damaged) | Air bubbles have been introduced into the flow cell | Air bubbles introduced through flow cell priming and library loading can irreversibly damage the pores. Watch the Priming and loading your flow cell video for best practice |
| Large proportion of inactive/unavailable pores | Contaminants are present in the sample | The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover. |
Temperature fluctuation
| Observation | Possible cause | Comments and actions |
|---|---|---|
| Temperature fluctuation | The flow cell has lost contact with the device | Check that there is a heat pad covering the metal plate on the back of the flow cell. Re-insert the flow cell and press it down to make sure the connector pins are firmly in contact with the device. If the problem persists, please contact Technical Services. |
Failed to reach target temperature
| Observation | Possible cause | Comments and actions |
|---|---|---|
| MinKNOW shows "Failed to reach target temperature" | The instrument was placed in a location that is colder than normal room temperature, or a location with poor ventilation (which leads to the flow cells overheating) | MinKNOW has a default timeframe for the flow cell to reach the target temperature. Once the timeframe is exceeded, an error message will appear and the sequencing experiment will continue. However, sequencing at an incorrect temperature may lead to a decrease in throughput and lower q-scores. Please adjust the location of the sequencing device to ensure that it is placed at room temperature with good ventilation, then re-start the process in MinKNOW. Please refer to this FAQ for more information on MinION temperature control. |
Last updated: 7/31/2024
Document options
