Direct-from-colony microbial sequencing: rapid Salmonella serotyping (SQK-RPB114.24)

Oxford Nanopore Technologies
Document type icon

Protocol

Direct-from-colony microbial sequencing: rapid Salmonella serotyping (SQK-RPB114.24) VDCM_9210_V114_revA_04Sep2024

This protocol:

  • is a rapid method to perform sequencing and analysis of Salmonella.
  • uses Salmonella colonies from overnight cultures.
  • includes tagmentation, barcoding and PCR amplification.
  • enables multiplexing of 1-24 samples.
  • is compatible with R10.4.1 flow cells.

For Research Use Only

This is an Early Access product For more information about our Early Access programmes, please see this article on product release phases.

FOR RESEARCH USE ONLY

概要

This protocol:

  • is a rapid method to perform sequencing and analysis of Salmonella.
  • uses Salmonella colonies from overnight cultures.
  • includes tagmentation, barcoding and PCR amplification.
  • enables multiplexing of 1-24 samples.
  • is compatible with R10.4.1 flow cells.

For Research Use Only

This is an Early Access product For more information about our Early Access programmes, please see this article on product release phases.

Document version: DCM_9210_V114_revA_04Sep2024

1. Overview of the protocol

重要

This is an Early Access product

For more information about our Early Access programmes, please see this article on product release phases.

Please ensure you always use the most recent version of the protocol.

Introduction to the direct-from-colony microbial sequencing: rapid Salmonella serotyping protocol

This protocol describes a method for preparing, sequencing and analysis of up to 24 Salmonella colonies using the Rapid RCR Barcoding Kit V14 (SQK-RPB114.24).

This simple end-to-end solution allows you to generate whole genome sequencing data directly from a single Salmonella colony, eliminating the need for subculture into liquid broth, DNA extraction or complex library preparation methods, thereby offering faster tun-around times.

Combined with our custom wf-bacterial-genomes analysis pipeline using EPI2ME, this method provides an organism species ID, serotype, multi locus sequence type (MLST) and antibiotic resistance (AMR) profile information.

This method is designed to provide non-circular genomes for research and routine lab operations, including food safety testing purposes.

For more information and additional options for this end-to-end workflow please visit our know-how document.

Salmonella serotyping RPB114 workflow

Steps in the end-to-end workflow:

Prepare for your experiment

You will need to:

  • Streak your sample onto a freshly prepared agar plate appropriately such that single Salmonella colonies can be isolated (overnight). We recommend the use of TSA plates for culturing Salmonella.

The quality checks performed during the protocol are essential in ensuring experimental success.

  • Ensure you have your sequencing kit, the correct equipment and third-party reagents
  • Download the software for acquiring and analysing your data
  • Check your flow cell to ensure it has enough pores for a good sequencing run

#### Library preparation The table below is an overview of the steps required in the library preparation, including timings and optional stopping points.
Step Process Time Stop option
Colony growth Grow Salmonella single colony culture(s) of ~2-3 mm overnight on an agar plate. ~16-18 hours
Sample preparation Resuspend each single colony in Tris Buffer. 5 minutes
DNA tagmentation Tagment your DNA using the Fragmentation Mix from the sequencing kit 10 minutes
PCR amplification PCR your sample using the barcoded primer supplied in the sequencing kit 180 minutes
Sample pooling and cleanup Pool your barcoded PCR samples in equal ratios and perform a clean-up 30 minutes 4°C overnight
Adapter ligation and clean-up Attach the sequencing adapters to the DNA ends 5 minutes We strongly recommend sequencing your library as soon as it is adapted.
Priming and loading the flow cell Prime the flow cell and load the prepared library for sequencing 5 minutes

Sequencing and analysis

You will need to:

  • Start a sequencing run using the MinKNOW software, which will collect raw data from the device and convert it into basecalled reads
  • Start the EPI2ME software and select the wf-bacterial-genomes workflow
重要

Compatibility of this protocol

This protocol should only be used in combination with:

2. Equipment and consumables

材料
  • Up to 24x single Salmonella colonies (2–3 mm in diameter)
  • Rapid PCR Barcoding Kit 24 V14 (SQK-RPB114.24)
消耗品
  • MinION and GridION Flow Cell
  • 1 M Tris Buffer, pH8 (e.g. Invitrogen™, AM9855G)
  • LongAmp Hot Start Taq 2X Master Mix (NEB, M0533)
  • Nuclease-free water (e.g. ThermoFisher, AM9937)
  • Freshly prepared 80% ethanol in nuclease-free water
  • Bovine Serum Albumin (BSA) (50 mg/ml) (e.g Invitrogen™ UltraPure™ BSA 50 mg/ml, AM2616)
  • Qubit dsDNA HS Assay Kit (Invitrogen, Q32851)
  • Qubit™ Assay Tubes (Invitrogen, Q32856)
  • 1.5 ml Eppendorf DNA LoBind tubes
  • 0.2 ml thin-walled PCR tubes
装置
  • MinION or GridION device
  • MinION and GridION Flow Cell Light Shield
  • Inoculation loop or equivalent for picking your colony
  • Ice bucket with ice
  • Microfuge
  • Timer
  • Thermal cycler
  • Magnetic rack
  • Hula mixer (gentle rotator mixer)
  • P1000 pipette and tips
  • P200 pipette and tips
  • P100 pipette and tips
  • P20 pipette and tips
  • P2 pipette and tips
  • Multichannel pipette and tips
  • Qubit fluorometer (or equivalent for QC check)
オプション装置
  • Agilent Bioanalyzer (or equivalent)

For this protocol, you will need a single colony of Salmonella 2–3 mm in diameter for each input.

Streak your sample onto a freshly prepared agar plate appropriately such that single Salmonella colonies can be isolated (overnight). We recommend the use of TSA plates for culturing Salmonella.

Optional: Alternatively, you can use 3-5 ng in 3 μl volume per sample of isolated DNA as input for library preparation.

Input DNA

How to QC your input DNA

It is important that the input DNA meets the quantity and quality requirements. Using too little or too much DNA, or DNA of poor quality (e.g. highly fragmented or containing RNA or chemical contaminants) can affect your library preparation.

For instructions on how to perform quality control of your DNA sample, please read the Input DNA/RNA QC protocol.

Chemical contaminants

Depending on how the DNA is extracted from the raw sample, certain chemical contaminants may remain in the purified DNA, which can affect library preparation efficiency and sequencing quality. Read more about contaminants on the Contaminants page of the Community.

Third-party reagents

We have validated and recommend the use of all the third-party reagents used in this protocol. Alternatives have not been tested by Oxford Nanopore Technologies.

For all third-party reagents, we recommend following the manufacturer's instructions to prepare the reagents for use.

Check your flow cell

We highly recommend that you check the number of pores in your flow cell prior to starting a sequencing experiment. This should be done within three months of purchasing for MinION/GridION/PromethION or within four weeks of purchasing Flongle Flow Cells. Oxford Nanopore Technologies will replace any flow cell with fewer than the number of pores in the table below, when the result is reported within two days of performing the flow cell check, and when the storage recommendations have been followed. To do the flow cell check, please follow the instructions in the Flow Cell Check document.

Flow cell Minimum number of active pores covered by warranty
Flongle Flow Cell 50
MinION/GridION Flow Cell 800
PromethION Flow Cell 5000
重要

The Rapid Adapter (RA) used in this kit and protocol is not interchangeable with other sequencing adapters.

Rapid PCR Barcoding Kit 24 V14 (SQK-RPB114.24) contents

sqk-rpb114.24 tubes

Name Acronym Cap colour No. of vials Fill volume per vial (µl)
Fragmentation Mix FRM Brown 1 160
Rapid Adapter RA Green 1 15
Adapter Buffer ADB Clear 1 100
AMPure XP Beads AXP Amber 3 1,200
Elution Buffer EB Black 2 500
EDTA EDTA Blue 1 700
Sequencing Buffer SB Red 1 700
Library Beads LIB Pink 1 600
Library Solution LS White cap, pink label 1 600
Flow Cell Flush FCF Clear 1 8,000
Flow Cell Tether FCT Purple 1 200
Rapid Barcode Primer 01-24 RLB01-24 Clear 24 (one per barcode) 15

Note: This product contains AMPure XP Reagent manufactured by Beckman Coulter, Inc. and can be stored at -20°C with the kit without detriment to reagent stability.

Rapid barcode primers

Component Sequence
RLB01 AAGAAAGTTGTCGGTGTCTTTGTG
RLB02 TCGATTCCGTTTGTAGTCGTCTGT
RLB03 GAGTCTTGTGTCCCAGTTACCAGG
RLB04 TTCGGATTCTATCGTGTTTCCCTA
RLB05 CTTGTCCAGGGTTTGTGTAACCTT
RLB06 TTCTCGCAAAGGCAGAAAGTAGTC
RLB07 GTGTTACCGTGGGAATGAATCCTT
RLB08 TTCAGGGAACAAACCAAGTTACGT
RLB09 AACTAGGCACAGCGAGTCTTGGTT
RLB10 AAGCGTTGAAACCTTTGTCCTCTC
RLB11 GTTTCATCTATCGGAGGGAATGGA
RLB12 GTTGAGTTACAAAGCACCGATCAG
RLB13 AGAACGACTTCCATACTCGTGTGA
RLB14 AACGAGTCTCTTGGGACCCATAGA
RLB15 AGGTCTACCTCGCTAACACCACTG
RLB16 CGTCAACTGACAGTGGTTCGTACT
RLB17 ACCCTCCAGGAAAGTACCTCTGAT
RLB18 CCAAACCCAACAACCTAGATAGGC
RLB19 GTTCCTCGTGCAGTGTCAAGAGAT
RLB20 TTGCGTCCTGTTACGAGAACTCAT
RLB21 GAGCCTCTCATTGTCCGTTCTCTA
RLB22 ACCACTGCCATGTATCAAAGTACG
RLB23 CTTACTACCCAGTGAACCTCCTCG
RLB24 GCATAGTTCTGCATGATGGGTTAG

3. Library preparation

材料
  • Up to 24x single Salmonella colonies (2–3 mm in diameter)
  • Fragmentation Mix (FRM)
  • Rapid Barcode Primers (RLB01-24, at 10 µM)
  • EDTA (EDTA)
  • AMPure XP Beads (AXP)
  • Elution Buffer (EB)
  • Rapid Adapter (RA)
  • Adapter Buffer (ADB)
消耗品
  • 1 M Tris Buffer, pH8 (e.g. Invitrogen™, AM9855G)
  • LongAmp Hot Start Taq 2X Master Mix (NEB, M0533)
  • Nuclease-free water (e.g. ThermoFisher, AM9937)
  • Freshly prepared 80% ethanol in nuclease-free water
  • Qubit dsDNA HS Assay Kit (Invitrogen, Q32851)
  • Qubit™ Assay Tubes (Invitrogen, Q32856)
  • 1.5 ml Eppendorf DNA LoBind tubes
  • 0.2 ml thin-walled PCR tubes
装置
  • Inoculation loop or equivalent for picking your colony
  • Ice bucket with ice
  • Thermal cycler
  • Hula mixer (gentle rotator mixer)
  • Magnetic rack
  • Microfuge
  • P1000 pipette and tips
  • P200 pipette and tips
  • P100 pipette and tips
  • P20 pipette and tips
  • P10 pipette and tips
  • P2 pipette and tips

Thaw kit components at room temperature, spin down briefly using a microfuge and mix by pipetting as indicated by the table below:

Reagent 1. Thaw at room temperature 2. Briefly spin down 3. Mix well by pipetting or vortexing
Rapid Barcode Primers (RLB01-24) Not frozen ✓ Pipette
Fragmentation Mix (FRM) Not frozen ✓ Pipette
Rapid Adapter (RA) Not frozen ✓ Pipette
Adapter Buffer (ADB) ✓ ✓ Vortex or Pipette
AMPure XP Beads (AXP) ✓ ✓ Mix by pipetting or vortexing immediately before use
Elution Buffer (EB) ✓ ✓ Vortex or Pipette
EDTA (EDTA) ✓ ✓ Vortex or Pipette

Note: Once thawed, keep all kit components on ice.

重要

When picking a single colony, please ensure that no media is carried through as this can negatively impact the PCR yields.

Prepare each cultured cell colony as follows:

  • For each colony/sample, add 50 µl 10 mM tris buffer (pH 8) to a 1.5 ml Eppendorf DNA LoBind tube.
  • Using an inoculation loop, transfer a single 2–3 mm colony from an overnight culture into a separate tube (from the step above).
  • Resuspend each colony thoroughly by pipette mixing and briefly vortexing.
  • Enusre your cell colony suspension is homogenous before proceeding.

In a separate 0.2 ml thin-walled PCR tube for each sample, mix the following:

Reagent Volume
DNA/colony suspension (from previous step) 3 μl
Fragmentation Mix (FRM) 1 μl
Total 4 μl

Mix thoroughly by pipetting the reaction.

In a thermal cycler, incubate the tube at 30°C for 2 minutes, then at 80°C for 2 minutes.

For each sample, set up a PCR reaction as follows in the 0.2 ml thin-walled PCR tube containing the tagmented DNA:

Reagent Volume
Tagmented DNA (from previous step) 4 µl
Nuclease-free water 20 µl
RLB (01-24, at 10 µM) 1 µl
LongAmp Hot Start Taq 2X Master Mix 25 µl
Total 50 µl

If the amount of input material is altered, the number of PCR cycles may need to be adjusted to produce the same yield.

Mix gently by flicking the tube, and spin down.

Amplify using the following cycling conditions:

Cycle step Temperature Time No. of cycles
Initial denaturation 95°C 3 mins 1
Denaturation

Annealing

Extension		 95°C

56°C

65°C		 15 sec

15 sec

6 min

25*
Final extension 65°C 6 min 1
Hold 4°C ∞

For more information on the PCR cycle number and externsion times please visit our know-how document.

Quantify 1 µl of each barcoded sample using a Qubit fluorometer (or equivalent) for QC check.

Note: The expected PCR yield for each sample is 15–45 ng/µl.

Pool 100 ng of each PCR barcoded samples in a clean 1.5 ml Eppendorf DNA LoBind tube.

Note: Please ensure you have quantified your samples prior to this step and take forward 100 ng of each of the samples for optimal barcode balancing.
Samples may vary in concentration following the barcoded PCR, therefore the volume of each barcoded sample added to the pool will be different.

Make up the volume of pooled samples to the nearest 100 µl using nuclease free water.

For example:

  • if the 100 ng pool of each sample results in a total of 88 µl, add 12 µl of nuclease-free water to make up the volume to 100 µl.
  • if the 100 ng pool of each sample results in a total of 180 µl, add 20 µl of nuclease-free water to make up the volume to 200 µl.

Resuspend the AMPure XP Beads (AXP) by vortexing.

To the pool of barcoded samples, add a 0.6X volume ratio of resuspended AMPure XP Beads (AXP) and mix by pipetting:

Volume of barcoded sample pool 100 μl 200 μl 300 μl
Volume of AMPure XP Beads (AXP) 60 μl 120 μl 180 μl

Incubate the reaction on a hula mixer (rotator mixer) for 10 minutes at room temperature.

Prepare 2 ml of fresh 80% ethanol in nuclease-free water.

Briefly spin down the sample and pellet on a magnetic rack until supernatant is clear and colourless. Keep the tube on the magnetic rack, and pipette off the supernatant.

Keep the tube on the magnet and wash the beads with 1 ml of freshly-prepared 80% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.

Repeat the previous step.

Spin down and place the tube back on the magnet. Pipette off any residual ethanol. Allow to dry for ~30 seconds, but do not dry the pellet to the point of cracking.

Remove the tube from the magnetic rack and resuspend the pellet by pipetting in 15 µl Elution Buffer (EB). Spin down and incubate for 5 minutes at room temperature.

Pellet the beads on a magnet until the eluate is clear and colourless, for at least 1 minute.

Remove and retain 15 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.

  • Remove and retain the eluate which contains the DNA library in a clean 1.5 ml Eppendorf DNA LoBind tube
  • Dispose of the pelleted beads
CHECKPOINT

Quantify 1 µl of eluted sample using a Qubit fluorometer.

Transfer 250 ng of your eluted samples into a clean 1.5 ml Eppendorf DNA LoBind tube. Make up the volume to 11 µl with Elution Buffer (EB).

Note: If your final yield is below 250 ng, take forward 11 µl of eluted sample for the maxium flow cell loading amount possible.

Please note, if you underload the flow cell you might need to sequence for longer than stated in this method to achieve the recommended number of reads (at least 50k reads per barcode).

In a fresh 1.5 ml Eppendorf DNA LoBind tube, dilute the Rapid Adapter (RA) as follows and pipette mix:

Reagent Volume
Rapid Adapter (RA) 1.5 μl
Adapter Buffer (ADB) 3.5 μl
Total 5 μl

Add 1 µl of the diluted Rapid Adapter (RA) to the barcoded DNA.

Mix gently by flicking the tube, and spin down.

Incubate the reaction for 5 minutes at room temperature.

最終ステップ

The prepared library is used for loading into the flow cell. Store the library on ice until ready to load.

4. Priming and loading the MinION and GridION Flow Cell

材料
  • Flow Cell Flush (FCF)
  • Flow Cell Tether (FCT)
  • Library Beads (LIB)
  • Sequencing Buffer (SB)
消耗品
  • MinION and GridION Flow Cell
  • Bovine Serum Albumin (BSA) (50 mg/ml) (e.g Invitrogen™ UltraPure™ BSA 50 mg/ml, AM2616)
  • 1.5 ml Eppendorf DNA LoBind tubes
装置
  • MinION or GridION device
  • MinION and GridION Flow Cell Light Shield
  • P1000 pipette and tips
  • P100 pipette and tips
  • P20 pipette and tips
  • P10 pipette and tips
重要

Please note, this kit is only compatible with R10.4.1 flow cells (FLO-MIN114).

ヒント

Priming and loading a flow cell

We recommend all new users watch the 'Priming and loading your flow cell' video before your first run.

Thaw the Sequencing Buffer (SB), Library Beads (LIB), Flow Cell Tether (FCT) and Flow Cell Flush (FCF) at room temperature before mixing by vortexing. Then spin down and store on ice.

重要

For optimal sequencing performance and improved output on MinION R10.4.1 flow cells (FLO-MIN114), we recommend adding Bovine Serum Albumin (BSA) to the flow cell priming mix at a final concentration of 0.2 mg/ml.

Note: We do not recommend using any other albumin type (e.g. recombinant human serum albumin).

To prepare the flow cell priming mix with BSA, combine the following reagents in a fresh 1.5 ml Eppendorf DNA LoBind tube. Mix by inverting the tube and pipette mix at room temperature:

Reagents Volume per flow cell
Flow Cell Flush (FCF) 1,170 µl
Bovine Serum Albumin (BSA) at 50 mg/ml 5 µl
Flow Cell Tether (FCT) 30 µl
Final total volume in tube 1,205 µl

Open the MinION or GridION device lid and slide the flow cell under the clip. Press down firmly on the flow cell to ensure correct thermal and electrical contact.

Flow Cell Loading Diagrams Step 1a

Flow Cell Loading Diagrams Step 1b

オプショナルステップ

Complete a flow cell check to assess the number of pores available before loading the library.

This step can be omitted if the flow cell has been checked previously.

See the flow cell check instructions in the MinKNOW protocol for more information.

Slide the flow cell priming port cover clockwise to open the priming port.

Flow Cell Loading Diagrams Step 2

重要

Take care when drawing back buffer from the flow cell. Do not remove more than 20-30 µl, and make sure that the array of pores are covered by buffer at all times. Introducing air bubbles into the array can irreversibly damage pores.

After opening the priming port, check for a small air bubble under the cover. Draw back a small volume to remove any bubbles:

  1. Set a P1000 pipette to 200 µl
  2. Insert the tip into the priming port
  3. Turn the wheel until the dial shows 220-230 µl, to draw back 20-30 µl, or until you can see a small volume of buffer entering the pipette tip
    __Note:__ Visually check that there is continuous buffer from the priming port across the sensor array.

Flow Cell Loading Diagrams Step 03 V5

Load 800 µl of the priming mix into the flow cell via the priming port, avoiding the introduction of air bubbles. Wait for five minutes. During this time, prepare the library for loading by following the steps below.

Flow Cell Loading Diagrams Step 04 V5

Thoroughly mix the contents of the Library Beads (LIB) by pipetting.

重要

The Library Beads (LIB) tube contains a suspension of beads. These beads settle very quickly. It is vital that they are mixed immediately before use.

We recommend using the Library Beads (LIB) for most sequencing experiments. However, the Library Solution (LIS) is available for more viscous libraries.

In a new 1.5 ml Eppendorf DNA LoBind tube, prepare the library for loading as follows:

Reagent Volume per flow cell
Sequencing Buffer (SB) 37.5 µl
Library Beads (LIB) mixed immediately before use 25.5 µl
DNA library 12 µl
Total 75 µl

Complete the flow cell priming:

  1. Gently lift the SpotON sample port cover to make the SpotON sample port accessible.
  2. Load 200 µl of the priming mix into the flow cell priming port (not the SpotON sample port), avoiding the introduction of air bubbles.

Flow Cell Loading Diagrams Step 5

Flow Cell Loading Diagrams Step 06 V5

Mix the prepared library gently by pipetting up and down just prior to loading.

Add 75 μl of the prepared library to the flow cell via the SpotON sample port in a dropwise fashion. Ensure each drop flows into the port before adding the next.

Flow Cell Loading Diagrams Step 07 V5

Gently replace the SpotON sample port cover, making sure the bung enters the SpotON port and close the priming port.

Step 8 update

Flow Cell Loading Diagrams Step 9

重要

Install the light shield on your flow cell as soon as library has been loaded for optimal sequencing output.

We recommend leaving the light shield on the flow cell when library is loaded, including during any washing and reloading steps. The shield can be removed when the library has been removed from the flow cell.

Place the light shield onto the flow cell, as follows:

  1. Carefully place the leading edge of the light shield against the clip. Note: Do not force the light shield underneath the clip.

  2. Gently lower the light shield onto the flow cell. The light shield should sit around the SpotON cover, covering the entire top section of the flow cell.

J2264 - Light shield animation Flow Cell FAW optimised

注意

The MinION Flow Cell Light Shield is not secured to the flow cell and careful handling is required after installation.

最終ステップ

Close the device lid and set up a sequencing run on MinKNOW.

5. Data acquisition and basecalling

How to start sequencing

The sequencing device control, data acquisition and real-time basecalling are carried out by the MinKNOW software. Please ensure MinKNOW is installed on your computer or device. Further instructions for setting up a sequencing run can be found in the MinKNOW protocol.

We recommend setting up a sequencing run on a MinION or GridION device using the basecalling and barcoding recommendations outlined below. All other parameters can be left to their default settings.

MinKNOW settings for Salmonella serotyping

For fastest turnaround time and easiest analysis, basecalling should be performed live during the sequencing run using the High Accuracy (HAC) basecaller.

Below are the recommendations for MinKNOW settings:

Positions

Flow cell position: [user defined]

Experiment name: [user defined]

Flow cell type: FLO-MIN114

Sample ID: [user defined]

Kit

Kit selection: Rapid PCR Barcoding Kit (SQK-RPB114.24)

Run configuration

Sequencing and analysis

Basecalling: On [default] Modified bases: Off Model: High-accuracy basecalling (HAC) [default]

Barcoding: On [default] Trim barcodes: Off [default] Barcode both ends: Off [default] Custom barcodes selection: Off [default]

Alignment: Off [default]

Adaptive sampling: Off [default]

Advanced options Active channel selection: On [default] Time between pore scans: 1.5 [default] Reserve pores: On [default]

Data targets

Sequencing time will vary according to the number of samples being sequenced. The aim is to generate 50k reads per sample/barcode.

Run limit: Set according to number of sampeles:

Number of samples/barcodes Recommended sequencing time
6 4 hours
12 8 hours
24 12 hours

Output

Output format .POD5: On [default] .FASTQ: On [default] .BAM: On

Filtering: On [default] Qscore: 9 [default] Minimum read length: 200 bp [default]

6. Downstream analysis

Post-basecalling analysis

We recommend performing downstream analysis using EPI2ME which facilitates bioinformatic analyses by allowing users to run Nextflow workflows in a desktop application. EPI2ME maintains a collection of bioinformatic workflows which are curated and actively maintained by experts in long-read sequence analysis.

Further information about the available EPI2ME workflows are available here, along with the Quick Start Guide to start your first bioinformatic workflow.

For the accurate and reliable assembly or alignment of you sample genomes, we recommend using the wf-bacterial-genomes workflow. At its core, the workflow is an efficient assembly pipeline which also polishes genomes using Medaka.

Whilst running the workflow using the default parameters will , using the ‘Isolates’ mode to produce high quality genome assemblies, perform additional analyses designed to increase genome quality and aid genome interrogation for common pathogens in the clinical and food safety fields. ‘Isolates’ analyses includes MLST(7-gene), species confirmation and AMR prediction in addition to sample-specific reports.

Note: You can also run this workflow through command line. However, we only recommend this option for experienced users. For more information, please visit the wf-bacterial-genomes page on GitHub and the know-how document.

重要

Please ensure your device meets the minimum compute requirements to run this workflow.

Compute requirements:

CPUs Memory
Minimum requirements: 8 32GB
Recommended requirements: 16 64GB

For more information visit the EPI2ME wf-bacterial-genomes documentation.

Open the EPI2ME app using the desktop shortcut.

On the landing page, open the workflow tab on the left-hand sidebar.

1 landing page EPI2ME

Navigate to the Available workflows tab and click on wf-bacterial-genomes option.

2 (1)

Click install.

3 (1)

Navigate to the Installed tab and click on the installed wf-bacterial-genomes workflow.

4 (1)

オプショナルステップ

If the workflow was already installed, check for updates by clicking 'Update workflow'.

Ensure you are using v1.3.0 or newer of the workflow. We recommend running the latest version of our workflows for the best results.

Update workflow no miss

Update workflow no miss II

Click on Run this workflow to open the launch wizard.

Run this workflow no miss

Set up your run by uploading your FASTQ file in the Input Options. We recommend keeping the default settings for the other parameter options.

6 (1)

In Sample Options, provide a sample sheet to match sample folder names (e.g. barcode01) to a sample name alias to be used in output reports.

You may specify any number of sample (barcode) folders in your sample sheet.

select-sample-options

To enable the isolates mode, tick the isolates checkbox.

7 (1)

In Advanced Options unselect Prokka annotation.

Optional setting: Set Flye genome size to 5000000, and Flye asm coverage to 50 (these settings are optional but will speed up run time).

select-advanced-options

オプショナルステップ

In Miscellaneous Options, set number of CPU threads.

Navigate to the 'Nextflow configuration' tab to assign a 'Run name' to your analysis as an identifier.

Workflow run name no miss

Click Launch workflow.

Ensure all parameter options have green ticks.

7 (2)

Once the workflow finishes, a report will be produced.

オプショナルステップ

Test data is available on Github to test the wf-bacterial-genomes workflow.

The test data can be found in the following repository: wf-bacterial-genomes test data

7. Flow cell reuse and returns

材料
  • Flow Cell Wash Kit (EXP-WSH004)

After your sequencing experiment is complete, if you would like to reuse the flow cell, please follow the Flow Cell Wash Kit protocol and store the washed flow cell at 2-8°C.

The Flow Cell Wash Kit protocol is available on the Nanopore Community.

ヒント

We recommend you to wash the flow cell as soon as possible after you stop the run. However, if this is not possible, leave the flow cell on the device and wash it the next day.

Alternatively, follow the returns procedure to flush out the flow cell ready to send back to Oxford Nanopore.

Instructions for returning flow cells can be found here.

Note: All flow cells must be flushed with deionised water before returning the product.

重要

If you encounter issues or have questions about your sequencing experiment, please refer to the Troubleshooting Guide that can be found in the online version of this protocol.

8. Issues during DNA/RNA extraction and library preparation

Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

We also have an FAQ section available on the Nanopore Community Support section.

If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

Low sample quality

Observation Possible cause Comments and actions
Low DNA purity (Nanodrop reading for DNA OD 260/280 is <1.8 and OD 260/230 is <2.0–2.2) The DNA extraction method does not provide the required purity The effects of contaminants are shown in the Contaminants document. Please try an alternative extraction method that does not result in contaminant carryover.

Consider performing an additional SPRI clean-up step.
Low RNA integrity (RNA integrity number <9.5 RIN, or the rRNA band is shown as a smear on the gel) The RNA degraded during extraction Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page.
RNA has a shorter than expected fragment length The RNA degraded during extraction Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page.

We recommend working in an RNase-free environment, and to keep your lab equipment RNase-free when working with RNA.

Low DNA recovery after AMPure bead clean-up

Observation Possible cause Comments and actions
Low recovery DNA loss due to a lower than intended AMPure beads-to-sample ratio 1. AMPure beads settle quickly, so ensure they are well resuspended before adding them to the sample.

2. When the AMPure beads-to-sample ratio is lower than 0.4:1, DNA fragments of any size will be lost during the clean-up.
Low recovery DNA fragments are shorter than expected The lower the AMPure beads-to-sample ratio, the more stringent the selection against short fragments. Please always determine the input DNA length on an agarose gel (or other gel electrophoresis methods) and then calculate the appropriate amount of AMPure beads to use. SPRI cleanup
Low recovery after end-prep The wash step used ethanol <80% DNA will be eluted from the beads when using ethanol <80%. Make sure to use the correct percentage.

9. Issues during the sequencing run using a Rapid-based sequencing kit

Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

We also have an FAQ section available on the Nanopore Community Support section.

If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

Fewer pores at the start of sequencing than after Flow Cell Check

Observation Possible cause Comments and actions
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check An air bubble was introduced into the nanopore array After the Flow Cell Check it is essential to remove any air bubbles near the priming port before priming the flow cell. If not removed, the air bubble can travel to the nanopore array and irreversibly damage the nanopores that have been exposed to air. The best practice to prevent this from happening is demonstrated in this video.
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check The flow cell is not correctly inserted into the device Stop the sequencing run, remove the flow cell from the sequencing device and insert it again, checking that the flow cell is firmly seated in the device and that it has reached the target temperature. If applicable, try a different position on the device (GridION/PromethION).
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check Contaminations in the library damaged or blocked the pores The pore count during the Flow Cell Check is performed using the QC DNA molecules present in the flow cell storage buffer. At the start of sequencing, the library itself is used to estimate the number of active pores. Because of this, variability of about 10% in the number of pores is expected. A significantly lower pore count reported at the start of sequencing can be due to contaminants in the library that have damaged the membranes or blocked the pores. Alternative DNA/RNA extraction or purification methods may be needed to improve the purity of the input material. The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

MinKNOW script failed

Observation Possible cause Comments and actions
MinKNOW shows "Script failed"
Restart the computer and then restart MinKNOW. If the issue persists, please collect the MinKNOW log files and contact Technical Support. If you do not have another sequencing device available, we recommend storing the flow cell and the loaded library at 4°C and contact Technical Support for further storage guidance.

Pore occupancy below 40%

Observation Possible cause Comments and actions
Pore occupancy <40% Not enough library was loaded on the flow cell 10–50 fmol of good quality library can be loaded on to a MinION Mk1B/GridION flow cell. Please quantify the library before loading and calculate mols using tools like the Promega Biomath Calculator, choosing "dsDNA: µg to pmol"
Pore occupancy close to 0 The Rapid PCR Barcoding Kit V14 was used, and sequencing adapters did not attach to the DNA Make sure to closely follow the protocol and use the correct volumes and incubation temperatures. A Lambda control library can be prepared to test the integrity of reagents.
Pore occupancy close to 0 No tether on the flow cell Tethers are added during flow cell priming (FCT tube). Make sure FCT was added to FCF before priming.

Shorter than expected read length

Observation Possible cause Comments and actions
Shorter than expected read length Unwanted fragmentation of DNA sample Read length reflects input DNA fragment length. Input DNA can be fragmented during extraction and library prep.

1. Please review the Extraction Methods in the Nanopore Community for best practice for extraction.

2. Visualise the input DNA fragment length distribution on an agarose gel before proceeding to the library prep. DNA gel2 In the image above, Sample 1 is of high molecular weight, whereas Sample 2 has been fragmented.

3. During library prep, avoid pipetting and vortexing when mixing reagents. Flicking or inverting the tube is sufficient.

Large proportion of unavailable pores

Observation Possible cause Comments and actions
Large proportion of unavailable pores (shown as blue in the channels panel and pore activity plot)

image2022-3-25 10-43-25 The pore activity plot above shows an increasing proportion of "unavailable" pores over time.		 Contaminants are present in the sample Some contaminants can be cleared from the pores by the unblocking function built into MinKNOW. If this is successful, the pore status will change to "sequencing pore". If the portion of unavailable pores stays large or increases:

1. A nuclease flush using the Flow Cell Wash Kit (EXP-WSH004) can be performed, or
2. Run several cycles of PCR to try and dilute any contaminants that may be causing problems.

Large proportion of inactive pores

Observation Possible cause Comments and actions
Large proportion of inactive/unavailable pores (shown as light blue in the channels panel and pore activity plot. Pores or membranes are irreversibly damaged) Air bubbles have been introduced into the flow cell Air bubbles introduced through flow cell priming and library loading can irreversibly damage the pores. Watch the Priming and loading your flow cell video for best practice
Large proportion of inactive/unavailable pores Certain compounds co-purified with DNA Known compounds, include polysaccharides, typically associate with plant genomic DNA.

1. Please refer to the Plant leaf DNA extraction method.
2. Clean-up using the QIAGEN PowerClean Pro kit.
3. Perform a whole genome amplification with the original gDNA sample using the QIAGEN REPLI-g kit.
Large proportion of inactive/unavailable pores Contaminants are present in the sample The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

Temperature fluctuation

Observation Possible cause Comments and actions
Temperature fluctuation The flow cell has lost contact with the device Check that there is a heat pad covering the metal plate on the back of the flow cell. Re-insert the flow cell and press it down to make sure the connector pins are firmly in contact with the device. If the problem persists, please contact Technical Services.

Failed to reach target temperature

Observation Possible cause Comments and actions
MinKNOW shows "Failed to reach target temperature" The instrument was placed in a location that is colder than normal room temperature, or a location with poor ventilation (which leads to the flow cells overheating) MinKNOW has a default timeframe for the flow cell to reach the target temperature. Once the timeframe is exceeded, an error message will appear and the sequencing experiment will continue. However, sequencing at an incorrect temperature may lead to a decrease in throughput and lower q-scores. Please adjust the location of the sequencing device to ensure that it is placed at room temperature with good ventilation, then re-start the process in MinKNOW. Please refer to this FAQ for more information on MinION Mk 1B temperature control.

Last updated: 9/4/2024

Document options

MinION