Ligation sequencing gDNA - Native Barcoding Kit 24 V14 (SQK-NBD114.24) (NBE_9169_v114_revV_02Jul2025)

Oxford Nanopore Technologies
Document type icon

Flongle: Protocol

Ligation sequencing gDNA - Native Barcoding Kit 24 V14 (SQK-NBD114.24) V NBE_9169_v114_revV_02Jul2025

Barcoding of native genomic DNA libraries

  • Requires the Native Barcoding Kit 24 V14 (SQK-NBD114.24)
  • PCR-free protocol
  • Using up to 24 barcodes
  • Allows analysis of native DNA
  • Compatible with R10.4.1 flow cells

For Research Use Only

FOR RESEARCH USE ONLY

Overview

Barcoding of native genomic DNA libraries

  • Requires the Native Barcoding Kit 24 V14 (SQK-NBD114.24)
  • PCR-free protocol
  • Using up to 24 barcodes
  • Allows analysis of native DNA
  • Compatible with R10.4.1 flow cells

For Research Use Only

Document version: NBE_9169_v114_revV_02Jul2025

1. Overview of the protocol

Introduction to the Native Barcoding Kit 24 V14 protocol

This protocol describes how to carry out native barcoding of genomic DNA (gDNA) using the Native Barcoding Kit 24 V14 (SQK-NBD114.24). There are 24 unique barcodes available, allowing the user to pool up to 24 different samples in one sequencing experiment. It is highly recommended that a Lambda control experiment is completed first to become familiar with the technology.

Steps in the sequencing workflow:

Prepare for your experiment

You will need to:

  • Extract your DNA, and check its length, quantity and purity. The quality checks performed during the protocol are essential in ensuring experimental success.
  • Ensure you have your sequencing kit, the correct equipment and third-party reagents.
  • Download the software for acquiring and analysing your data.
  • Check your flow cell to ensure it has enough pores for a good sequencing run.

Prepare your library

The Table below is an overview of the steps required in the library preparation, including timings and stopping points.

Library preparation Process Time Stop option
DNA repair and end-prep Repair the gDNA, and prepare the DNA ends for adapter attachment 20 minutes 4°C overnight
Native barcode ligation Ligate the native barcodes to the DNA ends 60 minutes 4°C overnight
Adapter ligation and clean-up Ligate sequencing adapters to the DNA ends 50 minutes 4°C for short-term storage or for repeated use, such as for reloading your flow cell
–80°C for long-term storage
Priming and loading the flow cell Prime the flow cell, and load your DNA library into the flow cell 10 minutes

Native barcoding workflow1

Sequencing

You will need to:

  • Start a sequencing run using the MinKNOW software, which will collect raw data from the device and convert it into basecalled reads.
  • Demultiplex barcoded reads in MinKNOW, choosing the SQK-NBD114.24 kit option.
  • Start the EPI2ME software and select a workflow for further analysis (this step is optional).

We do not recommend mixing barcoded libraries with non-barcoded libraries prior to sequencing.

Optional fragmentation and size selection

By default, the protocol contains no DNA fragmentation step, however in some cases it may be advantageous to fragment your sample. For example, when working with lower amounts of input gDNA (100 ng – 500 ng), fragmentation will increase the number of DNA molecules and therefore increase throughput. Instructions are available in the DNA Fragmentation section of Extraction methods.

Additionally, we offer several options for size-selecting your DNA sample to enrich for long fragments - instructions are available in the Size Selection section of Extraction methods.

Compatibility of this protocol

This protocol should only be used in combination with:

2. Equipment and consumables

Materials
  • Native Barcoding Kit 24 V14 (SQK-NBD114.24)
  • 400 ng gDNA per sample if using >4 barcodes
  • OR 1000 ng gDNA per sample if using ≤4 barcodes
  • Flongle Sequencing Expansion (EXP-FSE002)
Consumables
  • Flongle device - flow cell and adapter
  • NEB Blunt/TA Ligase Master Mix (NEB, M0367)
  • NEBNext FFPE Repair Mix (NEB, M6630)
  • NEBNext Ultra II End repair/dA-tailing Module (NEB, E7546)
  • NEBNext Quick Ligation Module (NEB, E6056)
  • Eppendorf twin.tec® PCR plate 96 LoBind, semi-skirted (Eppendorf™, 0030129504) with heat seals
  • 1.5 ml Eppendorf DNA LoBind tubes
  • 2 ml Eppendorf DNA LoBind tubes
  • Nuclease-free water (e.g. ThermoFisher, AM9937)
  • Freshly prepared 80% ethanol in nuclease-free water
  • Qubit™ Assay Tubes (Invitrogen, Q32856)
  • Qubit™ dsDNA HS Assay Kit (ThermoFisher, Q32851)
Equipment
  • Hula mixer (gentle rotator mixer)
  • Microplate centrifuge, e.g. Fisherbrand™ Mini Plate Spinner Centrifuge (Fisher Scientific,11766427)
  • Microfuge
  • Magnetic separation rack
  • Vortex mixer
  • Thermal cycler
  • Multichannel pipette and tips
  • P1000 pipette and tips
  • P200 pipette and tips
  • P100 pipette and tips
  • P20 pipette and tips
  • P10 pipette and tips
  • P2 pipette and tips
  • Ice bucket with ice
  • Timer
  • Eppendorf 5424 centrifuge (or equivalent)
  • Qubit™ fluorometer (or equivalent for QC check)
Optional equipment
  • Nanodrop spectrophotometer

Flow cell deterioration/saturation

At Oxford Nanopore, we are continuously improving our production processes to deliver more robust products. In the case of the Flongle, we are seeing an improvement in the stability of the flow cells that we ship. However, a small number of flow cells have been shown to rapidly deteriorate upon loading. This can be seen as saturation in the MinKNOW GUI and we are working hard to resolve this issue. In the meantime, we suggest the following loading recommendations and the use of buffers from the Flongle Sequencing Expansion (EXP-FSE002) shipped with your Flongle Flow Cells. If your flow cell rapidly deteriorates/saturates upon loading, please contact support@nanoporetech.com for assistance.

Loading recommendations: Following standard input recommendations, the protocol should produce final library (adapted DNA in Elution Buffer (EB)) to load at least two Flongle Flow Cells. We recommend reserving sufficient library to load a second Flongle Flow Cell, should you need to generate more data.

Flongle Sequencing Expansion (EXP-FSE002)

There are three components that come into direct contact with a flow cell at the point of loading (SB: Sequencing Buffer, FCF: Flow Cell Flush and LIB: Library Beads or LIS: Library Solution). These components are stored in plastic vials, and we found very low levels of contaminants seeping out of this plastic and impacting the robustness of the Flongle Flow Cell (MinION and PromethION Flow Cells are not affected by this).

When storing these components in glass vials instead of plastic, the incidence of flow cell deterioration was found to be reduced.

Flongle data

As a result, we have produced a Flongle Sequencing Expansion (EXP-FSE002) with the three components in glass vials, sufficient for 12 Flongle Flow Cell loads in total.

To load a library onto your Flongle Flow Cell, you will need to use the following:

Flongle Sequencing Expansion (EXP-FSE002) components

  • Sequencing Buffer (SB)
  • Flow Cell Flush (FCF)
  • Library Beads (LIB) or Library Solution (LIS)

Sequencing Kit components

  • Flow Cell Tether (FCT)

Oxford Nanopore deems the lifespan of the Flow Cell Expansion to be 6 months from receipt by the customer.

For this protocol, we recommend the following inputs:

  • 400 ng per sample for >4 barcodes
  • 1000 ng per sample for ≤4 barcodes

Input DNA

How to QC your input DNA

It is important that the input DNA meets the quantity and quality requirements. Using too little or too much DNA, or DNA of poor quality (e.g. highly fragmented or containing RNA or chemical contaminants) can affect your library preparation.

For instructions on how to perform quality control of your DNA sample, please read the Input DNA/RNA QC protocol.

Chemical contaminants

Depending on how the DNA is extracted from the raw sample, certain chemical contaminants may remain in the purified DNA, which can affect library preparation efficiency and sequencing quality. Read more about contaminants on the Contaminants page of the Community.

Check your flow cell

We highly recommend that you check the number of pores in your flow cell prior to starting a sequencing experiment. This should be done within 12 weeks of purchasing your MinION/GridION/PromethION Flow Cells or within four weeks of purchasing Flongle Flow Cells. Oxford Nanopore Technologies will replace any unused flow cell with fewer than the number of pores listed in the Table below, when the result is reported within two days of performing the flow cell check, and when the storage recommendations have been followed. To do the flow cell check, please follow the instructions in the Flow Cell Check document.

Flow cell Minimum number of active pores covered by warranty
Flongle Flow Cell 50
MinION/GridION Flow Cell 800
PromethION Flow Cell 5000

Third-party reagents

We have validated and recommend the use of all the third-party reagents used in this protocol. Alternatives have not been tested by Oxford Nanopore Technologies.

For all third-party reagents, we recommend following the manufacturer's instructions to prepare the reagents for use.

The Native Adapter (NA) used in this kit and protocol is not interchangeable with other sequencing adapters.

Native Barcoding Kit 24 V14 (SQK-NBD114.24) contents

Note: We are in the process of updating our native barcoding kits with an increased volume of Short Fragment Buffer (SFB). If you have an old format kit and/or require additional volume of Short Fragment Buffer (SFB), this can be purchased via our SFB Expansion (EXP-SFB001).

New format: increased volume of Short Fragment Buffer (SFB)

SQK-NBD11424_SFB_update_kit_image_June2025

Name Acronym Cap colour No. of vials Fill volume per vial (µl)
DNA Control Sample DCS Yellow 2 35
Native Adapter NA Green 1 40
Sequencing Buffer SB Red 1 700
Library Beads LIB Pink 1 600
Library Solution LIS White cap, pink label 1 600
Elution Buffer EB Black 2 500
AMPure XP Beads AXP Clear cap, light teal label 1 6,000
Long Fragment Buffer LFB Orange 1 1,800
Short Fragment Buffer SFB Clear 1 13,000
EDTA EDTA Blue 1 700
Flow Cell Flush FCF Clear cap, light blue label 1 8,000
Flow Cell Tether FCT Purple 1 200
Native Barcode plate NB01-24 - 2 plates, 3 sets of barcodes per plate 5 µl per well

Old format: lower volume of Short Fragment Buffer (SFB)

SQK-NBD114.24 plate format

Name Acronym Cap colour No. of vials Fill volume per vial (µl)
DNA Control Sample DCS Yellow 2 35
Native Adapter NA Green 1 40
Sequencing Buffer SB Red 1 700
Library Beads LIB Pink 1 600
Library Solution LIS White cap, pink label 1 600
Elution Buffer EB Black 2 500
AMPure XP Beads AXP Clear cap, light teal label 1 6,000
Long Fragment Buffer LFB Orange 1 1,800
Short Fragment Buffer SFB Clear 1 1,800
EDTA EDTA Blue 1 700
Flow Cell Flush FCF Clear cap, light blue label 1 8,000
Flow Cell Tether FCT Purple 1 200
Native Barcode plate NB01-24 - 2 plates, 3 sets of barcodes per plate 5 µl per well

Note: This product contains AMPure XP reagent manufactured by Beckman Coulter, Inc. and can be stored at -20°C with the kit without detriment to reagent stability.

Note: The DNA Control Sample (DCS) is a 3.6 kb standard amplicon mapping the 3' end of the Lambda genome.

Flongle Sequencing Expansion (EXP-FSE002) contents

EXP-FSE002 kit contents v2

Name Acronym Cap colour Number of vials Fill volume per vial (µl)
Sequencing Buffer SB Blue 1 250
Library Beads LIB Blue 1 200
Library Solution LIS Blue 1 200
Flow Cell Flush FCF Blue 1 1,600

Please note that Oxford Nanopore Technologies deems the lifespan of the Flongle Sequencing Expansion (EXP-FSE002) to be 6 months from receipt by the customer.

To maximise the use of the Native Barcoding Kits, the Native Barcode Auxiliary V14 (EXP-NBA114) expansion pack is available.

This expansion provides extra library preparation reagents to allow users to utilise any unused barcodes for those running in smaller subsets.

This expansion pack will provide enough reagents for 12 reactions. For customers requiring extra EDTA, we recommend using 0.25M EDTA.

Native Barcode Auxiliary V14 (EXP-NBA114) contents:

EXP-NBA114 tubes

Name Acronym Cap colour No. of vials Fill volume per vial (µl)
Native Adapter NA Green 2 40
AMPure XP Beads AXP Amber 1 400
Long Fragment Buffer LFB Orange 2 1,800
Short Fragment Buffer SFB Clear 2 1,800

Note: This product contains AMPure XP reagent manufactured by Beckman Coulter, Inc. and can be stored at -20°C with the kit without detriment to reagent stability.

Native barcode sequences

Component Forward sequence Reverse sequence
NB01 CACAAAGACACCGACAACTTTCTT AAGAAAGTTGTCGGTGTCTTTGTG
NB02 ACAGACGACTACAAACGGAATCGA TCGATTCCGTTTGTAGTCGTCTGT
NB03 CCTGGTAACTGGGACACAAGACTC GAGTCTTGTGTCCCAGTTACCAGG
NB04 TAGGGAAACACGATAGAATCCGAA TTCGGATTCTATCGTGTTTCCCTA
NB05 AAGGTTACACAAACCCTGGACAAG CTTGTCCAGGGTTTGTGTAACCTT
NB06 GACTACTTTCTGCCTTTGCGAGAA TTCTCGCAAAGGCAGAAAGTAGTC
NB07 AAGGATTCATTCCCACGGTAACAC GTGTTACCGTGGGAATGAATCCTT
NB08 ACGTAACTTGGTTTGTTCCCTGAA TTCAGGGAACAAACCAAGTTACGT
NB09 AACCAAGACTCGCTGTGCCTAGTT AACTAGGCACAGCGAGTCTTGGTT
NB10 GAGAGGACAAAGGTTTCAACGCTT AAGCGTTGAAACCTTTGTCCTCTC
NB11 TCCATTCCCTCCGATAGATGAAAC GTTTCATCTATCGGAGGGAATGGA
NB12 TCCGATTCTGCTTCTTTCTACCTG CAGGTAGAAAGAAGCAGAATCGGA
NB13 AGAACGACTTCCATACTCGTGTGA TCACACGAGTATGGAAGTCGTTCT
NB14 AACGAGTCTCTTGGGACCCATAGA TCTATGGGTCCCAAGAGACTCGTT
NB15 AGGTCTACCTCGCTAACACCACTG CAGTGGTGTTAGCGAGGTAGACCT
NB16 CGTCAACTGACAGTGGTTCGTACT AGTACGAACCACTGTCAGTTGACG
NB17 ACCCTCCAGGAAAGTACCTCTGAT ATCAGAGGTACTTTCCTGGAGGGT
NB18 CCAAACCCAACAACCTAGATAGGC GCCTATCTAGGTTGTTGGGTTTGG
NB19 GTTCCTCGTGCAGTGTCAAGAGAT ATCTCTTGACACTGCACGAGGAAC
NB20 TTGCGTCCTGTTACGAGAACTCAT ATGAGTTCTCGTAACAGGACGCAA
NB21 GAGCCTCTCATTGTCCGTTCTCTA TAGAGAACGGACAATGAGAGGCTC
NB22 ACCACTGCCATGTATCAAAGTACG CGTACTTTGATACATGGCAGTGGT
NB23 CTTACTACCCAGTGAACCTCCTCG CGAGGAGGTTCACTGGGTAGTAAG
NB24 GCATAGTTCTGCATGATGGGTTAG CTAACCCATCATGCAGAACTATGC

3. DNA repair and end-prep

Materials
  • 400 ng gDNA per barcode
  • OR 1000 ng gDNA per sample if using ≤4 barcodes
  • AMPure XP Beads (AXP)
  • DNA Control Sample (DCS)
Consumables
  • NEBNext® FFPE DNA Repair Mix (NEB, M6630)
  • NEBNext® Ultra™ II End Repair/dA-Tailing Module (NEB, E7546)
  • Freshly prepared 80% ethanol in nuclease-free water
  • 1.5 ml Eppendorf DNA LoBind tubes
  • Eppendorf twin.tec® PCR plate 96 LoBind, semi-skirted (Eppendorf™, 0030129504) with heat seals
  • OR 0.2 ml thin-walled PCR tubes
  • Nuclease-free water (e.g. ThermoFisher, AM9937)
  • Qubit™ Assay Tubes (Invitrogen, Q32856)
  • Qubit dsDNA HS Assay Kit (Invitrogen, Q32851)
Equipment
  • P1000 pipette and tips
  • P200 pipette and tips
  • P100 pipette and tips
  • P20 pipette and tips
  • P10 pipette and tips
  • P2 pipette and tips
  • Multichannel pipette and tips
  • Thermal cycler
  • Microplate centrifuge, e.g. Fisherbrand™ Mini Plate Spinner Centrifuge (Fisher Scientific,11766427)
  • Microfuge
  • Ice bucket with ice
  • Magnetic separation rack
  • Vortex mixer
  • Hula mixer (rotator mixer)
  • Qubit fluorometer (or equivalent)

For samples containing long gDNA fragments, we recommend using wide-bore pipette tips for the mixing steps to preserve the DNA length.

Thaw the AMPure XP Beads (AXP) and DNA Control Sample (DCS) at room temperature and mix by vortexing. Keep the beads at room temperature and store the DNA Control Sample (DCS) on ice.

Prepare the NEBNext FFPE DNA Repair Mix and NEBNext Ultra II End Repair / dA-tailing Module reagents in accordance with manufacturer’s instructions, and place on ice.

For optimal performance, NEB recommend the following:

  1. Thaw all reagents on ice.

  2. Flick and/or invert the reagent tubes to ensure they are well mixed.
    Note: Do not vortex the FFPE DNA Repair Mix or Ultra II End Prep Enzyme Mix.

  3. Always spin down tubes before opening for the first time each day.

  4. The Ultra II End Prep Reaction Buffer and FFPE DNA Repair Buffer may have a little precipitate. Allow the mixture to come to room temperature and pipette the buffer up and down several times to break up the precipitate, followed by vortexing the tube for 30 seconds to solubilise any precipitate.
    Note: It is important the buffers are mixed well by vortexing.

  5. The FFPE DNA Repair Buffer may have a yellow tinge and is fine to use if yellow.

Do not vortex the NEBNext FFPE DNA Repair Mix or NEBNext Ultra II End Prep Enzyme Mix.

It is important that the NEBNext FFPE DNA Repair Buffer and NEBNext Ultra II End Prep Reaction Buffer are mixed well by vortexing.

Check for any visible precipitate; vortexing for at least 30 seconds may be required to solubilise any precipitate.

Dilute your DNA Control Sample (DCS) by adding 105 µl Elution Buffer (EB) directly to one DCS tube. Mix gently by pipetting and spin down.

One tube of diluted DNA Control Sample (DCS) is enough for 140 samples. Excess can be stored at -20°C in the freezer.

We recommend using the DNA Control Sample (DCS) in your library prep for troubleshooting purposes. However, you can omit this step and make up the extra 1 µl with your sample DNA.

In clean 0.2 ml thin-walled PCR tubes (or a clean 96-well plate), prepare your DNA samples:

  • For >4 barcodes, aliquot 400 ng per sample
  • For ≤4 barcodes, aliquot 1000 ng per sample

Make up each sample to 11 µl using nuclease-free water. Mix gently by pipetting and spin down.

Combine the following components per tube/well:

Between each addition, pipette mix 10 - 20 times.

Reagent Volume
DNA sample 11 µl
Diluted DNA Control Sample (DCS) 1 µl
NEBNext FFPE DNA Repair Buffer 0.875 µl
Ultra II End-prep Reaction Buffer 0.875 µl
Ultra II End-prep Enzyme Mix 0.75 µl
NEBNext FFPE DNA Repair Mix 0.5 µl
Total 15 µl

We recommend making up a mastermix of the End Prep and DNA Repair reagents for the total number of samples and adding 3 µl to each well.

Ensure the components are thoroughly mixed by pipetting and spin down in a centrifuge.

Using a thermal cycler, incubate at 20°C for 5 minutes and 65°C for 5 minutes.

Transfer each sample into a clean 1.5 ml Eppendorf DNA LoBind tube.

Resuspend the AMPure XP beads (AXP) by vortexing.

Add 15 µl of resuspended AMPure XP Beads (AXP) to each end-prep reaction and mix by flicking the tube.

Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.

Prepare sufficient fresh 80% ethanol in nuclease-free water for all of your samples. Allow enough for 400 µl per sample, with some excess.

Spin down the samples and pellet the beads on a magnet until the eluate is clear and colourless. Keep the tubes on the magnet and pipette off the supernatant.

Keep the tube on the magnet and wash the beads with 200 µl of freshly prepared 80% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.

If the pellet was disturbed, wait for beads to pellet again before removing the ethanol.

Repeat the previous step.

Briefly spin down and place the tubes back on the magnet for the beads to pellet. Pipette off any residual ethanol. Allow to dry for 30 seconds, but do not dry the pellets to the point of cracking.

Remove the tubes from the magnetic rack and resuspend the pellet in 10 µl nuclease-free water. Spin down and incubate for 2 minutes at room temperature.

Pellet the beads on a magnet until the eluate is clear and colourless.

Remove and retain 10 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.

  • Dispose of the pelleted beads

Quantify 1 µl of each eluted sample using a Qubit fluorometer.

Take forward an equimolar mass of each sample to be barcoded forward into the native barcode ligation step. However, you may store the samples at 4°C overnight.

4. Native barcode ligation

Materials
  • Native Barcodes (NB01-24)
  • AMPure XP Beads (AXP)
  • EDTA (EDTA)
  • Short Fragment Buffer (SFB)
Consumables
  • NEB Blunt/TA Ligase Master Mix (NEB, M0367)
  • Nuclease-free water (e.g. ThermoFisher, AM9937)
  • 1.5 ml Eppendorf DNA LoBind tubes
  • Eppendorf twin.tec® PCR plate 96 LoBind, semi-skirted (Eppendorf™, 0030129504) with heat seals
  • OR 0.2 ml thin-walled PCR tubes
  • Qubit™ Assay Tubes (Invitrogen, Q32856)
  • Qubit™ dsDNA HS Assay Kit (ThermoFisher, Q32851)
Equipment
  • Magnetic separation rack
  • Vortex mixer
  • Hula mixer (gentle rotator mixer)
  • Microfuge
  • Thermal cycler
  • Ice bucket with ice
  • Multichannel pipette and tips
  • P1000 pipette and tips
  • P200 pipette and tips
  • P100 pipette and tips
  • P20 pipette and tips
  • P10 pipette and tips
  • P2 pipette and tips
  • Qubit™ fluorometer (or equivalent for QC check)

Prepare the NEB Blunt/TA Ligase Master Mix according to the manufacturer's instructions, and place on ice:

  1. Thaw the reagents at room temperature.

  2. Spin down the reagent tubes for 5 seconds.

  3. Ensure the reagents are fully mixed by performing 10 full volume pipette mixes.

Thaw the EDTA at room temperature and mix by vortexing. Then spin down and place on ice.

Thaw the Short Fragment Buffer (SFB) at room temperature and mix by vortexing. Place on ice.

Thaw the Native Barcodes (NB01-24) at room temperature. Briefly spin down, individually mix the barcodes required for your number of samples by pipetting, and place them on ice.

Select a unique barcode for each sample to be run together on the same flow cell. Up to 24 samples can be barcoded and combined in one experiment.

Please note: Only use one barcode per sample.

In clean 0.2 ml PCR-tubes or a 96-well plate, add the reagents in the following order per well:

Between each addition, pipette mix 10 - 20 times.

Reagent Volume
End-prepped DNA 7.5 µl
Native Barcode (NB01-24) 2.5 µl
Blunt/TA Ligase Master Mix 10 µl
Total 20 µl

Thoroughly mix the reaction by gently pipetting and briefly spinning down.

Incubate for 20 minutes at room temperature.

Add the following volume of EDTA to each well and mix thoroughly by pipetting and spin down briefly.

Note: Ensure you follow the instructions for the cap colour of your EDTA tube.

EDTA cap colour Volume per well
For clear cap EDTA 2 µl
For blue cap EDTA 4 µl

EDTA is added at this step to stop the reaction.

Pool all the barcoded samples in a 1.5 ml Eppendorf DNA LoBind tube.

Note: Ensure you follow the instructions for the cap colour of your EDTA tube.

Volume per sample For 6 samples For 12 samples For 24 samples
Total volume for preps using clear cap EDTA 22 µl 132 µl 264 µl 528 µl
Total volume for preps using blue cap EDTA 24 µl 144 µl 288 µl 576 µl

We recommend checking the base of your tubes/plate are all the same volume before pooling and after to ensure all the liquid has been taken forward.

Resuspend the AMPure XP Beads (AXP) by vortexing.

Add 0.4X AMPure XP Beads (AXP) to the pooled reaction, and mix by pipetting.

Note: Ensure you follow the instructions for the cap colour of your EDTA tube.

Volume per sample For 6 samples For 12 samples For 24 samples
Volume of AXP for preps using clear cap EDTA 9 µl 53 µl 106 µl 211 µl
Volume of AXP for preps using blue cap EDTA 10 µl 58 µl 115 µl 230 µl

Incubate on a Hula mixer (rotator mixer) for 10 minutes at room temperature.

For optimal results we recommend using Short Fragment Buffer (SFB) for the clean-up steps following native barcoding.

Our development teams have determined that using the Short Fragment Buffer (SFB) instead of ethanol for the post-barcoding washes removes excess barcode more efficiently. This translates to improved barcode classification rates and reduced physical barcode cross-talk.

New batches of the native barcoding kits will contain sufficient Short Fragment Buffer (SFB) to follow the updated method. If you have an older format of the native barcoding kit with a lower volume of Short Fragment Buffer (SFB), you may require additional reagents available through the SFB Expansion (EXP-SFB001).


Please note, the old method using 80% ethanol is still compatible with this method. If you wish to continue using 80% ethanol for your post-barcoding wash, please follow the steps below:

  • Prepare sufficient fresh 80% ethanol in nuclease-free water for your washes.
  • Use the freshly prepared 80% ethanol in place of the Short Fragment Buffer (SFB) for the wash steps below.

Spin down the sample and pellet on a magnet for 5 minutes. Keep the tube on the magnetic rack until the eluate is clear and colourless, and pipette off the supernatant.

Keep the tube on the magnetic rack and wash the beads with 700 µl of Short Fragment Buffer (SFB) without disturbing the pellet. Remove the buffer using a pipette and discard.

If the pellet was disturbed, wait for beads to pellet again before removing the buffer.

Repeat the previous step.

Spin down and place the tube back on the magnetic rack. Pipette off any residual buffer.

Remove the tube from the magnetic rack and resuspend the pellet in 35 µl nuclease-free water by gently flicking.

Incubate for 10 minutes at 37°C. Every 2 minutes, agitate the sample by gently flicking for 10 seconds to encourage DNA elution.

Pellet the beads on a magnetic rack until the eluate is clear and colourless.

Remove and retain 35 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.

Quantify 1 µl of eluted sample using a Qubit fluorometer.

Take forward the barcoded DNA library to the adapter ligation and clean-up step. However, you may store the sample at 4°C overnight.

5. Adapter ligation and clean-up

Materials
  • Long Fragment Buffer (LFB)
  • Short Fragment Buffer (SFB)
  • Elution Buffer (EB)
  • Native Adapter (NA)
  • AMPure XP Beads (AXP)
Consumables
  • NEBNext® Quick Ligation Module (NEB, E6056)
  • NEBNext® Quick Ligation Reaction Buffer (NEB, B6058)
  • 1.5 ml Eppendorf DNA LoBind tubes
  • Qubit™ Assay Tubes (Invitrogen, Q32856)
  • Qubit™ dsDNA HS Assay Kit (ThermoFisher, Q32851)
Equipment
  • Microfuge
  • Magnetic separation rack
  • Vortex mixer
  • Hula mixer (gentle rotator mixer)
  • Thermal cycler
  • P1000 pipette and tips
  • P200 pipette and tips
  • P100 pipette and tips
  • P20 pipette and tips
  • P10 pipette and tips
  • Ice bucket with ice
  • Qubit™ fluorometer (or equivalent for QC check)

The Native Adapter (NA) used in this kit and protocol is not interchangeable with other sequencing adapters.

Check your flow cell.

We recommend performing a flow cell check before starting adapter ligation and clean-up to ensure you have a flow cell with sufficient pores for a good sequencing run.

See the flow cell check instructions in the MinKNOW protocol for more information.

Prepare the NEBNext Quick Ligation Reaction Module according to the manufacturer's instructions, and place on ice:

  1. Thaw the reagents at room temperature.

  2. Spin down the reagent tubes for 5 seconds.

  3. Ensure the reagents are fully mixed by performing 10 full volume pipette mixes. Note: Do NOT vortex the Quick T4 DNA Ligase.

The NEBNext Quick Ligation Reaction Buffer (5x) may have a little precipitate. Allow the mixture to come to room temperature and pipette the buffer up and down several times to break up the precipitate, followed by vortexing the tube for several seconds to ensure the reagent is thoroughly mixed.

Do not vortex the Quick T4 DNA Ligase.

Spin down the Native Adapter (NA) and Quick T4 DNA Ligase, pipette mix and place on ice.

Thaw the Elution Buffer (EB) at room temperature and mix by vortexing. Then spin down and place on ice.

Depending on the wash buffer (LFB or SFB) used, the clean-up step after adapter ligation is designed to either enrich for DNA fragments of >3 kb, or purify all fragments equally.

  • To enrich for DNA fragments of 3 kb or longer, use Long Fragment Buffer (LFB)
  • To retain DNA fragments of all sizes, use Short Fragment Buffer (SFB)

Thaw either Long Fragment Buffer (LFB) or Short Fragment Buffer (SFB) at room temperature and mix by vortexing. Then spin down and keep at room temperature.

In a 1.5 ml Eppendorf LoBind tube, mix in the following order:

Between each addition, pipette mix 10 - 20 times.

Reagent Volume
Pooled barcoded sample 30 µl
Native Adapter (NA) 5 µl
NEBNext Quick Ligation Reaction Buffer (5X) 10 µl
Quick T4 DNA Ligase 5 µl
Total 50 µl

Thoroughly mix the reaction by gently pipetting and briefly spinning down.

Incubate the reaction for 20 minutes at room temperature.

The next clean-up step uses Long Fragment Buffer (LFB) or Short Fragment Buffer (SFB) rather than 80% ethanol to wash the beads. The use of ethanol will be detrimental to the sequencing reaction.

Resuspend the AMPure XP Beads (AXP) by vortexing.

Add 20 µl of resuspended AMPure XP Beads (AXP) to the reaction and mix by pipetting.

Incubate on a Hula mixer (rotator mixer) for 10 minutes at room temperature.

Spin down the sample and pellet on the magnetic rack. Keep the tube on the magnet and pipette off the supernatant.

Wash the beads by adding either 125 μl Long Fragment Buffer (LFB) or Short Fragment Buffer (SFB). Flick the beads to resuspend, spin down, then return the tube to the magnetic rack and allow the beads to pellet. Remove the supernatant using a pipette and discard.

Repeat the previous step.

Spin down and place the tube back on the magnet. Pipette off any residual supernatant.

Remove the tube from the magnetic rack and resuspend pellet in 7 µl Elution Buffer (EB).

Spin down and incubate for 10 minutes at 37°C. Every 2 minutes, agitate the sample by gently flicking for 10 seconds to encourage DNA elution.

Pellet the beads on a magnet until the eluate is clear and colourless, for at least 1 minute.

Remove and retain 7 µl of eluate containing the DNA library into a clean 1.5 ml Eppendorf DNA LoBind tube.

Dispose of the pelleted beads.

Quantify 1 µl of eluted sample using a Qubit fluorometer.

Prepare your final library to 5-10 fmol in 5 µl of Elution Buffer (EB).

If required, we recommend using a mass to mol calculator such as the NEB calculator.

We recommend loading 5-10 fmol of this final prepared library onto the R10.4.1 flow cell.

Following standard input recommendations, the protocol should produce enough final library (adapter DNA in EB) to load at least two Flongle flow cells. We recommend reserving enough library to load onto a second flow cell. Loading more than 10 fmol can have a detrimental effect on output. Dilute the library in EB or nuclease-free water to a final volume of 5 μl.

The prepared library is used for loading onto the flow cell. Store the library on ice or at 4°C until ready to load.

Library storage recommendations

We recommend storing libraries in Eppendorf DNA LoBind tubes at 4°C for short-term storage or repeated use, for example, re-loading flow cells between washes. For single use and long-term storage of more than 3 months, we recommend storing libraries at -80°C in Eppendorf DNA LoBind tubes.

If quantities allow, the library may be diluted in Elution Buffer (EB) for splitting across multiple flow cells.

Depending on how many flow cells the library will be split across, more Elution Buffer (EB) than what is supplied in the kit will be required.

6. Flongle Flow Cell loading

Materials
  • Flongle Sequencing Expansion (EXP-FSE002)
  • Flow Cell Tether (FCT)
Consumables
  • Flongle Flow Cell
  • 1.5 ml Eppendorf DNA LoBind tubes
Equipment
  • Flongle adapter
  • MinION or GridION device
  • P200 pipette and tips
  • P20 pipette and tips
  • P10 pipette and tips

Please note, this kit is only compatible with R10.4.1 flow cells (FLO-FLG114).

Flongle Sequencing Expansion (EXP-FSE002)

To load a library onto your Flongle Flow Cell, you will need to use the following:

Flongle Sequencing Expansion (EXP-FSE002) components

  • Sequencing Buffer (SB)
  • Flow Cell Flush (FCF)
  • Library Beads (LIB) or Library Solution (LIS)

Sequencing Kit components

  • Flow Cell Tether (FCT)

Oxford Nanopore Technologies deem the useful life of the Flow Cell Expansion to be 6 months from receipt by the customer.

Do NOT touch the reverse side of the Flongle flow cell array or the contact pads on the Flongle adapter. ALWAYS wear gloves when handling Flongle flow cells and adapters to avoid damage to the flow cell or adapter.

Flongle flow cell contacts

The diagram below shows the components of the Flongle flow cell:

Named items of the flongle A0 v2.0

The seal tab, air vent, waste channel, drain port and sample port are visible here. The sample port, drain port and air vent only become accessible once the seal tab is peeled back.

Thaw the Sequencing Buffer (SB), Library Beads (LIB) or Library Solution (LIS, if using), Flow Cell Tether (FCT) and Flow Cell Flush (FCF) at room temperature before mixing by vortexing. Then spin down and store on ice.

In a fresh 1.5 ml Eppendorf DNA LoBind tube, mix 117 µl of Flow Cell Flush (FCF) with 3 µl of Flow Cell Tether (FCT) and mix by pipetting.

Place the Flongle adapter into the MinION or one of the five GridION positions.

The adapter should sit evenly and flat on the MinION Mk1B or GridION platform. This ensures the flow cell assembly is flat during the next stage.

The adapter needs to be plugged into your device, and the device should be plugged in and powered on before inserting the Flongle flow cell.

Flow cell adapter insertion

Place the flow cell into the Flongle adapter, and press the flow cell down until you hear a click.

The flow cell should sit evenly and flat inside the adapter, to avoid any bubbles forming inside the fluidic compartments.

Flow cell insertion

How to prime and load a Flongle Flow Cell

A short video describing how to prime and load a Flongle Flow Cell.

Peel back the seal tab from the Flongle flow cell, up to a point where the sample port is exposed, as follows:

  1. Lift up the seal tab: Peel back tab 1


  2. Pull the seal tab to open access to the sample port: Peel back tab 2


  3. Hold the seal tab open by using adhesive on the tab to stick to the MinION Mk 1B lid: Peel back tab 3

To prime your flow cell with the mix of Flow Cell Flush (FCF) and Flow Cell Tether (FCT) that was prepared earlier, ensure that there is no air gap in the sample port or the pipette tip. Place the P200 pipette tip inside the sample port and slowly dispense the 120 µl of priming fluid into the Flongle flow cell by slowly pipetting down. We also recommend twisting the pipette plunger down to avoid flushing the flow cell too vigorously.

Air gap

The Library Beads (LIB) tube contains a suspension of beads. These beads settle very quickly. It is vital that they are mixed immediately before use.

We recommend using the Library Beads (LIB) for most sequencing experiments. However, the Library Solution (LIS) is available for more viscous libraries.

Vortex the vial of Library Beads (LIB). Note that the beads settle quickly, so immediately prepare the Sequencing Mix in a fresh 1.5 ml Eppendorf DNA LoBind tube for loading the Flongle, as follows:

Reagents Volume
Sequencing Buffer (SB) 15 µl
Library Beads (LIB) mixed immediately before use, or Library Solution (LIS), if using. 10 µl
DNA library 5 µl
Total 30 µl

To add the Sequencing Mix to the flow cell, ensure that there is no air gap in the sample port or the pipette tip. Place the P200 tip inside the sample port and slowly dispense the Sequencing Mix into the flow cell by slowly pipetting down. We also recommend twisting the pipette plunger down to avoid flushing the flow cell too vigorously.

Air gap

Seal the Flongle flow cell using the adhesive on the seal tab, as follows:

  1. Stick the transparent adhesive tape to the sample port. Re-sealing flow cell 1


  2. Replace the top (Wheel icon section) of the seal tab to its original position. Re-sealing flow cell 4

Close the device lid and set up a sequencing run on MinKNOW.

When a flow cell is inserted into the MinION Mk1D, the device lid will sit on top of the flow cell, leaving a small gap around the sides. This is normal and has no impact on the performance of the device.

Please refer to this FAQ regarding the device lid.

MinION Mk1D with flow cell

7. Data acquisition and basecalling

How to start sequencing

Once you have loaded your flow cell, the sequencing run can be started on MinKNOW, our sequencing software that controls the device, data acquisition and real-time basecalling. For more detailed information on setting up and using MinKNOW, please see the MinKNOW protocol.

MinKNOW can be used and set up to sequence in multiple ways:

  • On a computer either directly or remotely connected to a sequencing device.
  • Directly on a GridION sequencing device.

For more information on using MinKNOW on a sequencing device, please see the device user manuals:

To start a sequencing run on MinKNOW:

1. Navigate to the start page and click Start sequencing.

2. Fill in your experiment details, such as name and flow cell position and sample ID.

3. Select the Native Barcoding Kit 24 V14 (SQK-NBD114.24) on the Kit page.

4. Configure the sequencing and output parameters for your sequencing run or keep to the default settings on the Run configuration tab.

Note: If basecalling was turned off when a sequencing run was set up, basecalling can be performed post-run on MinKNOW. For more information, please see the MinKNOW protocol.

5. Click Start to initiate the sequencing run.

Data analysis after sequencing

After sequencing has completed on MinKNOW, the flow cell can be reused or returned, as outlined in the Flow cell reuse and returns section.

After sequencing and basecalling, the data can be analysed. For further information about options for basecalling and post-basecalling analysis, please refer to the Data Analysis document.

In the Downstream analysis section, we outline further options for analysing your data.

8. Downstream analysis

Post-basecalling analysis

There are several options for further analysing your basecalled data:

8.1. EPI2ME workflows

For in-depth data analysis, Oxford Nanopore Technologies offers a range of bioinformatics tutorials and workflows available in EPI2ME, which are available in the EPI2ME section of the Community. The platform provides a vehicle where workflows deposited in GitHub by our Research and Applications teams can be showcased with descriptive texts, functional bioinformatics code and example data.

8.2. Research analysis tools

Oxford Nanopore Technologies' Research division has created a number of analysis tools, that are available in the Oxford Nanopore GitHub repository. The tools are aimed at advanced users, and contain instructions for how to install and run the software. They are provided as-is, with minimal support.

8.3. Community-developed analysis tools

If a data analysis method for your research question is not provided in any of the resources above, please refer to the resource centre and search for bioinformatics tools for your application. Numerous members of the Nanopore Community have developed their own tools and pipelines for analysing nanopore sequencing data, most of which are available on GitHub. Please be aware that these tools are not supported by Oxford Nanopore Technologies, and are not guaranteed to be compatible with the latest chemistry/software configuration.

9. Issues during DNA/RNA extraction and library preparation for Kit 14

Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

We also have an FAQ section available on the Nanopore Community Support section.

If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

Low sample quality

Observation Possible cause Comments and actions
Low DNA purity (Nanodrop reading for DNA OD 260/280 is <1.8 and OD 260/230 is <2.0–2.2) The DNA extraction method does not provide the required purity The effects of contaminants are shown in the Contaminants document. Please try an alternative extraction method that does not result in contaminant carryover.

Consider performing an additional SPRI clean-up step.
Low RNA integrity (RNA integrity number <9.5 RIN, or the rRNA band is shown as a smear on the gel) The RNA degraded during extraction Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page.
RNA has a shorter than expected fragment length The RNA degraded during extraction Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page.

We recommend working in an RNase-free environment, and to keep your lab equipment RNase-free when working with RNA.

Low DNA recovery after AMPure bead clean-up

Observation Possible cause Comments and actions
Low recovery DNA loss due to a lower than intended AMPure beads-to-sample ratio 1. AMPure beads settle quickly, so ensure they are well resuspended before adding them to the sample.

2. When the AMPure beads-to-sample ratio is lower than 0.4:1, DNA fragments of any size will be lost during the clean-up.
Low recovery DNA fragments are shorter than expected The lower the AMPure beads-to-sample ratio, the more stringent the selection against short fragments. Please always determine the input DNA length on an agarose gel (or other gel electrophoresis methods) and then calculate the appropriate amount of AMPure beads to use. SPRI cleanup
Low recovery after end-prep The wash step used ethanol <70% DNA will be eluted from the beads when using ethanol <70%. Make sure to use the correct percentage.

10. Issues during the sequencing run for Kit 14

Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

We also have an FAQ section available on the Nanopore Community Support section.

If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

Fewer pores at the start of sequencing than after Flow Cell Check

Observation Possible cause Comments and actions
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check An air bubble was introduced into the nanopore array After the Flow Cell Check it is essential to remove any air bubbles near the priming port before priming the flow cell. If not removed, the air bubble can travel to the nanopore array and irreversibly damage the nanopores that have been exposed to air. The best practice to prevent this from happening is demonstrated in this video.
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check The flow cell is not correctly inserted into the device Stop the sequencing run, remove the flow cell from the sequencing device and insert it again, checking that the flow cell is firmly seated in the device and that it has reached the target temperature. If applicable, try a different position on the device (GridION/PromethION).
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check Contaminations in the library damaged or blocked the pores The pore count during the Flow Cell Check is performed using the QC DNA molecules present in the flow cell storage buffer. At the start of sequencing, the library itself is used to estimate the number of active pores. Because of this, variability of about 10% in the number of pores is expected. A significantly lower pore count reported at the start of sequencing can be due to contaminants in the library that have damaged the membranes or blocked the pores. Alternative DNA/RNA extraction or purification methods may be needed to improve the purity of the input material. The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

MinKNOW script failed

Observation Possible cause Comments and actions
MinKNOW shows "Script failed"
Restart the computer and then restart MinKNOW. If the issue persists, please collect the MinKNOW log files and contact Technical Support. If you do not have another sequencing device available, we recommend storing the flow cell and the loaded library at 4°C and contact Technical Support for further storage guidance.

Pore occupancy below 40%

Observation Possible cause Comments and actions
Pore occupancy <40% Not enough library was loaded on the flow cell 10–20 fmol of good quality library can be loaded on to a MinION/GridION flow cell. Please quantify the library before loading and calculate mols using tools like the Promega Biomath Calculator, choosing "dsDNA: µg to pmol"
Pore occupancy close to 0 The Native Barcoding Kit was used, and ethanol was used instead of LFB or SFB at the wash step after sequencing adapter ligation Ethanol can denature the motor protein on the sequencing adapters. Make sure the LFB or SFB buffer was used after ligation of sequencing adapters.
Pore occupancy close to 0 No tether on the flow cell Tethers are adding during flow cell priming (FCT tube). Make sure FCT was added to FCF before priming.

Shorter than expected read length

Observation Possible cause Comments and actions
Shorter than expected read length Unwanted fragmentation of DNA sample Read length reflects input DNA fragment length. Input DNA can be fragmented during extraction and library prep.

1. Please review the Extraction Methods in the Nanopore Community for best practice for extraction.

2. Visualise the input DNA fragment length distribution on an agarose gel before proceeding to the library prep. DNA gel2 In the image above, Sample 1 is of high molecular weight, whereas Sample 2 has been fragmented.

3. During library prep, avoid pipetting and vortexing when mixing reagents. Flicking or inverting the tube is sufficient.

Large proportion of unavailable pores

Observation Possible cause Comments and actions
Large proportion of unavailable pores (shown as blue in the channels panel and pore activity plot)

image2022-3-25 10-43-25 The pore activity plot above shows an increasing proportion of "unavailable" pores over time.		 Contaminants are present in the sample Some contaminants can be cleared from the pores by the unblocking function built into MinKNOW. If this is successful, the pore status will change to "sequencing pore". If the portion of unavailable pores stays large or increases:

1. A nuclease flush using the Flow Cell Wash Kit (EXP-WSH004) can be performed, or
2. Run several cycles of PCR to try and dilute any contaminants that may be causing problems.

Large proportion of inactive pores

Observation Possible cause Comments and actions
Large proportion of inactive/unavailable pores (shown as light blue in the channels panel and pore activity plot. Pores or membranes are irreversibly damaged) Air bubbles have been introduced into the flow cell Air bubbles introduced through flow cell priming and library loading can irreversibly damage the pores. Watch the Priming and loading your flow cell video for best practice
Large proportion of inactive/unavailable pores Certain compounds co-purified with DNA Known compounds, include polysaccharides, typically associate with plant genomic DNA.

1. Please refer to the Plant leaf DNA extraction method.
2. Clean-up using the QIAGEN PowerClean Pro kit.
3. Perform a whole genome amplification with the original gDNA sample using the QIAGEN REPLI-g kit.
Large proportion of inactive/unavailable pores Contaminants are present in the sample The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

Reduction in sequencing speed and q-score later into the run

Observation Possible cause Comments and actions
Reduction in sequencing speed and q-score later into the run Fast fuel consumption is typically seen in Kit 9 chemistry (e.g. SQK-LSK109) when the flow cell is overloaded with library. Please see the appropriate protocol for your DNA library to find the recommendation. Add more fuel to the flow cell by following the instructions in the MinKNOW protocol. In future experiments, load lower amounts of library to the flow cell.

Temperature fluctuation

Observation Possible cause Comments and actions
Temperature fluctuation The flow cell has lost contact with the device Check that there is a heat pad covering the metal plate on the back of the flow cell. Re-insert the flow cell and press it down to make sure the connector pins are firmly in contact with the device. If the problem persists, please contact Technical Services.

Failed to reach target temperature

Observation Possible cause Comments and actions
MinKNOW shows "Failed to reach target temperature" The instrument was placed in a location that is colder than normal room temperature, or a location with poor ventilation (which leads to the flow cells overheating) MinKNOW has a default timeframe for the flow cell to reach the target temperature. Once the timeframe is exceeded, an error message will appear and the sequencing experiment will continue. However, sequencing at an incorrect temperature may lead to a decrease in throughput and lower q-scores. Please adjust the location of the sequencing device to ensure that it is placed at room temperature with good ventilation, then re-start the process in MinKNOW. Please refer to this link for more information on MinION temperature control.

Last updated: 7/2/2025

Document options

Flongle
Language: