Main menu

Ligation sequencing gDNA - PCR barcoding (SQK-LSK109 with EXP-PBC096) (PBGE96_9068_v109_revT_14Aug2019)


Overview

For barcoding genomic DNA for nanopore sequencing

  • Offering highest accuracy
  • ~85 mins library prep
  • using up to 96 barcodes
  • includes PCR steps
  • Compatible with R10.3 flow cells

For Research Use Only

Document version: PBGE96_9068_v109_revT_14Aug2019

1. Overview of the protocol

This is a Legacy product.

The SQK-LSK109 kit has been discontinued. Should you require any assistance or have questions, please contact our Customer Support support@nanoporetech.com.

PCR Barcoding Expansion Pack 1-96 features

This kit is recommended for users who:

  • want to optimise their sequencing experiment for throughput
  • require control over read length
  • would like to utilise upstream processes such as size selection or whole genome amplification
  • want to multiplex up to 96 different samples

Optional fragmentation and size selection

By default, the protocol contains no DNA fragmentation step, however in some cases it may be advantageous to fragment your sample. For example, when working with lower amounts of input gDNA (100 ng – 500 ng), fragmentation will increase the number of DNA molecules and therefore increase throughput. Instructions are available in the DNA Fragmentation section of Extraction methods.

Additionally, we offer several options for size-selecting your DNA sample to enrich for long fragments - instructions are available in the Size Selection section of Extraction methods.

Introduction to the PCR Barcoding Expansion Pack 1-96

This protocol describes how to carry out PCR barcoding using the Ligation Sequencing Kit 1D (SQK-LSK109) and the PCR Barcoding Expansion Pack 1-96 (EXP-PBC096). It is highly recommended that a Lambda control experiment is completed first to become familiar with the technology.

Steps in the sequencing workflow:

Prepare for your experiment

You will need to:

  • Extract your DNA, and check its length, quantity and purity. The quality checks performed during the protocol are essential in ensuring experimental success.
  • Ensure you have your sequencing kit, the correct equipment and third-party reagents
  • Download the software for acquiring and analysing your data
  • Check your flow cell to ensure it has enough pores for a good sequencing run

Library preparation

You will need to:

  • Prepare the DNA ends for adapter attachment
  • Attach barcoding adapters supplied in the kit to the DNA ends
  • Amplify each barcoded sample by PCR, then pool the samples together
  • Repair the DNA, and prepare the DNA ends for adapter attachment
  • Attach sequencing adapters supplied in the kit to the DNA ends
  • Prime the flow cell, and load your DNA library into the flow cell

SQK-LSK109 PCR barcoding

Sequencing and analysis

You will need to:

  • Start a sequencing run using the MinKNOW software, which will collect raw data from the device and convert it into basecalled reads
  • Start the EPI2ME software and select the barcoding workflow

96 barcode sequences

Component Sequence
BC01 / RB01 AAGAAAGTTGTCGGTGTCTTTGTG
BC02 / RB02 TCGATTCCGTTTGTAGTCGTCTGT
BC03 / RB03 GAGTCTTGTGTCCCAGTTACCAGG
BC04 / RB04 TTCGGATTCTATCGTGTTTCCCTA
BC05 / RB05 CTTGTCCAGGGTTTGTGTAACCTT
BC06 / RB06 TTCTCGCAAAGGCAGAAAGTAGTC
BC07 / RB07 GTGTTACCGTGGGAATGAATCCTT
BC08 / RB08 TTCAGGGAACAAACCAAGTTACGT
BC09 / RB09 AACTAGGCACAGCGAGTCTTGGTT
BC10 / RB10 AAGCGTTGAAACCTTTGTCCTCTC
BC11 / RB11 GTTTCATCTATCGGAGGGAATGGA
BC12 / RB12 CAGGTAGAAAGAAGCAGAATCGGA
BC13 / 16S13 / RB13 AGAACGACTTCCATACTCGTGTGA
BC14 / 16S14 / RB14 AACGAGTCTCTTGGGACCCATAGA
BC15 / 16S15 / RB15 AGGTCTACCTCGCTAACACCACTG
BC16 / 16S16 / RB16 CGTCAACTGACAGTGGTTCGTACT
BC17 / 16S17 / RB17 ACCCTCCAGGAAAGTACCTCTGAT
BC18 / 16S18 / RB18 CCAAACCCAACAACCTAGATAGGC
BC19 / 16S19 / RB19 GTTCCTCGTGCAGTGTCAAGAGAT
BC20 / 16S20 / RB20 TTGCGTCCTGTTACGAGAACTCAT
BC21 / 16S21 / RB21 GAGCCTCTCATTGTCCGTTCTCTA
BC22 / 16S22 / RB22 ACCACTGCCATGTATCAAAGTACG
BC23 / 16S23 / RB23 CTTACTACCCAGTGAACCTCCTCG
BC24 / 16S24 / RB24 GCATAGTTCTGCATGATGGGTTAG
BC25 / RB25 GTAAGTTGGGTATGCAACGCAATG
BC26 / RB26 CATACAGCGACTACGCATTCTCAT
BC27 / RB27 CGACGGTTAGATTCACCTCTTACA
BC28 / RB28 TGAAACCTAAGAAGGCACCGTATC
BC29 / RB29 CTAGACACCTTGGGTTGACAGACC
BC30 / RB30 TCAGTGAGGATCTACTTCGACCCA
BC31 / RB31 TGCGTACAGCAATCAGTTACATTG
BC32 / RB32 CCAGTAGAAGTCCGACAACGTCAT
BC33 / RB33 CAGACTTGGTACGGTTGGGTAACT
BC34 / RB34 GGACGAAGAACTCAAGTCAAAGGC
BC35 / RB35 CTACTTACGAAGCTGAGGGACTGC
BC36 / RB36 ATGTCCCAGTTAGAGGAGGAAACA
BC37 / RB37 GCTTGCGATTGATGCTTAGTATCA
BC38 / RB38 ACCACAGGAGGACGATACAGAGAA
BC39 / RB39 CCACAGTGTCAACTAGAGCCTCTC
BC40 / RB40 TAGTTTGGATGACCAAGGATAGCC
BC41 / RB41 GGAGTTCGTCCAGAGAAGTACACG
BC42 / RB42 CTACGTGTAAGGCATACCTGCCAG
BC43 / RB43 CTTTCGTTGTTGACTCGACGGTAG
BC44 / RB44 AGTAGAAAGGGTTCCTTCCCACTC
BC45 / RB45 GATCCAACAGAGATGCCTTCAGTG
BC46 / RB46 GCTGTGTTCCACTTCATTCTCCTG
BC47 / RB47 GTGCAACTTTCCCACAGGTAGTTC
BC48 / RB48 CATCTGGAACGTGGTACACCTGTA
BC49 / RB49 ACTGGTGCAGCTTTGAACATCTAG
BC50 / RB50 ATGGACTTTGGTAACTTCCTGCGT
BC51 / RB51 GTTGAATGAGCCTACTGGGTCCTC
BC52 / RB52 TGAGAGACAAGATTGTTCGTGGAC
BC53 / RB53 AGATTCAGACCGTCTCATGCAAAG
BC54 / RB54 CAAGAGCTTTGACTAAGGAGCATG
BC55 / RB55 TGGAAGATGAGACCCTGATCTACG
BC56 / RB56 TCACTACTCAACAGGTGGCATGAA
BC57 / RB57 GCTAGGTCAATCTCCTTCGGAAGT
BC58 / RB58 CAGGTTACTCCTCCGTGAGTCTGA
BC59 / RB59 TCAATCAAGAAGGGAAAGCAAGGT
BC60 / RB60 CATGTTCAACCAAGGCTTCTATGG
BC61 / RB61 AGAGGGTACTATGTGCCTCAGCAC
BC62 / RB62 CACCCACACTTACTTCAGGACGTA
BC63 / RB63 TTCTGAAGTTCCTGGGTCTTGAAC
BC64 / RB64 GACAGACACCGTTCATCGACTTTC
BC65 / RB65 TTCTCAGTCTTCCTCCAGACAAGG
BC66 / RB66 CCGATCCTTGTGGCTTCTAACTTC
BC67 / RB67 GTTTGTCATACTCGTGTGCTCACC
BC68 / RB68 GAATCTAAGCAAACACGAAGGTGG
BC69 / RB69 TACAGTCCGAGCCTCATGTGATCT
BC70 / RB70 ACCGAGATCCTACGAATGGAGTGT
BC71 / RB71 CCTGGGAGCATCAGGTAGTAACAG
BC72 / RB72 TAGCTGACTGTCTTCCATACCGAC
BC73 / RB73 AAGAAACAGGATGACAGAACCCTC
BC74 / RB74 TACAAGCATCCCAACACTTCCACT
BC75 / RB75 GACCATTGTGATGAACCCTGTTGT
BC76 / RB76 ATGCTTGTTACATCAACCCTGGAC
BC77 / RB77 CGACCTGTTTCTCAGGGATACAAC
BC78 / RB78 AACAACCGAACCTTTGAATCAGAA
BC79 / RB79 TCTCGGAGATAGTTCTCACTGCTG
BC80 / RB80 CGGATGAACATAGGATAGCGATTC
BC81 / RB81 CCTCATCTTGTGAAGTTGTTTCGG
BC82 / RB82 ACGGTATGTCGAGTTCCAGGACTA
BC83 / RB83 TGGCTTGATCTAGGTAAGGTCGAA
BC84 / RB84 GTAGTGGACCTAGAACCTGTGCCA
BC85 / RB85 AACGGAGGAGTTAGTTGGATGATC
BC86 / RB86 AGGTGATCCCAACAAGCGTAAGTA
BC87 / RB87 TACATGCTCCTGTTGTTAGGGAGG
BC88 / RB88 TCTTCTACTACCGATCCGAAGCAG
BC89 / RB89 ACAGCATCAATGTTTGGCTAGTTG
BC90 / RB90 GATGTAGAGGGTACGGTTTGAGGC
BC91 / RB91 GGCTCCATAGGAACTCACGCTACT
BC92 / RB92 TTGTGAGTGGAAAGATACAGGACC
BC93 / RB93 AGTTTCCATCACTTCAGACTTGGG
BC94 / RB94 GATTGTCCTCAAACTGCCACCTAC
BC95 / RB95 CCTGTCTGGAAGAAGAATGGACTT
BC96 / RB96 CTGAACGGTCATAGAGTCCACCAT

We do not recommend mixing barcoded libraries with non-barcoded libraries prior to sequencing.

Compatibility of this protocol

This protocol should only be used in combination with:

  • PCR Barcoding Expansion Pack 1-96 (EXP-PBC096)
  • Ligation Sequencing Kit (SQK-LSK109)
  • R9.4.1 (FLO-MIN106) flow cells
  • Flow Cell Wash Kit (EXP-WSH004)

2. Equipment and consumables

Materials
  • <1 µg of each DNA sample to be barcoded in 45 µl
  • PCR Barcoding Expansion 1-96 (EXP-PBC096)
  • Ligation Sequencing Kit (SQK-LSK109)
  • Flow Cell Priming Kit (EXP-FLP002)


Equipment
  • Hula mixer (gentle rotator mixer)
  • Magnetic separation rack, suitable for 1.5 ml Eppendorf tubes
  • Microfuge
  • Vortex mixer
  • Thermal cycler
  • P1000 pipette and tips
  • P200 pipette and tips
  • P100 pipette and tips
  • P20 pipette and tips
  • P10 pipette and tips
  • P2 pipette and tips
  • Ice bucket with ice
  • Timer
Optional equipment
  • Agilent Bioanalyzer (or equivalent)
  • Qubit™ fluorometer (or equivalent for QC check)
  • Eppendorf 5424 centrifuge (or equivalent)

For this protocol, you will need <1 µg of each DNA sample to be barcoded in 45 µl.

Input DNA

How to QC your input DNA

It is important that the input DNA meets the quantity and quality requirements. Using too little or too much DNA, or DNA of poor quality (e.g. highly fragmented or containing RNA or chemical contaminants) can affect your library preparation.

For instructions on how to perform quality control of your DNA sample, please read the Input DNA/RNA QC protocol.

Chemical contaminants

Depending on how the DNA is extracted from the raw sample, certain chemical contaminants may remain in the purified DNA, which can affect library preparation efficiency and sequencing quality. Read more about contaminants on the Contaminants page of the Community.

NEBNext® Companion Module for Oxford Nanopore Technologies® Ligation Sequencing

For customers new to nanopore sequencing, we recommend buying the NEBNext® Companion Module for Oxford Nanopore Technologies® Ligation Sequencing (catalogue number E7180S or E7180L), which contains all the NEB reagents needed for use with the Ligation Sequencing Kit.

Please note, for our amplicon protocols, NEBNext FFPE DNA Repair Mix and NEBNext FFPE DNA Repair Buffer are not required.

The reagents provided in the NEBNext® Companion Module for Oxford Nanopore Technologies® Ligation Sequencing are sufficient for 8 reactions when following this protocol. If performing more than 8 reactions, an additional 168 µl of NEBNext® Ultra™ II End Prep Reaction Buffer is required.

PCR Barcoding Expansion Pack 1-96 (EXP-PBC096)

2655 10999
Name Acronym Cap colour No. of vials/plates Fill volume per well (µl)
PCR Barcode Primer Mix plate BC01-96 White 1 plate 24
Barcode Adapter plate BCA Blue 1 plate 240

The Barcode Adapter (BCA) tubes in the PCR Barcoding Expansion 1-12 and 1-96 (EXP-PBC001 and EXP-PBC096) are only required for library preparaption of genomic DNA or if PCR with tailed primers is not carried out.

Layout of barcodes in the 96 tube plate

The wells of the 96 tube plate correspond to the barcodes in the following way. All barcodes are supplied at 10 µM concentration and to be used at a final concentration of 0.2 µM.

Barcode 96 plate

Ligation Sequencing Kit contents (SQK-LSK109)

SQK-LSK109 v1

Name Acronym Cap colour No. of vials Fill volume per vial (µl)
DNA CS DCS Yellow 1 50
Adapter Mix AMX Green 1 40
Ligation Buffer LNB Clear 1 200
L Fragment Buffer LFB White cap, orange stripe on label 2 1,800
S Fragment Buffer SFB Grey 2 1,800
Sequencing Buffer SQB Red 2 300
Elution Buffer EB Black 1 200
Loading Beads LB Pink 1 360

Flow Cell Priming Kit contents (EXP-FLP002)

FLP

Name Acronym Cap colour No. of vials Fill volume per vial (μl)
Flush Buffer FB Blue 6 1,170
Flush Tether FLT Purple 1 200

3. Computer requirements and software

MinION Mk1B IT requirements

Sequencing on a MinION Mk1B requires a high-spec computer or laptop to keep up with the rate of data acquisition. For more information, refer to the MinION Mk1B IT requirements document.

MinION Mk1C IT requirements

The MinION Mk1C contains fully-integrated compute and screen, removing the need for any accessories to generate and analyse nanopore data. For more information refer to the MinION Mk1C IT requirements document.

MinION Mk1D IT requirements

Sequencing on a MinION Mk1D requires a high-spec computer or laptop to keep up with the rate of data acquisition. For more information, refer to the MinION Mk1D IT requirements document.

Software for nanopore sequencing

MinKNOW

The MinKNOW software controls the nanopore sequencing device, collects sequencing data and basecalls in real time. You will be using MinKNOW for every sequencing experiment to sequence, basecall and demultiplex if your samples were barcoded.

For instructions on how to run the MinKNOW software, please refer to the MinKNOW protocol.

EPI2ME (optional)

The EPI2ME cloud-based platform performs further analysis of basecalled data, for example alignment to the Lambda genome, barcoding, or taxonomic classification. You will use the EPI2ME platform only if you would like further analysis of your data post-basecalling.

For instructions on how to create an EPI2ME account and install the EPI2ME Desktop Agent, please refer to this link.

Check your flow cell

We highly recommend that you check the number of pores in your flow cell prior to starting a sequencing experiment. This should be done within 12 weeks of purchasing for MinION/GridION/PromethION or within four weeks of purchasing Flongle Flow Cells. Oxford Nanopore Technologies will replace any flow cell with fewer than the number of pores in the table below, when the result is reported within two days of performing the flow cell check, and when the storage recommendations have been followed. To do the flow cell check, please follow the instructions in the Flow Cell Check document.

Flow cell Minimum number of active pores covered by warranty
Flongle Flow Cell 50
MinION/GridION Flow Cell 800
PromethION Flow Cell 5000

4. End-prep

Materials
  • <1 µg of each DNA sample to be barcoded in 45 µl


Equipment
  • Thermal cycler
  • Ice bucket with ice
  • Centrifuge capable of taking 96-well plates
  • Magnetic separation rack, suitable for 1.5 ml Eppendorf tubes
Optional equipment
  • Qubit™ fluorometer (or equivalent for QC check)

Optional fragmentation and size selection

By default, the protocol contains no DNA fragmentation step, however in some cases it may be advantageous to fragment your sample. For example, when working with lower amounts of input gDNA (100 ng – 500 ng), fragmentation will increase the number of DNA molecules and therefore increase throughput. Instructions are available in the DNA Fragmentation section of Extraction methods.

Additionally, we offer several options for size-selecting your DNA sample to enrich for long fragments - instructions are available in the Size Selection section of Extraction methods.

Prepare the DNA in nuclease-free water.

  1. Transfer <1 μg DNA of each sample into a fresh 0.2 ml PCR tube or plate
  2. Adjust the volume to 45 μl with nuclease-free water
  3. Mix thoroughly by flicking the tube to avoid unwanted shearing
  4. Spin down briefly in a microfuge

In a 0.2 ml 96 well PCR plate, set up the end-repair / dA-tailing reactions as follows:

Between each addition, pipette mix 10-20 times.

Reagent Volume
<1 µg DNA 45 µl
Ultra II End-prep reaction buffer 7 µl
Ultra II End-prep enzyme mix 3 µl
Nuclease-free water 5 µl
Total 60 µl

Ensure the components are thoroughly mixed by pipetting, and spin down.

Seal the plate with adhesive film or PCR strip caps, spin down in a centrifuge and incubate for 5 minutes at 20 °C and 5 minutes at 65 °C using the thermal cycler.

If condensation is observed in the plate after the thermocycling, briefly spin down the plate contents in a centrifuge.

Resuspend the AMPure XP beads by vortexing.

Add 60 µl of resuspended AMPure XP beads to the end-prep reaction and mix by pipetting.

Allow DNA to bind to beads for 5 minutes at room temperature.

Prepare sufficient fresh 70% ethanol in nuclease-free water.

Place on a magnetic rack, allow beads to pellet and pipette off supernatant.

Keep the tube on the magnet and wash the beads with 180 µl of freshly-prepared 70% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.

Repeat the previous step.

Cover the plate with adhesive film and leave plate on magnet for 2 minutes to allow residual liquid to collect at the bottom. Remove the adhesive film, return the plate to the magnet and aspirate residual wash solution.

Briefly incubate the plate on a thermal cycler at 37° C with the lid open and the plate wells unsealed.

Remove the plate from the magnet and resuspend pellet in 31 µl nuclease-free water. Incubate for 2 minutes at room temperature.

Pellet the beads on a magnet until the eluate is clear and colourless.

Remove eluate once it is clear and colourless. Transfer each eluted sample to a new 96-well PCR plate.

Quantify 1 µl of end-prepped DNA using a Qubit fluorometer - recovery aim >700 ng.

Take forward approximately 700 ng of end-prepped DNA in 30 µl nuclease-free water into adapter ligation. However, at this point, it is also possible to store the sample at 4°C overnight.

5. Ligation of Barcode Adapter

Materials
  • Barcode Adapter (BCA)

Consumables
  • NEB Blunt/TA Ligase Master Mix (NEB, M0367)
  • Nuclease-free water (e.g. Thermo Scientific, AM9937)
  • Freshly prepared 70% ethanol in nuclease-free water
  • 10 mM Tris-HCl pH 8.5
  • 0.2 ml 96-well PCR plate

Equipment
  • Microplate centrifuge
  • Hula mixer (gentle rotator mixer)
  • Vortex mixer
  • Magnetic rack suitable for 96-well PCR plates, e.g. DynaMag™-96 Side Skirted Magnet (Thermo Fisher,12027)
  • Ice bucket with ice
  • Multichannel pipette and tips
Optional equipment
  • Agilent Bioanalyzer (or equivalent)

Add the reagents to a fresh 96-well plate, in the order given below:

Between each addition, pipette mix 10-20 times.

Reagent Volume
End-prepped DNA 30 µl
Barcode Adapter 20 µl
Blunt/TA Ligase Master Mix 50 µl
Total 100 µl

Ensure the components are thoroughly mixed by pipetting.

Seal the plate with adhesive film or PCR strip caps and briefly spin down in a plate spinner.

Incubate the reaction for 10 minutes at room temperature.

Resuspend the AMPure XP beads by vortexing.

Add 40 µl of resuspended AMPure XP beads to each sample and mix by pipetting up and down ten times.

Allow DNA to bind to beads for 5 minutes at room temperature.

Prepare sufficient fresh 70% ethanol in nuclease-free water.

Place on a magnetic rack, allow beads to pellet and pipette off supernatant.

Keep the tube on the magnet and wash the beads with 180 µl of freshly-prepared 70% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.

Repeat the previous step.

Cover the plate with adhesive film and leave plate on magnet for 2 minutes to allow residual liquid to collect at the bottom. Remove the adhesive film, return the plate to the magnet and aspirate residual wash solution.

Briefly incubate the plate on a thermal cycler at 37° C with the lid open and the plate wells unsealed.

Remove the plate from the magnet and resuspend pellet in 25 µl nuclease-free water. Incubate for 2 minutes at room temperature.

Pellet the beads on a magnet until the eluate is clear and colourless.

Remove eluate once it is clear and colourless. Transfer each eluted sample to a new 96-well PCR plate.

Quantify 1 µl of end-prepped DNA using a Qubit fluorometer.

Dilute the library to a concentration of 10 ng/µl with nuclease-free water or 10 mM Tris-HCl pH 8.5.

Take forward the samples to the next step. However, at this point it is also possible to store the sample at 4°C overnight.

6. Barcoding PCR

Materials
  • PCR Barcodes (BC01-96, at 10 µM)

Consumables
  • LongAmp Taq 2X Master Mix (e.g. NEB, cat # M0287)
  • Nuclease-free water (e.g. Thermo Scientific, AM9937)
  • 1.5 ml Eppendorf DNA LoBind tubes

Equipment
  • Thermal cycler
Optional equipment
  • Qubit™ fluorometer (or equivalent for QC check)

Capping and decapping the 96 well format

Layout of barcodes in the 96 tube plate

The wells of the 96 tube plate correspond to the barcodes in the following way. All barcodes are supplied at 10 µM concentration and to be used at a final concentration of 0.2 µM.

Barcode 96 plate

Set up a barcoding PCR reaction as follows for each library:

The following is written for LongAmp Taq, but can be adapted for use with other polymerases.

Between each addition, pipette mix 10-20 times.

Reagent Volume
PCR Barcode (one of BC1-BC96, at 10 µM) 1 µl
Adapter-ligated DNA 2 µl
LongAmp Taq 2x master mix 25 µl
Nuclease-free water 22 µl
Total volume 50 µl

If the amount of input material is altered, the number of PCR cycles may need to be adjusted to produce the same yield.

Mix by pipetting.

Seal the plate with adhesive film or PCR strip caps and briefly spin down in a plate spinner.

Amplify using the following cycling conditions:

Cycle step Temperature Time No. of cycles
Initial denaturation 95 °C 3 mins 1
Denaturation 95 °C 15 secs 15-18 (b)
Annealing 62 °C (a) 15 secs (a) 15-18 (b)
Extension 65 °C (c) dependent on length of target fragment (d) 15-18 (b)
Final extension 65 °C dependent on length of target fragment (d) 1
Hold 4 °C

a. This is specific to the Oxford Nanopore primer and should be maintained

b. Adjust accordingly if input quantities are altered

c. This temperature is determined by the type of polymerase that is being used (given here for LongAmp Taq polymerase)

d. Adjust accordingly for different lengths of amplicons and the type of polymerase that is being used (LongAmp Taq amplifies at a rate of 50 seconds per kb)

Purify the barcoded DNA using standard methods which are suitable for the fragment size.

Quantify the barcoded library using standard techniques, and pool all barcoded libraries in the desired ratios in a 1.5 ml DNA LoBind Eppendorf tube.

Prepare 1 µg of pooled barcoded libraries in 47 µl nuclease-free water.

If the volume of your pool exceeds the 49 µl required for the end-prep reaction, consider a 2.5x AMPure XP bead purification of the pool to concentrate your sample.

This pooled library is now ready to be end-repaired and adapted for sequencing. However, at this point it is also possible to store the sample at 4°C overnight.

7. End-prep

Materials
  • Pooled barcoded DNA
  • DNA Control Sample (DCS)
  • AMPure XP Beads (AXP)

Consumables
  • 1.5 ml Eppendorf DNA LoBind tubes
  • Nuclease-free water (e.g. Thermo Scientific, AM9937)
  • NEBNext® Ultra™ II End Repair/dA-Tailing Module (NEB, E7546)
  • Freshly prepared 80% ethanol in nuclease-free water
  • Qubit™ Assay Tubes (Invitrogen, Q32856)
  • Qubit dsDNA HS Assay Kit (Invitrogen, Q32851)

Equipment
  • P1000 pipette and tips
  • P100 pipette and tips
  • P10 pipette and tips
  • Thermal cycler
  • Microfuge
  • Hula mixer (gentle rotator mixer)
  • Magnetic separation rack
  • Ice bucket with ice
Optional equipment
  • Qubit™ fluorometer (or equivalent for QC check)

Thaw DNA Control Sample (DCS) at room temperature, spin down, mix by pipetting, and place on ice.

We recommend using the DNA Control Sample (DCS) in your library prep for troubleshooting purposes. However, you can omit this step and make up the extra 1 µl with your sample DNA.

Prepare the NEBNext Ultra II End Repair / dA-tailing Module reagents in accordance with manufacturer's instructions, and place on ice:

For optimal performance, NEB recommend the following:

  1. Thaw all reagents on ice.

  2. Ensure the reagents are well mixed.


Note: Do not vortex the Ultra II End Prep Enzyme Mix.

  1. Always spin down tubes before opening for the first time each day.

  2. The NEBNext Ultra II End Prep Reaction Buffer may contain a white precipitate. If this occurs, allow the mixture(s) to come to room temperature and pipette the buffer several times to break up the precipitate, followed by a quick vortex to mix.

In a 0.2 ml thin-walled PCR tube, mix the following:

Reagent Volume
DNA Control Sample (DCS) 1 µl
DNA 49 µl
Ultra II End-prep Reaction Buffer 7 µl
Ultra II End-prep Enzyme Mix 3 µl
Total 60 µl

Ensure the components are thoroughly mixed by pipetting.

Using a thermal cycler, incubate at 20°C for 5 minutes and 65°C for 5 minutes.

AMPure XP bead clean-up

It is recommended that the repaired/end-prepped DNA sample is subjected to the following clean-up with AMPure XP beads. This clean-up can be omitted for simplicity and to reduce library preparation time. However, it has been observed that omission of this clean-up can: reduce subsequent adapter ligation efficiency, increase the prevalence of chimeric reads, and lead to an increase in pores being unavailable for sequencing. If omitting the clean-up step, proceed to the next section.

Resuspend the AMPure XP Beads (AXP) by vortexing.

Transfer the DNA sample to a clean 1.5 ml Eppendorf DNA LoBind tube.

Add 60 µl of resuspended the AMPure XP Beads (AXP) to the end-prep reaction and mix by flicking the tube.

Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.

Prepare 500 μl of fresh 80% ethanol in nuclease-free water.

Spin down the sample and pellet on a magnet until supernatant is clear and colourless. Keep the tube on the magnet, and pipette off the supernatant.

Keep the tube on the magnet and wash the beads with 200 µl of freshly prepared 80% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.

Repeat the previous step.

Spin down and place the tube back on the magnet. Pipette off any residual ethanol. Allow to dry for ~30 seconds, but do not dry the pellet to the point of cracking.

Remove the tube from the magnetic rack and resuspend the pellet in 61 µl nuclease-free water. Incubate for 2 minutes at room temperature.

Pellet the beads on a magnet until the eluate is clear and colourless, for at least 1 minute.

Remove and retain 61 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.

Quantify 1 µl of eluted sample using a Qubit fluorometer.

Take forward the repaired and end-prepped DNA into the adapter ligation step. However, at this point it is also possible to store the sample at 4°C overnight.

8. Adapter ligation and clean-up

Materials
  • Adapter Mix (AMX)
  • Ligation Buffer (LNB)
  • Long Fragment Buffer (LFB)
  • S Fragment Buffer (SFB)
  • Elution Buffer (EB)

Consumables
  • NEBNext Quick Ligation Module (NEB, E6056)
  • 1.5 ml Eppendorf DNA LoBind tubes
  • Agencourt AMPure XP beads (Beckman Coulter™, A63881)

Equipment
  • Magnetic separation rack
  • Microfuge
  • Vortex mixer
  • P1000 pipette and tips
  • P100 pipette and tips
  • P20 pipette and tips
  • P10 pipette and tips

Although the recommended third-party ligase is supplied with its own buffer, the ligation efficiency of Adapter Mix (AMX) is higher when using Ligation Buffer supplied within the Ligation Sequencing Kit.

Spin down the Adapter Mix (AMX) and Quick T4 Ligase, and place on ice.

Thaw Ligation Buffer (LNB) at room temperature, spin down and mix by pipetting. Due to viscosity, vortexing this buffer is ineffective. Place on ice immediately after thawing and mixing.

Thaw the Elution Buffer (EB) at room temperature and mix by vortexing. Then spin down and place on ice.

Depending on the wash buffer (LFB or SFB) used, the clean-up step after adapter ligation is designed to either enrich for DNA fragments of >3 kb, or purify all fragments equally.

  • To enrich for DNA fragments of 3 kb or longer, use Long Fragment Buffer (LFB)
  • To retain DNA fragments of all sizes, use Short Fragment Buffer (SFB)

To enrich for DNA fragments of 3 kb or longer, thaw one tube of Long Fragment Buffer (LFB) at room temperature, mix by vortexing, spin down and place on ice.

To retain DNA fragments of all sizes, thaw one tube of Short Fragment Buffer (SFB) at room temperature, mix by vortexing, spin down and place on ice.

In a 1.5 ml Eppendorf DNA LoBind tube, mix in the following order:

Between each addition, pipette mix 10 - 20 times.

Reagent Volume
DNA sample from the previous step 60 µl
Ligation Buffer (LNB) 25 µl
NEBNext Quick T4 DNA Ligase 10 µl
Adapter Mix (AMX) 5 µl
Total 100 µl

Ensure the components are thoroughly mixed by pipetting, and spin down.

Incubate the reaction for 10 minutes at room temperature.

If you have omitted the AMPure purification step after DNA repair and end-prep, do not incubate the reaction for longer than 10 minutes.

Resuspend the AMPure XP beads by vortexing.

Add 40 µl of resuspended AMPure XP beads to the reaction and mix by flicking the tube.

Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.

Spin down the sample and pellet on a magnet. Keep the tube on the magnet, and pipette off the supernatant when clear and colourless.

Wash the beads by adding either 250 μl Long Fragment Buffer (LFB) or 250 μl Short Fragment Buffer (SFB). Flick the beads to resuspend, spin down, then return the tube to the magnetic rack and allow the beads to pellet. Remove the supernatant using a pipette and discard.

Repeat the previous step.

Spin down and place the tube back on the magnet. Pipette off any residual supernatant. Allow to dry for ~30 seconds, but do not dry the pellet to the point of cracking.

Remove the tube from the magnetic rack and resuspend the pellet in 15 µl Elution Buffer (EB). Spin down and incubate for 10 minutes at room temperature. For high molecular weight DNA, incubating at 37°C can improve the recovery of long fragments.

Pellet the beads on a magnet until the eluate is clear and colourless, for at least 1 minute.

Remove and retain 15 µl of eluate containing the DNA library into a clean 1.5 ml Eppendorf DNA LoBind tube.

Dispose of the pelleted beads

Quantify 1 µl of eluted sample using a Qubit fluorometer.

We recommend loading 5-50 fmol of the final prepared library onto a flow cell.

Loading more than the maximal recommended amount of DNA can have a detrimental effect on output as higher quantities of DNA results in a larger number of ligated DNA ends with loaded motor protein. This depletes fuel in the Sequencing Buffer, regardless of whether or not the DNA fragments are being sequenced. This leads to fuel depletion and speed drop-off early in the sequencing run. Dilute the libraries in Elution Buffer if required.

If you are using the Flongle for sample prep development, we recommend loading 3-20 fmol instead.

The prepared library is used for loading into the flow cell. Store the library on ice or at 4°C until ready to load.

Library storage recommendations

We recommend storing libraries in Eppendorf DNA LoBind tubes at 4°C for short term storage or repeated use, for example, reloading flow cells between washes. For single use and long-term storage of more than 3 months, we recommend storing libraries at -80°C in Eppendorf DNA LoBind tubes. For further information, please refer to the DNA library stability Know-How document.

If quantities allow, the library may be diluted in Elution Buffer (EB) for splitting across multiple flow cells.

Additional buffer for doing this can be found in the Sequencing Auxiliary Vials expansion (EXP-AUX001), available to purchase separately. This expansion also contains additional vials of Sequencing Buffer (SQB) and Loading Beads (LB), required for loading the libraries onto flow cells.

9. Priming and loading the SpotON flow cell

Materials
  • Flow Cell Priming Kit (EXP-FLP002)
  • Loading Beads (LB)
  • Sequencing Buffer (SQB)

Consumables
  • 1.5 ml Eppendorf DNA LoBind tubes
  • Nuclease-free water (e.g. Thermo Scientific, AM9937)

Equipment
  • MinION Mk1B or Mk1C
  • SpotON Flow Cell
  • MinION/GridION Flow Cell Light Shield
  • P1000 pipette and tips
  • P100 pipette and tips
  • P20 pipette and tips
  • P10 pipette and tips

Priming and loading a flow cell

We recommend all new users watch the 'Priming and loading your flow cell' video before your first run.

Thaw the Sequencing Buffer (SQB), Loading Beads (LB), Flush Tether (FLT) and one tube of Flush Buffer (FB) at room temperature before mixing the reagents by vortexing, and spin down at room temperature.

To prepare the flow cell priming mix, add 30 µl of thawed and mixed Flush Tether (FLT) directly to the tube of thawed and mixed Flush Buffer (FB), and mix by vortexing at room temperature.

Open the MinION device lid and slide the flow cell under the clip.

Press down firmly on the flow cell to ensure correct thermal and electrical contact.

Flow Cell Loading Diagrams Step 1a

Flow Cell Loading Diagrams Step 1b

Complete a flow cell check to assess the number of pores available before loading the library.

This step can be omitted if the flow cell has been checked previously.

See the flow cell check instructions in the MinKNOW protocol for more information.

Slide the flow cell priming port cover clockwise to open the priming port.

Flow Cell Loading Diagrams Step 2

Take care when drawing back buffer from the flow cell. Do not remove more than 20-30 µl, and make sure that the array of pores are covered by buffer at all times. Introducing air bubbles into the array can irreversibly damage pores.

After opening the priming port, check for a small air bubble under the cover. Draw back a small volume to remove any bubbles:

  1. Set a P1000 pipette to 200 µl
  2. Insert the tip into the priming port
  3. Turn the wheel until the dial shows 220-230 µl, to draw back 20-30 µl, or until you can see a small volume of buffer entering the pipette tip

Note: Visually check that there is continuous buffer from the priming port across the sensor array.

Flow Cell Loading Diagrams Step 03 V5

Load 800 µl of the priming mix into the flow cell via the priming port, avoiding the introduction of air bubbles. Wait for five minutes. During this time, prepare the library for loading by following the steps below.

Flow Cell Loading Diagrams Step 04 V5

Thoroughly mix the contents of the Loading Beads (LB) by pipetting.

The Loading Beads (LB) tube contains a suspension of beads. These beads settle very quickly. It is vital that they are mixed immediately before use.

In a new tube, prepare the library for loading as follows:

Reagent Volume per flow cell
Sequencing Buffer (SQB) 37.5 µl
Loading Beads (LB), mixed immediately before use 25.5 µl
DNA library 12 µl
Total 75 µl

Note: Load the library onto the flow cell immediately after adding the Sequencing Buffer (SQB) and Loading Beads (LB) because the fuel in the buffer will start to be consumed by the adapter.

Complete the flow cell priming:

  1. Gently lift the SpotON sample port cover to make the SpotON sample port accessible.
  2. Load 200 µl of the priming mix into the flow cell priming port (not the SpotON sample port), avoiding the introduction of air bubbles.

Flow Cell Loading Diagrams Step 5

Flow Cell Loading Diagrams Step 06 V5

Mix the prepared library gently by pipetting up and down just prior to loading.

Add 75 μl of the prepared library to the flow cell via the SpotON sample port in a dropwise fashion. Ensure each drop flows into the port before adding the next.

Flow Cell Loading Diagrams Step 07 V5

Gently replace the SpotON sample port cover, making sure the bung enters the SpotON port and close the priming port.

Step 8 update

Flow Cell Loading Diagrams Step 9

Install the light shield on your flow cell as soon as library has been loaded for optimal sequencing output.

We recommend leaving the light shield on the flow cell when library is loaded, including during any washing and reloading steps. The shield can be removed when the library has been removed from the flow cell.

Place the light shield onto the flow cell, as follows:

  1. Carefully place the leading edge of the light shield against the clip. Note: Do not force the light shield underneath the clip.

  2. Gently lower the light shield onto the flow cell. The light shield should sit around the SpotON cover, covering the entire top section of the flow cell.

J2264 - Light shield animation Flow Cell FAW optimised

The MinION Flow Cell Light Shield is not secured to the flow cell and careful handling is required after installation.

Close the device lid and set up a sequencing run on MinKNOW.

10. Data acquisition and basecalling

How to start sequencing

Once you have loaded your flow cell, the sequencing run can be started on MinKNOW, our sequencing software that controls the device, data acquisition and real-time basecalling. For more detailed information on setting up and using MinKNOW, please see the MinKNOW protocol.

MinKNOW can be used and set up to sequence in multiple ways:

  • On a computer either directly or remotely connected to a sequencing device.
  • Directly on a GridION or PromethION 24/48 sequencing device.

For more information on using MinKNOW on a sequencing device, please see the device user manuals:


To start a sequencing run on MinKNOW:

1. Navigate to the start page and click Start sequencing.

2. Fill in your experiment details, such as name and flow cell position and sample ID.

3. Select the sequencing kit used in the library preparation on the Kit page.

4. Configure the sequencing and output parameters for your sequencing run or keep to the default settings on the Run configuration tab.

Note: If basecalling was turned off when a sequencing run was set up, basecalling can be performed post-run on MinKNOW. For more information, please see the MinKNOW protocol.

5. Click Start to initiate the sequencing run.

Data analysis after sequencing

After sequencing has completed on MinKNOW, the flow cell can be reused or returned, as outlined in the Flow cell reuse and returns section.

After sequencing and basecalling, the data can be analysed. For further information about options for basecalling and post-basecalling analysis, please refer to the Data Analysis document.

In the Downstream analysis section, we outline further options for analysing your data.

11. Flow cell reuse and returns

Materials
  • Flow Cell Wash Kit (EXP-WSH004)

After your sequencing experiment is complete, if you would like to reuse the flow cell, please follow the Flow Cell Wash Kit protocol and store the washed flow cell at +2°C to +8°C.

The Flow Cell Wash Kit protocol is available on the Nanopore Community.

We recommend you to wash the flow cell as soon as possible after you stop the run. However, if this is not possible, leave the flow cell on the device and wash it the next day.

Alternatively, follow the returns procedure to send the flow cell back to Oxford Nanopore.

Instructions for returning flow cells can be found here.

If you encounter issues or have questions about your sequencing experiment, please refer to the Troubleshooting Guide that can be found in the online version of this protocol.

12. Downstream analysis

Post-basecalling analysis

There are several options for further analysing your basecalled data:

1. EPI2ME workflows

For in-depth data analysis, Oxford Nanopore Technologies offers a range of bioinformatics tutorials and workflows available in EPI2ME. The platform provides a vehicle where workflows deposited in GitHub by our Research and Applications teams can be showcased with descriptive texts, functional bioinformatics code and example data.

2. Research analysis tools

Oxford Nanopore Technologies' Research division has created a number of analysis tools, which are available in the Oxford Nanopore GitHub repository. The tools are aimed at advanced users, and contain instructions for how to install and run the software. They are provided as-is, with minimal support.

3. Community-developed analysis tools

If a data analysis method for your research question is not provided in any of the resources above, please refer to the resource centre and search for bioinformatics tools for your application. Numerous members of the Nanopore Community have developed their own tools and pipelines for analysing nanopore sequencing data, most of which are available on GitHub. Please be aware that these tools are not supported by Oxford Nanopore Technologies, and are not guaranteed to be compatible with the latest chemistry/software configuration.

13. Issues during DNA/RNA extraction and library preparation

Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

We also have an FAQ section available on the Nanopore Community Support section.

If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

Low sample quality

Observation Possible cause Comments and actions
Low DNA purity (Nanodrop reading for DNA OD 260/280 is <1.8 and OD 260/230 is <2.0–2.2) The DNA extraction method does not provide the required purity The effects of contaminants are shown in the Contaminants document. Please try an alternative extraction method that does not result in contaminant carryover.

Consider performing an additional SPRI clean-up step.
Low RNA integrity (RNA integrity number <9.5 RIN, or the rRNA band is shown as a smear on the gel) The RNA degraded during extraction Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page.
RNA has a shorter than expected fragment length The RNA degraded during extraction Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page.

We recommend working in an RNase-free environment, and to keep your lab equipment RNase-free when working with RNA.

Low DNA recovery after AMPure bead clean-up

Observation Possible cause Comments and actions
Low recovery DNA loss due to a lower than intended AMPure beads-to-sample ratio 1. AMPure beads settle quickly, so ensure they are well resuspended before adding them to the sample.

2. When the AMPure beads-to-sample ratio is lower than 0.4:1, DNA fragments of any size will be lost during the clean-up.
Low recovery DNA fragments are shorter than expected The lower the AMPure beads-to-sample ratio, the more stringent the selection against short fragments. Please always determine the input DNA length on an agarose gel (or other gel electrophoresis methods) and then calculate the appropriate amount of AMPure beads to use. SPRI cleanup
Low recovery after end-prep The wash step used ethanol <70% DNA will be eluted from the beads when using ethanol <70%. Make sure to use the correct percentage.

14. Issues during the sequencing run

Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

We also have an FAQ section available on the Nanopore Community Support section.

If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

Fewer pores at the start of sequencing than after Flow Cell Check

Observation Possible cause Comments and actions
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check An air bubble was introduced into the nanopore array After the Flow Cell Check it is essential to remove any air bubbles near the priming port before priming the flow cell. If not removed, the air bubble can travel to the nanopore array and irreversibly damage the nanopores that have been exposed to air. The best practice to prevent this from happening is demonstrated in this video.
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check The flow cell is not correctly inserted into the device Stop the sequencing run, remove the flow cell from the sequencing device and insert it again, checking that the flow cell is firmly seated in the device and that it has reached the target temperature. If applicable, try a different position on the device (GridION/PromethION).
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check Contaminations in the library damaged or blocked the pores The pore count during the Flow Cell Check is performed using the QC DNA molecules present in the flow cell storage buffer. At the start of sequencing, the library itself is used to estimate the number of active pores. Because of this, variability of about 10% in the number of pores is expected. A significantly lower pore count reported at the start of sequencing can be due to contaminants in the library that have damaged the membranes or blocked the pores. Alternative DNA/RNA extraction or purification methods may be needed to improve the purity of the input material. The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

MinKNOW script failed

Observation Possible cause Comments and actions
MinKNOW shows "Script failed"
Restart the computer and then restart MinKNOW. If the issue persists, please collect the MinKNOW log files and contact Technical Support. If you do not have another sequencing device available, we recommend storing the flow cell and the loaded library at 4°C and contact Technical Support for further storage guidance.

Pore occupancy below 40%

Observation Possible cause Comments and actions
Pore occupancy <40% Not enough library was loaded on the flow cell Ensure you load the recommended amount of good quality library in the relevant library prep protocol onto your flow cell. Please quantify the library before loading and calculate mols using tools like the Promega Biomath Calculator, choosing "dsDNA: µg to pmol"
Pore occupancy close to 0 The Ligation Sequencing Kit was used, and sequencing adapters did not ligate to the DNA Make sure to use the NEBNext Quick Ligation Module (E6056) and Oxford Nanopore Technologies Ligation Buffer (LNB, provided in the sequencing kit) at the sequencing adapter ligation step, and use the correct amount of each reagent. A Lambda control library can be prepared to test the integrity of the third-party reagents.
Pore occupancy close to 0 The Ligation Sequencing Kit was used, and ethanol was used instead of LFB or SFB at the wash step after sequencing adapter ligation Ethanol can denature the motor protein on the sequencing adapters. Make sure the LFB or SFB buffer was used after ligation of sequencing adapters.
Pore occupancy close to 0 No tether on the flow cell Tethers are adding during flow cell priming (FLT/FCT tube). Make sure FLT/FCT was added to FB/FCF before priming.

Shorter than expected read length

Observation Possible cause Comments and actions
Shorter than expected read length Unwanted fragmentation of DNA sample Read length reflects input DNA fragment length. Input DNA can be fragmented during extraction and library prep.

1. Please review the Extraction Methods in the Nanopore Community for best practice for extraction.

2. Visualise the input DNA fragment length distribution on an agarose gel before proceeding to the library prep. DNA gel2 In the image above, Sample 1 is of high molecular weight, whereas Sample 2 has been fragmented.

3. During library prep, avoid pipetting and vortexing when mixing reagents. Flicking or inverting the tube is sufficient.

Large proportion of unavailable pores

Observation Possible cause Comments and actions
Large proportion of unavailable pores (shown as blue in the channels panel and pore activity plot)

image2022-3-25 10-43-25 The pore activity plot above shows an increasing proportion of "unavailable" pores over time.
Contaminants are present in the sample Some contaminants can be cleared from the pores by the unblocking function built into MinKNOW. If this is successful, the pore status will change to "sequencing pore". If the portion of unavailable pores stays large or increases:

1. A nuclease flush using the Flow Cell Wash Kit (EXP-WSH004) can be performed, or
2. Run several cycles of PCR to try and dilute any contaminants that may be causing problems.

Large proportion of inactive pores

Observation Possible cause Comments and actions
Large proportion of inactive/unavailable pores (shown as light blue in the channels panel and pore activity plot. Pores or membranes are irreversibly damaged) Air bubbles have been introduced into the flow cell Air bubbles introduced through flow cell priming and library loading can irreversibly damage the pores. Watch the Priming and loading your flow cell video for best practice
Large proportion of inactive/unavailable pores Certain compounds co-purified with DNA Known compounds, include polysaccharides, typically associate with plant genomic DNA.

1. Please refer to the Plant leaf DNA extraction method.
2. Clean-up using the QIAGEN PowerClean Pro kit.
3. Perform a whole genome amplification with the original gDNA sample using the QIAGEN REPLI-g kit.
Large proportion of inactive/unavailable pores Contaminants are present in the sample The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

Reduction in sequencing speed and q-score later into the run

Observation Possible cause Comments and actions
Reduction in sequencing speed and q-score later into the run For Kit 9 chemistry (e.g. SQK-LSK109), fast fuel consumption is typically seen when the flow cell is overloaded with library (please see the appropriate protocol for your DNA library to see the recommendation). Add more fuel to the flow cell by following the instructions in the MinKNOW protocol. In future experiments, load lower amounts of library to the flow cell.

Temperature fluctuation

Observation Possible cause Comments and actions
Temperature fluctuation The flow cell has lost contact with the device Check that there is a heat pad covering the metal plate on the back of the flow cell. Re-insert the flow cell and press it down to make sure the connector pins are firmly in contact with the device. If the problem persists, please contact Technical Services.

Failed to reach target temperature

Observation Possible cause Comments and actions
MinKNOW shows "Failed to reach target temperature" The instrument was placed in a location that is colder than normal room temperature, or a location with poor ventilation (which leads to the flow cells overheating) MinKNOW has a default timeframe for the flow cell to reach the target temperature. Once the timeframe is exceeded, an error message will appear and the sequencing experiment will continue. However, sequencing at an incorrect temperature may lead to a decrease in throughput and lower q-scores. Please adjust the location of the sequencing device to ensure that it is placed at room temperature with good ventilation, then re-start the process in MinKNOW. Please refer to this link for more information on MinION temperature control.

Guppy – no input .fast5 was found or basecalled

Observation Possible cause Comments and actions
No input .fast5 was found or basecalled input_path did not point to the .fast5 file location The --input_path has to be followed by the full file path to the .fast5 files to be basecalled, and the location has to be accessible either locally or remotely through SSH.
No input .fast5 was found or basecalled The .fast5 files were in a subfolder at the input_path location To allow Guppy to look into subfolders, add the --recursive flag to the command

Guppy – no Pass or Fail folders were generated after basecalling

Observation Possible cause Comments and actions
No Pass or Fail folders were generated after basecalling The --qscore_filtering flag was not included in the command The --qscore_filtering flag enables filtering of reads into Pass and Fail folders inside the output folder, based on their strand q-score. When performing live basecalling in MinKNOW, a q-score of 7 (corresponding to a basecall accuracy of ~80%) is used to separate reads into Pass and Fail folders.

Guppy – unusually slow processing on a GPU computer

Observation Possible cause Comments and actions
Unusually slow processing on a GPU computer The --device flag wasn't included in the command The --device flag specifies a GPU device to use for accelerate basecalling. If not included in the command, GPU will not be used. GPUs are counted from zero. An example is --device cuda:0 cuda:1, when 2 GPUs are specified to use by the Guppy command.

Last updated: 3/12/2026

Document options

MinION
Language:

Getting started

Buy a MinION starter pack Nanopore store Sequencing service providers Channel partners

Quick links

Intellectual property Cookie policy Corporate reporting Privacy policy Terms, conditions and policies Accessibility

About Oxford Nanopore

Contact us News Media resources & contacts Investor centre Careers BSI 27001 accreditationBSI 90001 accreditationBSI mark of trust
English flag