Rapid sequencing V14 - Plasmid sequencing (SQK-RBK114.24 or SQK-RBK114.96)
MinION: Protocol
Rapid sequencing V14 - Plasmid sequencing (SQK-RBK114.24 or SQK-RBK114.96) V PRB_9188_v114_revF_30Sept2024
- The fastest and simplest protocol to sequence plasmid DNA
- For multiplexing up to 96 samples
- Library preparation time ~60 minutes
- High yield
- Fragmentation
- Compatible with R10.4.1 flow cells
For Research Use Only
FOR RESEARCH USE ONLY
Contents
Introduction to the protocol
Library preparation
Sequencing and data analysis
Troubleshooting
Descripción general
- The fastest and simplest protocol to sequence plasmid DNA
- For multiplexing up to 96 samples
- Library preparation time ~60 minutes
- High yield
- Fragmentation
- Compatible with R10.4.1 flow cells
For Research Use Only
1. Overview of the protocol
Rapid Barcoding Kit features
This kit is recommended for users who:
- Wish to multiplex samples to reduce price per sample
- Need a PCR-free method of multiplexing to preserve additional information such as base modifications
- Require a short preparation time
- Have limited access to laboratory equipment
Introduction to plasmid sequencing using the Rapid Barcoding Kit 24 or 96 V14
This protocol describes how to carry out rapid barcoding of plasmid DNA using the Rapid Barcoding Kit 24 or 96 V14 (SQK-RBK114.24 or SQK-RBK114.96) to sequence up to 96 plasmid samples. This method can be utilised for routine verification of plasmid constructs in molecular biology research, quality control of plasmid DNA samples in biotechnology applications, and analysis of engineered plasmids for gene therapy development. During library preparation, the plasmid DNA is tagmented with the Rapid Barcodes before the samples are pooled and cleaned up. Rapid sequencing adapters are attached to the DNA ends before sequencing on a flow cell.
We recommend new users to sequence for 12 hours, although a shorter run-time may be sufficient. After sequencing, perform downstream analysis using the EPI2ME Labs Clone Validation (wf-clone-validation) workflow. A report is generated with a consensus sequence from each plasmid. Detailed instructions for setting up MinKNOW and the EPI2ME Labs workflow are included.
Steps in the sequencing workflow:
Prepare for your experiment
You will need to:
- Extract your DNA, and check its length, quantity and purity. The quality checks performed during the protocol are essential in ensuring experimental success.
- Ensure you have your sequencing kit, the correct equipment and third-party reagents.
- Download the software for acquiring and analysing your data.
- Check your flow cell to ensure it has enough pores for a good sequencing run.
Library preparation
You will need to:
- Tagment your DNA using the Rapid Barcodes; this simultaneously attaches a pair of barcodes to the fragments.
- Pool the barcoded samples.
- Attach the rapid sequencing adapters to the DNA ends.
- Prime the flow cell, and load your DNA library into the flow cell.
Sequencing and analysis
You will need to:
- Start a sequencing run using the MinKNOW software, which will collect raw data from the device into basecalled reads and will perform barcode demultiplexing.
- Start the EPI2ME software and use the Clone Validation workflow for analysis.
IMPORTANTE
Compatibility of this protocol
This protocol should only be used in combination with:
- Rapid Barcoding Kit 24 V14 (SQK-RBK114.24)
- Rapid Barcoding Kit 96 V14 (SQK-RBK114.96)
- R10.4.1 flow cells (FLO-MIN114)
- Flow Cell Wash Kit (EXP-WSH004)
- Flow Cell Priming Kit V14 (EXP-FLP004)
- Sequencing Auxiliary Vials V14 (EXP-AUX003)
- Rapid Adapter Auxiliary V14 (EXP-RAA114)
2. Equipment and consumables
Material
- 50 ng high molecular weight plasmid DNA per sample
- Rapid Barcoding Kit 24 V14 (SQK-RBK114.24) OR Rapid Barcoding Kit 96 V14 (SQK-RBK114.96)
Consumibles
- Tubos de 1,5 ml Eppendorf DNA LoBind
- 2 ml Eppendorf DNA LoBind tubes
- 0.2 ml thin-walled PCR tubes or 0.2 ml 96-well PCR plate
- Agua sin nucleasas (p. ej., ThermoFisher AM9937)
- Etanol al 80 % recién preparado con agua sin nucleasas
- (Opcional) Seroalbúmina bovina (BSA) (50 mg/ml) (p. ej., Invitrogen™ UltraPure™ BSA 50 mg/ml, AM2616)
- Tubos de ensayo Qubit™ (Invitrogen Q32856)
- Qubit dsDNA HS Assay Kit (Invitrogen Q32851) (kit de ensayo ADNbc alta sensibilidad)
Instrumental
- Dispositivo MinION o GridION
- Cubeta con hielo
- Microplate centrifuge, e.g. Fisherbrand™ Mini Plate Spinner Centrifuge (Fisher Scientific, 11766427)
- Temporizador
- Termociclador o termobloque
- Gradilla magnética
- Mezclador Hula (mezclador giratorio suave)
- Pipeta y puntas P1000
- Pipeta y puntas P200
- Pipeta y puntas P100
- Pipeta y puntas P20
- Pipeta y puntas P2
- Multichannel pipette and tips
- Fluorímetro Qubit (o equivalente para el control de calidad)
Equipo opcional
- Standard gel electrophoresis equipment
- Bioanalizador Agilent (o equivalente)
For this protocol, you will need 50 ng high molecular weight plasmid DNA per sample.
Cantidad de muestra inicial de ADN
Cómo realizar un control de calidad de la muestra inicial de ADN
Es importante que la muestra de ADN cumpla con los requisitos de cantidad y calidad. Usar demasiado ADN, poco o de mala calidad (p. ej., que esté muy fragmentado, que contenga ARN o contaminantes químicos), puede afectar a la preparación de la biblioteca.
Para realizar un control de calidad en la muestra de ADN, consulte el protocolo Input DNA/ RNA QC
Contaminantes químicos
Dependiendo de cómo se extraiga el ADN de la muestra cruda, ciertos contaminantes químicos pueden permanecer en el ADN purificado, lo cual afecta la eficacia de la preparación de la biblioteca y la calidad de la secuenciación. Encontrará más información sobre contaminantes en la página Contaminants de la comunidad Nanopore.
IMPORTANTE
The Rapid Adapter (RA) used in this kit and protocol is not interchangeable with other sequencing adapters.
Rapid Barcoding Kit 24 V14 (SQK-RBK114.24) contents
| Name | Acronym | Cap colour | No. of vials | Fill volume per vial (µl) |
|---|---|---|---|---|
| Rapid Adapter | RA | Green | 1 | 15 |
| Adapter Buffer | ADB | Clear | 1 | 100 |
| AMPure XP Beads | AXP | Amber | 2 | 1,200 |
| Elution Buffer | EB | Black | 1 | 500 |
| Sequencing Buffer | SB | Red | 1 | 700 |
| Library Beads | LIB | Pink | 1 | 600 |
| Library Solution | LIS | White cap, pink label | 1 | 600 |
| Flow Cell Flush | FCF | Blue | 6 | 1,170 |
| Flow Cell Tether | FCT | Purple | 1 | 200 |
| Rapid Barcodes | RB01-24 | Clear | 24 | 15 |
This Product Contains AMPure XP Reagent Manufactured by Beckman Coulter, Inc. and can be stored at -20°C with the kit without detriment to reagent stability.
Rapid Barcoding Kit 96 V14 (SQK-RBK114.96) contents
| Name | Acronym | Cap colour | No. of vials | Fill volume per vial (µl) |
|---|---|---|---|---|
| Rapid Adapter | RA | Green | 2 | 15 |
| Adapter Buffer | ADB | Clear | 1 | 100 |
| AMPure XP Beads | AXP | Amber | 3 | 1,200 |
| Elution Buffer | EB | Black | 1 | 1,500 |
| Sequencing Buffer | SB | Red | 1 | 1,700 |
| Library Beads | LIB | Pink | 1 | 1,800 |
| Library Solution | LIS | White cap, pink label | 1 | 1,800 |
| Flow Cell Flush | FCF | Clear | 1 | 15,500 |
| Flow Cell Tether | FCT | Purple | 2 | 200 |
| Rapid Barcodes | RB01-96 | - | 3 plates | 8 µl per well |
This Product Contains AMPure XP Reagent Manufactured by Beckman Coulter, Inc. and can be stored at -20°C with the kit without detriment to reagent stability.
To maximise the use of the Rapid Barcoding Kits, the Rapid Adapter Auxiliary V14 (EXP-RAA114) and the Sequencing Auxiliary Vials V14 (EXP-AUX003) expansion packs are available.
These expansions provide additional library preparation and flow cell priming reagents to allow users to utilise any unused barcodes for those running in smaller subsets.
Both expansion packs used together will provide enough reagents for 6 library preparations.
Rapid Adapter Auxiliary V14 (EXP-RAA114) contents:
| Name | Acronym | Cap colour | No. of vials | Fill volume per vial (μl) |
|---|---|---|---|---|
| Rapid Adapter | RA | 1 | Green | 15 |
| Adapter Buffer | ADB | 1 | Clear | 100 |
Sequencing Auxiliary Vials V14 (EXP-AUX003) contents:
| Name | Acronym | Cap colour | No. of vials | Fill volume per vial (μl) |
|---|---|---|---|---|
| Elution Buffer | EB | Black | 2 | 500 |
| Sequencing Buffer | SB | Red | 2 | 700 |
| Library Solution | LIS | White cap, pink label | 2 | 600 |
| Library Beads | LIB | Pink | 2 | 600 |
| Flow Cell Flush | FCF | Light blue label | 2 | 8,000 |
| Flow Cell Tether | FCT | Purple | 2 | 200 |
Rapid barcode sequences
| Component | Sequence |
|---|---|
| RB01 | AAGAAAGTTGTCGGTGTCTTTGTG |
| RB02 | TCGATTCCGTTTGTAGTCGTCTGT |
| RB03 | GAGTCTTGTGTCCCAGTTACCAGG |
| RB04 | TTCGGATTCTATCGTGTTTCCCTA |
| RB05 | CTTGTCCAGGGTTTGTGTAACCTT |
| RB06 | TTCTCGCAAAGGCAGAAAGTAGTC |
| RB07 | GTGTTACCGTGGGAATGAATCCTT |
| RB08 | TTCAGGGAACAAACCAAGTTACGT |
| RB09 | AACTAGGCACAGCGAGTCTTGGTT |
| RB10 | AAGCGTTGAAACCTTTGTCCTCTC |
| RB11 | GTTTCATCTATCGGAGGGAATGGA |
| RB12 | CAGGTAGAAAGAAGCAGAATCGGA |
| RB13 | AGAACGACTTCCATACTCGTGTGA |
| RB14 | AACGAGTCTCTTGGGACCCATAGA |
| RB15 | AGGTCTACCTCGCTAACACCACTG |
| RB16 | CGTCAACTGACAGTGGTTCGTACT |
| RB17 | ACCCTCCAGGAAAGTACCTCTGAT |
| RB18 | CCAAACCCAACAACCTAGATAGGC |
| RB19 | GTTCCTCGTGCAGTGTCAAGAGAT |
| RB20 | TTGCGTCCTGTTACGAGAACTCAT |
| RB21 | GAGCCTCTCATTGTCCGTTCTCTA |
| RB22 | ACCACTGCCATGTATCAAAGTACG |
| RB23 | CTTACTACCCAGTGAACCTCCTCG |
| RB24 | GCATAGTTCTGCATGATGGGTTAG |
| RB25 | GTAAGTTGGGTATGCAACGCAATG |
| RB26 | CATACAGCGACTACGCATTCTCAT |
| RB27 | CGACGGTTAGATTCACCTCTTACA |
| RB28 | TGAAACCTAAGAAGGCACCGTATC |
| RB29 | CTAGACACCTTGGGTTGACAGACC |
| RB30 | TCAGTGAGGATCTACTTCGACCCA |
| RB31 | TGCGTACAGCAATCAGTTACATTG |
| RB32 | CCAGTAGAAGTCCGACAACGTCAT |
| RB33 | CAGACTTGGTACGGTTGGGTAACT |
| RB34 | GGACGAAGAACTCAAGTCAAAGGC |
| RB35 | CTACTTACGAAGCTGAGGGACTGC |
| RB36 | ATGTCCCAGTTAGAGGAGGAAACA |
| RB37 | GCTTGCGATTGATGCTTAGTATCA |
| RB38 | ACCACAGGAGGACGATACAGAGAA |
| RB39 | CCACAGTGTCAACTAGAGCCTCTC |
| RB40 | TAGTTTGGATGACCAAGGATAGCC |
| RB41 | GGAGTTCGTCCAGAGAAGTACACG |
| RB42 | CTACGTGTAAGGCATACCTGCCAG |
| RB43 | CTTTCGTTGTTGACTCGACGGTAG |
| RB44 | AGTAGAAAGGGTTCCTTCCCACTC |
| RB45 | GATCCAACAGAGATGCCTTCAGTG |
| RB46 | GCTGTGTTCCACTTCATTCTCCTG |
| RB47 | GTGCAACTTTCCCACAGGTAGTTC |
| RB48 | CATCTGGAACGTGGTACACCTGTA |
| RB49 | ACTGGTGCAGCTTTGAACATCTAG |
| RB50 | ATGGACTTTGGTAACTTCCTGCGT |
| RB51 | GTTGAATGAGCCTACTGGGTCCTC |
| RB52 | TGAGAGACAAGATTGTTCGTGGAC |
| RB53 | AGATTCAGACCGTCTCATGCAAAG |
| RB54 | CAAGAGCTTTGACTAAGGAGCATG |
| RB55 | TGGAAGATGAGACCCTGATCTACG |
| RB56 | TCACTACTCAACAGGTGGCATGAA |
| RB57 | GCTAGGTCAATCTCCTTCGGAAGT |
| RB58 | CAGGTTACTCCTCCGTGAGTCTGA |
| RB59 | TCAATCAAGAAGGGAAAGCAAGGT |
| RB60 | CATGTTCAACCAAGGCTTCTATGG |
| RB61 | AGAGGGTACTATGTGCCTCAGCAC |
| RB62 | CACCCACACTTACTTCAGGACGTA |
| RB63 | TTCTGAAGTTCCTGGGTCTTGAAC |
| RB64 | GACAGACACCGTTCATCGACTTTC |
| RB65 | TTCTCAGTCTTCCTCCAGACAAGG |
| RB66 | CCGATCCTTGTGGCTTCTAACTTC |
| RB67 | GTTTGTCATACTCGTGTGCTCACC |
| RB68 | GAATCTAAGCAAACACGAAGGTGG |
| RB69 | TACAGTCCGAGCCTCATGTGATCT |
| RB70 | ACCGAGATCCTACGAATGGAGTGT |
| RB71 | CCTGGGAGCATCAGGTAGTAACAG |
| RB72 | TAGCTGACTGTCTTCCATACCGAC |
| RB73 | AAGAAACAGGATGACAGAACCCTC |
| RB74 | TACAAGCATCCCAACACTTCCACT |
| RB75 | GACCATTGTGATGAACCCTGTTGT |
| RB76 | ATGCTTGTTACATCAACCCTGGAC |
| RB77 | CGACCTGTTTCTCAGGGATACAAC |
| RB78 | AACAACCGAACCTTTGAATCAGAA |
| RB79 | TCTCGGAGATAGTTCTCACTGCTG |
| RB80 | CGGATGAACATAGGATAGCGATTC |
| RB81 | CCTCATCTTGTGAAGTTGTTTCGG |
| RB82 | ACGGTATGTCGAGTTCCAGGACTA |
| RB83 | TGGCTTGATCTAGGTAAGGTCGAA |
| RB84 | GTAGTGGACCTAGAACCTGTGCCA |
| RB85 | AACGGAGGAGTTAGTTGGATGATC |
| RB86 | AGGTGATCCCAACAAGCGTAAGTA |
| RB87 | TACATGCTCCTGTTGTTAGGGAGG |
| RB88 | TCTTCTACTACCGATCCGAAGCAG |
| RB89 | ACAGCATCAATGTTTGGCTAGTTG |
| RB90 | GATGTAGAGGGTACGGTTTGAGGC |
| RB91 | GGCTCCATAGGAACTCACGCTACT |
| RB92 | TTGTGAGTGGAAAGATACAGGACC |
| RB93 | AGTTTCCATCACTTCAGACTTGGG |
| RB94 | GATTGTCCTCAAACTGCCACCTAC |
| RB95 | CCTGTCTGGAAGAAGAATGGACTT |
| RB96 | CTGAACGGTCATAGAGTCCACCAT |
3. Computer requirements and software
MinION Mk1B IT requirements
Sequencing on a MinION Mk1B requires a high-spec computer or laptop to keep up with the rate of data acquisition. Read more in the MinION IT Requirements document.
Requisitos informáticos para el MinION Mk1C
El MinION Mk1C contiene ordenador y pantalla integrados, lo que elimina la dependencia de cualquier accesorio para generar y analizar datos de nanoporos. Encontrará más información en el documento MinION Mk1C IT Requirements.
Software for nanopore sequencing
MinKNOW
The MinKNOW software controls the nanopore sequencing device, collects sequencing data and basecalls in real time. You will be using MinKNOW for every sequencing experiment to sequence, basecall and demultiplex if your samples were barcoded.
For instructions on how to run the MinKNOW software, please refer to the MinKNOW protocol.
EPI2ME
The EPI2ME cloud-based platform performs further analysis of basecalled data, for example alignment to the Lambda genome, barcoding, or taxonomic classification. You will use the EPI2ME platform only if you would like further analysis of your data post-basecalling.
For instructions on how to create an EPI2ME account and install the EPI2ME Desktop Agent, please refer to the EPI2ME Platform protocol.
Check your flow cell
We highly recommend that you check the number of pores in your MinION Flow Cell prior to starting a sequencing experiment. This should be done within 12 weeks of purchasing the flow cells. Oxford Nanopore Technologies will replace any flow cell with fewer than the number of pores in the table below, when the result is reported within two days of performing the flow cell check, and when the storage recommendations have been followed. To do the flow cell check, please follow the instructions in the Flow Cell Check document.
The minimum number of active pores in a MinION Flow Cell that is covered by warranty is 800 pores.
4. Library preparation
Material
- 50 ng of high molecular weight plasmid DNA per sample
- Rapid Barcodes (RB01-24) or Rapid Barcode Plate (RB01-96)
- Rapid Adapter (RA)
- Adapter Buffer (ADB)
- AMPure XP Beads (AXP) (microesferas magnéticas)
- Elution Buffer (EB)
Consumibles
- 0.2 ml thin-walled PCR tubes or 0.2 ml 96-well PCR plate
- 1.5 ml Eppendorf DNA LoBind tubes
- 2 ml Eppendorf DNA LoBind tubes
- Agua sin nucleasas (p. ej., ThermoFisher AM9937)
- Etanol al 80 % recién preparado con agua sin nucleasas
- Tubos de ensayo Qubit™ (Invitrogen Q32856)
- Qubit dsDNA HS Assay Kit (Invitrogen Q32851) (kit de ensayo ADNbc alta sensibilidad)
Instrumental
- Cubeta con hielo
- Timer
- Termociclador
- Microplate centrifuge, e.g. Fisherbrand™ Mini Plate Spinner Centrifuge (Fisher Scientific, 11766427)
- Gradilla magnética
- Mezclador Hula (mezclador giratorio suave)
- P1000 pipette and tips
- Pipeta y puntas P200
- Pipeta y puntas P100
- Pipeta y puntas P20
- Pipeta y puntas P10
- Pipeta y puntas P2
- Multichannel pipette and tips
Program the thermal cycler: 30°C for 2 minutes, then 80°C for 2 minutes.
Thaw kit components at room temperature, spin down briefly using a microfuge and mix by pipetting as indicated by the table below:
| Reagent | 1. Thaw at room temperature | 2. Briefly spin down | 3. Mix well by pipetting |
|---|---|---|---|
| Rapid Barcodes (RB01-24) or Rapid Barcode Plate (RB01-96) | Not frozen | ✓ | ✓ |
| Rapid Adapter (RA) | Not frozen | ✓ | ✓ |
| AMPure XP Beads (AXP) | ✓ | ✓ | Mix by pipetting or vortexing immediately before use |
| Elution Buffer (EB) | ✓ | ✓ | ✓ |
| Adapter Buffer (ADB) | ✓ | ✓ | Mix by vortexing |
Prepare the DNA in nuclease-free water, as follows. Approximately 50 ng of plasmid DNA is required in 9 µl of volume for each sample for barcoding.
- Dilute your plasmid DNA samples with nuclease-free water to approximately 50 ng. See the table below for dilutions:
| Starting Conc. | Volume of DNA | Volume of nuclease-free water | Total volume |
|---|---|---|---|
| 100 ng/µl | 2 µl | 34 µl | 36 µl |
| 90 ng/µl | 2 µl | 31 µl | 33 µl |
| 80 ng/µl | 2 µl | 27 µl | 29 µl |
| 70 ng/µl | 3 µl | 35 µl | 38 µl |
| 60 ng/µl | 2 µl | 20 µl | 22 µl |
| 50 ng/µl | 2 µl | 16 µl | 18 µl |
| 40 ng/µl | 5 µl | 31 µl | 36 µl |
| 30 ng/µl | 5 µl | 22 µl | 27 µl |
| 20 ng/µl | 5 µl | 13 µl | 18 µl |
| 10 ng/µl | 10 µl | 8 µl | 18 µl |
| <5.56 ng/µl | 9 µl | 0 µl | 9 µl |
- Pipette mix the dilutions, and spin down briefly.
- Add 9 µl of volume for each sample into a 0.2 ml PCR tube or plate.
Select a unique barcode for every sample to be run together on the same flow cell. Up to 96 samples can be barcoded and combined in one experiment.
Please note: Only use one barcode per sample.
In 0.2 ml thin-walled PCR tubes or plate, mix the following reagents. The Rapid Barcodes can be transferred using a multichannel pipette:
| Reagent | Volume |
|---|---|
| 50 ng template DNA | 9 μl |
| Rapid Barcodes (RB01-96, one for each sample) | 1 μl |
| Total | 10 μl |
Ensure the components are thoroughly mixed by pipetting and spin down briefly.
Incubate the tubes or plate at 30°C for 2 minutes and then at 80°C for 2 minutes. Briefly put the tubes or plate on ice to cool.
Spin down the tubes or plate to collect the liquid at the bottom.
Pool all the barcoded samples into a clean 1.5 ml Eppendorf DNA LoBind tube, noting the total volume.
| . | Volume per sample | For 12 samples | For 24 samples | For 48 samples | For 96 samples |
|---|---|---|---|---|---|
| Total volume | 10 μl | 120 μl | 240 μl | 480 μl | 960 μl |
Resuspend the AMPure XP beads (AXP) by vortexing.
To the entire pooled barcoded sample, add an equal volume of resuspended AMPure XP Beads (AXP) and mix by flicking the tube.
| . | Volume per sample | For 12 samples | For 24 samples | For 48 samples | For 96 samples |
|---|---|---|---|---|---|
| Volume of AXP | 10 μl | 120 μl | 240 μl | 480 μl | 960 μl |
Incubar en el mezclador Hula (o mezclador giratorio suave) durante 5 minutos a temperatura ambiente.
Prepare at least 3 ml of fresh 80% ethanol in nuclease-free water.
Spin down the sample and pellet on a magnet. Keep the tube on the magnet, and pipette off the supernatant.
Keep the tube on the magnet and wash the beads with 1.5 ml of freshly prepared 80% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.
Repetir el paso anterior.
Briefly spin down and place the tube back on the magnet. Pipette off any residual ethanol. Allow to dry for 30 seconds, but do not dry the pellet to the point of cracking.
Remove the tube from the magnetic rack and resuspend the pellet in 15 µl Elution Buffer (EB). Incubate for 10 minutes at room temperature.
Precipitar las microesferas en un imán, durante al menos 1 minuto, hasta que el eluido se vuelva claro e incoloro.
Remove and retain 15 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.
- Remove and retain the eluate which contains the DNA library in a clean 1.5 ml Eppendorf DNA LoBind tube
- Dispose of the pelleted beads
CHECKPOINT
Cuantificar 1 μl de muestra eluida utilizando un fluorímetro Qubit.
Transfer 11 µl of the sample into a clean 1.5 ml Eppendorf DNA LoBind tube.
Note: We recommend transfering a maximum of 800 ng of the DNA library. If necessary, take forward only the necessary volume for 800 ng of DNA library and make up the rest of the volume to 11 µl using Elution Buffer (EB).
In a fresh 1.5 ml Eppendorf DNA LoBind tube, dilute the Rapid Adapter (RA) as follows and pipette mix:
| Reagent | Volume |
|---|---|
| Rapid Adapter (RA) | 1.5 μl |
| Adapter Buffer (ADB) | 3.5 μl |
| Total | 5 μl |
Add 1 µl of the diluted Rapid Adapter (RA) to the barcoded DNA.
Mix gently by flicking the tube, and spin down.
Incubate the reaction for 5 minutes at room temperature.
FIN DEL PROCESO
The prepared library is used for loading into the flow cell. Store the library on ice until ready to load.
5. Priming and loading the SpotON flow cell
Material
- Flow Cell Flush (FCF)
- Flow Cell Tether (FCT) (anclaje de celda de flujo)
- Library Solution (LIS)
- Library Beads (LIB) (microesferas de carga de la biblioteca)
- Sequencing Buffer (SB)
Consumibles
- Tubos de 1,5 ml Eppendorf DNA LoBind
- Celda de flujo MinION/GridION
- Agua sin nucleasas (p. ej., ThermoFisher AM9937)
- (Opcional) Seroalbúmina bovina (BSA) (50 mg/ml) (p. ej., Invitrogen™ UltraPure™ BSA 50 mg/ml, AM2616)
Instrumental
- Dispositivo MinION o GridION
- Pantalla protectora celdas de flujo MinION/GridION
- Pipeta y puntas P1000
- Pipeta y puntas P100
- Pipeta y puntas P20
- Pipeta y puntas P10
IMPORTANTE
Nótese, este kit es compatible solo con las celdas de flujo R10.4.1 (FLO-MIN114).
CONSEJO
Cebado y carga de la celda de flujo
Se recomienda a los nuevos usuarios que miren el vídeo Priming and loading your flow cell antes de realizar su primer experimento.
Uso de Library Solution (LIS)
En la mayoría de experimentos de secuenciación, recomendamos usar Library Beads (LIB) para cargar la biblioteca en la celda de flujo. Nótese, si previamente se ha usado agua para cargar la biblioteca, se deberá usar Library Solution (LIS) en su lugar. Nota: Algunos clientes han notado que las bibliotecas viscosas pueden cargarse con mayor facilidad cuando no se usan Library Beads (LIB).
Descongelar los viales Sequencing Buffer (SB), Library Beads (LIB) o Library Solution (LIS), -si se requiere-, y un tubo de Flow Cell Flush (FCF) a temperatura ambiente. Agitar en vórtex, centrifugar y colocar en hielo.
IMPORTANTE
Para obtener un rendimiento de secuenciación óptimo y mejorar el rendimiento de las celdas de flujo MinION R10.4.1 (FLO-MIN114), recomendamos añadir seroalbúmina bovina (BSA), en una concentración total de 0,2 mg/ml, a la mezcla de cebado de la celda de flujo.
Nota: No se aconseja utilizar ningún otro tipo de albúmina (p. ej., seroalbúmina humana recombinante).
To prepare the flow cell priming mix with BSA, combine the following reagents and pipette mix at room temperature:
Note: The vials of Flow Cell Flush (FCF) in kit SQK-RBK114.24 and SQK-RBK114.96 have different formats. Please ensure you are using the correct volume when preparing your flow cell priming mix.
- If using SQK-RBK114.24: The reagents can be added directly to the single-use tube of Flow Cell Flush (FCF).
- If using SQK-RBK114.96: Prepare the reagents in a suitable tube.
| Reagents | Volume per flow cell |
|---|---|
| Flow Cell Flush (FCF) | 1,170 µl |
| Bovine Serum Albumin (BSA) at 50 mg/ml | 5 µl |
| Flow Cell Tether (FCT) | 30 µl |
| Total volume | 1,205 µl |
Abrir la tapa del dispositivo MinION o GridION y deslizar la celda de flujo debajo del clip. Presionar la celda de flujo con firmeza para asegurar un contacto eléctrico y térmico adecuados.
MEDIDA OPCIONAL
Antes de cargar la biblioteca, verifique la celda de flujo para determinar el número de poros disponible.
Si se ha verificado con anterioridad la cantidad de poros presentes en la celda de flujo, este paso se puede omitir.
Dispone de más información en las instrucciones de comprobación de la celda de flujo, del protocolo de MinKNOW.
Abrir el puerto de cebado de la celda de flujo, deslizando la tapa en el sentido de las agujas del reloj.
IMPORTANTE
Tenga cuidado a la hora de extraer el tampón de la celda de flujo. No retire más de 20-30 μl y asegúrese de que el tampón cubra la matriz de poros en todo momento. La introducción de burbujas de aire en la matriz puede dañar los poros de manera irreversible.
Tras abrir el puerto de cebado, verificar si hay una burbuja de aire bajo la tapa. Retirar una pequeña cantidad de tampón para quitar las burbujas:
- Ajustar una pipeta P1000 a 200 μl.
- Introducir la punta de la pipeta en el puerto de cebado.
- Girar la rueda hasta que el indicador de volumen marque 220-230 μl o hasta que se pueda ver una pequeña cantidad de tampón entrar en la punta de la pipeta.
Nota: Comprobar que haya un flujo continuo de tampón circulando desde el puerto de cebado a través de la matriz de poros.
Cargar 800 μl de solución en el puerto de cebado, evitando introducir burbujas de aire. Esperar 5 minutos. Durante este tiempo, preparar la biblioteca para cargar siguiendo los pasos a continuación.
Mezclar con la pipeta, minuciosamente, el contenido del vial Library Beads (LIB).
IMPORTANTE
Este vial contiene microesferas en suspensión. Las microesferas precipitan muy rápido; por eso, es fundamental mezclarlas justo antes de usar.
En la mayoría de experimentos de secuenciación, se recomienda usar Library Beads (LIB) . El reactivo Library Solution (LIS) está indicado para bibliotecas de ADN más viscosas.
En un tubo nuevo de 1,5 ml Eppendorf DNA LoBind, preparar la biblioteca de la siguiente manera:
| Reactivo | Volumen por celda de flujo |
|---|---|
| Sequencing Buffer (SB) | 37,5 µl |
| Library Beads (LIB) mezcladas justo antes de usar, o Library Solution (LIS), si se requiere | 25,5 µl |
| Biblioteca de ADN | 12 µl |
| Total | 75 µl |
Completar el cebado de la celda de flujo:
- Levantar suavemente la tapa del puerto de carga SpotON.
- Cargar 200 µl de solución en el puerto de cebado (no en el puerto de muestra SpotON), evitando introducir burbujas de aire.
Mezclar la biblioteca pipeteando suavemente, justo antes de cargar.
Añadir, gota a gota, 75 μl de la biblioteca preparada en el puerto de muestra SpotON. Procurar que cada gota fluya hacia adentro del puerto antes de añadir la siguiente.
Volver a colocar con cuidado, la tapa del puerto de muestra SpotON, procurando que el tapón encaje en el agujero y cerrar el puerto de cebado.
IMPORTANTE
Para obtener resultados de secuenciación óptimos, coloque la pantalla protectora sobre la celda de flujo justo después de cargar la biblioteca.
Recomendamos colocar la pantalla protectora en la celda de flujo y dejarla puesta mientras la biblioteca esté cargada, incluyendo los lavados y pasos de recarga. Retirar la pantalla cuando se haya extraído la biblioteca de la celda de flujo.
Colocar la pantalla protectora de la siguiente manera:
Colocar con cuidado el borde delantero de la pantalla protectora contra el clip. Nota: No hacer fuerza sobre ella.
Colocar la pantalla protectora con suavidad sobre la celda de flujo. La pieza debe asentarse alrededor de la tapa SpotON y debe cubrir por completo la sección superior de la celda de flujo.
ATENCIÓN
La pantalla protectora no está fijada a la celda de flujo. Una vez colocada, es necesario manipularla con cuidado.
FIN DEL PROCESO
Cerrar la tapa del dispositivo y configurar un experimento de secuenciación en MinKNOW.
6. Data acquisition and basecalling
How to start sequencing
The sequencing device control, data acquisition and real-time basecalling are carried out by the MinKNOW software. Please ensure MinKNOW is installed on your computer or device. Further instructions for setting up a sequencing run can be found in the MinKNOW protocol.
We recommend setting up a sequencing run on a MinION or GridION device using the basecalling and barcoding recommendations outlined below. All other parameters can be left to their default settings.
Open the MinKNOW software using the desktop shortcut and log into the MinKNOW software using your Community credentials.
Click on your connected device.
Set up a sequencing run by clicking Start sequencing.
Type in the experiment name, select the flow cell postition and enter sample ID. Choose FLO-MIN114 flow cell type from the drop-down menu.
Click Continue to kit selection.
Select the Rapid Barcoding Kit 24 V14 (SQK-RBK114.24) or Rapid Barcoding Kit 96 V14 (SQK-RBK114.96).
Click Continue to Run Options to continue.
Change the run limit to 12 hours by clicking "Options" and changing the run limit value to 12. The other run settings can be left at the defaults.
Click Continue to basecalling to continue.
Set up basecalling and barcoding using the following parameters:
Ensure basecalling is ON.
Next to "Models", click Edit options and choose High accuracy basecaller (HAC) from the drop-down menu.
Ensure barcoding in ON.
All other options can be kept to their default settings.
Click Continue to output and continue.
Set up the output format and filtering as follows:
Select either .POD5 or .FAST5 (legacy) as the output format.
Ensure .FASTQ is selected for basecalled reads.
Ensure filtering is ON and read splitting is enabled. Other parameters can be kept to their default settings.
Click Continue to final review to continue.
Click "Start" to start sequencing.
You will be automatically navigated to the "Sequencing Overview" page to monitor the sequencing run.
7. Downstream analysis using EPI2ME Labs
Post-basecalling analysis
We recommend performing downstream analysis using EPI2ME Labs which facilitates bioinformatic analyses by allowing users to run Nextflow workflows in a desktop application. EPI2ME Labs maintains a collection of bioinformatic workflows which are curated and actively maintained by experts in long-read sequence analysis.
Further information about the available EPI2ME Labs workflows are available here, along with the Quick Start Guide to start your first bioinformatic workflow.
For the assembly of small plasmid sequences, we recommend using the wf-clone-validation workflow which requires Nextflow and Docker to be installed before running the workflow.
Open the EPI2ME app using the desktop shortcut.
Scroll down on the landing page and click on the wf-clone-validation workflow to download and confirm to install.
Navigate to the Workflows tab and click on wf-clone-validation.
Click on "Run this workflow" to open the launch wizard.
Set up your run by uploading your FASTQ file in the "Input Options". We recommend keeping the default settings for the other parameter options.
Click "Launch workflow".
Ensure all parameter options have green ticks.
Once the workflow finishes, a report will be produced.
Clone validation workflow report
A report is produced containing the results of the assembled plasmid sequences. The primary outputs of the workflow include:
- a consensus .fasta file for each sample
- a .csv showing the pass or fail status of each sample
- a feature table containing annotations for each of the samples
- an HTML report document detailing the primary findings of the workflow
A sample report can be viewed here.
The summary graph shows the number of reads per barcode and the table shows the length of the consensus sequence for each barcode. These data may be used to identify the samples that may have dropped out of the sequence analysis due to insufficient sequence reads.
For each barcode, read length statistics and a pLannotate plot is presented to illustrate the polished plasmid consensus sequence. In the sample report, barcode01 has been assembled into a 5385 bp consensus sequence. The unfilled features on the plot are incomplete features.
A feature table is also provided for each barcode to give descriptions of the annotated sequence which can be used to identify the precise location of the annotated features.
8. Ending the experiment
Material
- Flow Cell Wash Kit (EXP-WSH004) (kit de lavado de celda de flujo)
Si al terminar el experimento desea volver a usar la celda de flujo, siga las instrucciones del protocolo Flow Cell Wash Kit y guarde la celda de flujo lavada a 2-8 ⁰C.
El protocolo Flow Cell Wash Kit está disponible en la comunidad Nanopore.
Otra posibilidad es seguir el procedimiento de devolución para lavar la celda de flujo y enviarla a Oxford Nanopore.
Aquí puede encontrar las instrucciones para devolver celdas de flujo.
Nota: Antes de proceder a su devolución, las celdas de flujo deben lavarse con agua desionizada.
IMPORTANTE
Ante cualquier duda o pregunta acerca del experimento de secuenciación, consulte la guía de resolución de problemas, Troubleshooting Guide, que se encuentra en la versión en línea de este protocolo.
9. Issues during DNA/RNA extraction and library preparation
A continuación hay una lista de los problemas más frecuentes, con algunas posibles causas y soluciones propuestas.
También disponemos de una página de preguntas frecuentes, FAQ, en la sección Support de la comunidad Nanopore.
Si ha probado las soluciones propuestas y continúa teniendo problemas, póngase en contacto con el departamento de asistencia técnica, bien por correo electrónico (support@nanoporetech.com) o a través del Live Chat de la comunidad Nanopore.
Baja calidad de la muestra
| Observación | Posible causa | Comentarios y acciones recomendadas |
|---|---|---|
| Baja pureza del ADN (la lectura del Nanodrop para ADN OD 260/280 es <1,8 y OD 260/230 es <2,0-2,2) | El método de extracción de ADN no proporciona la pureza necesaria | Los efectos de los contaminantes se muestran en la página Contaminants. Pruebe con un método de extracción alternativo que no provoque el arrastre de contaminantes. Considere realizar un paso adicional de limpieza SPRI. |
| Baja integridad del ARN (número de integridad del ARN <9,5 RIN o la banda ARNr se muestra como una mancha en el gel). | El ARN se degradó durante la extracción | Probar un método de extracción de ARN diferente. Encontrará más información sobre RIN en la página RNA Integrity Number. Asimismo, dispone de información adicional en la página DNA/RNA Handling. |
| El ARN tiene una longitud de fragmento más corta de lo esperado | El ARN se degradó durante la extracción | Probar un método de extracción de ARN diferente. Encontrará más información sobre RIN en la página RNA Integrity Number. Asimismo, dispone de información adicional en la página DNA/RNA Handling. Cuando se trabaje con ARN, recomendamos que el espacio de trabajo y el instrumental de laboratorio estén libres de ribonucleasas. |
Escasa recuperación de ADN tras la limpieza con microesferas magnéticas AMPure
| Observación | Posible causa | Comentarios y acciones recomendadas |
|---|---|---|
| Escasa recuperación | Pérdida de ADN debido a una proporción de microesferas magnéticas AMPure por muestra inferior a lo previsto. | 1. Las microesferas magnéticas AMPure precipitan con rapidez; antes de añadirlas a la muestra hay que asegurarse de que estén bien resuspendidas. 2. Si la proporción de microesferas por muestra es inferior a 0.4:1, los fragmentos de ADN, sean del tamaño que sean, se perderán durante la limpieza. |
| Escasa recuperación | Los fragmentos de ADN son más cortos de lo esperado | Cuanto menor sea la proporción de microesferas magnéticas AMPure por muestra, más rigurosa será la selección de fragmentos largos frente a los cortos. Determinar siempre la longitud de la muestra de ADN en un gel de agarosa u otros métodos de electroforesis en gel, y, a continuación, calcular la cantidad adecuada de microesferas magnéticas que se debe utilizar.  |
| Escasa recuperación tras la preparación de extremos | El paso de lavado utilizó etanol a <70 % | Cuando se utilice etanol a <70 %, el ADN se eluirá de las microesferas magnéticas. Asegúrese de utilizar el porcentaje correcto. |
The VolTRAX run terminated in the middle of the library prep
| Observation | Possible cause | Comments and actions |
|---|---|---|
| The green light was switched off or An adapter was used to connect the VolTRAX USB-C cable to the computer | Insufficient power supply to the VolTRAX | The green LED signals that 3 A are being supplied to the device. This is the requirement for the full capabilities of the VolTRAX V2 device. Please use computers that meet the requirements listed on the VolTRAX V2 protocol. |
The VolTRAX software shows an inaccurate amount of reagents loaded
| Observation | Possible cause | Comments and actions |
|---|---|---|
| The VolTRAX software shows an inaccurate amount of reagents loaded | Pipette tips do not fit the VolTRAX cartridge ports | Rainin 20 μl or 30 μl and Gilson 10 μl, 20 μl or 30 μl pipette tips are compatible with loading reagents into the VolTRAX cartridge. Rainin 20 μl is the most suitable. |
| The VolTRAX software shows an inaccurate amount of reagents loaded | The angle at which reagents are pipetted into the cartridge is incorrect | The pipetting angle should be slightly greater than the cartridge inlet angle. Please watch the demo video included in the VolTRAX software before loading. |
10. Issues during the sequencing run
A continuación hay una lista de los problemas más frecuentes, con algunas posibles causas y soluciones propuestas.
También disponemos de una página de preguntas frecuentes, FAQ, en la sección Support de la comunidad Nanopore.
Si ha probado las soluciones propuestas y continúa teniendo problemas, póngase en contacto con el departamento de asistencia técnica, bien por correo electrónico (support@nanoporetech.com) o a través del Live Chat de la comunidad Nanopore.
Menos poros al inicio de la secuenciación que después de verificar la celda de flujo
| Observación | Posible causa | Comentarios y acciones recomendadas |
|---|---|---|
| MinKNOW presentó al inicio de la secuenciación un número de poros inferior al indicado durante la comprobación de la celda de flujo | Se introdujo una burbuja de aire en la matriz de nanoporos | Tras comprobar el número de poros presente en la celda de flujo, es imprescindible quitar las burbujas que haya cerca del puerto de cebado. Si no se quitan, pueden desplazarse a la matriz de nanoporos y dañar de manera irreversible los nanoporos expuestos al aire. En este vídeo se muestran algunas buenas prácticas para evitar que esto ocurra. |
| MinKNOW presentó al inicio de la secuenciación un número de poros inferior al indicado durante la comprobación de la celda de flujo | La celda de flujo no está colocada correctamente | Detener el ciclo de secuenciación, quitar la celda de flujo del dispositivo e insertarla de nuevo. Comprobar que está firmemente asentada en el dispositivo y que ha alcanzado la temperatura deseada. Si procede, probar con una posición diferente del dispositivo (GriION/PromethION). |
| MinKNOW presentó al inicio de la secuenciación un número de poros inferior al indicado durante la comprobación de la celda de flujo | La presencia de contaminantes en la biblioteca ha dañado o bloqueado los poros | El número de poros resultante tras la comprobación de la celda de flujo se realiza usando el control de calidad de las moléculas de ADN presentes en el tampón de almacenamiento de la celda de flujo. Al inicio de la secuenciación, se utiliza la misma biblioteca para estimar el número de poros activos. Por este motivo, se estima que puede haber una variabilidad del 10 % en el número de poros detectados. Tener un número de poros considerablemente inferior al inicio de la secuenciación puede deberse a la presencia de contaminantes en la biblioteca que hayan dañado las membranas o bloqueado los poros. Para mejorar la pureza del material de entrada tal vez sea necesario usar métodos de purificación o extracción de ADN/ARN alternativos. Los efectos de los contaminantes están descritos en la página Contaminants. Se recomienda, probar con un método de extracción alternativo que no provoque el arrastre de contaminantes. |
Error en el script de MinKNOW
| Observación | Posible causa | Comentarios y acciones recomendadas |
|---|---|---|
| MinKNOW muestra el mensaje "Error en el script" | Reiniciar el ordenador y reiniciar MinKNOW. Si el problema continúa, reúna los archivos de registro MinKNOW log files y contacte con el servicio de asistencia técnica. Si no dispone de otro dispositivo de secuenciación, recomendamos que guarde la celda de flujo con la biblioteca cargada a 4 °C y contacte con el servicio de asistencia técnica para recibir recomendaciones de almacenamiento adicionales. |
Pore occupancy below 40%
| Observation | Possible cause | Comments and actions |
|---|---|---|
| Pore occupancy <40% | Not enough library was loaded on the flow cell | Ensure you load the recommended amount of good quality library in the relevant library prep protocol onto your flow cell. Please quantify the library before loading and calculate mols using tools like the Promega Biomath Calculator, choosing "dsDNA: µg to pmol" |
| Pore occupancy close to 0 | The Ligation Sequencing Kit was used, and sequencing adapters did not ligate to the DNA | Make sure to use the NEBNext Quick Ligation Module (E6056) and Oxford Nanopore Technologies Ligation Buffer (LNB, provided in the sequencing kit) at the sequencing adapter ligation step, and use the correct amount of each reagent. A Lambda control library can be prepared to test the integrity of the third-party reagents. |
| Pore occupancy close to 0 | The Ligation Sequencing Kit was used, and ethanol was used instead of LFB or SFB at the wash step after sequencing adapter ligation | Ethanol can denature the motor protein on the sequencing adapters. Make sure the LFB or SFB buffer was used after ligation of sequencing adapters. |
| Pore occupancy close to 0 | No tether on the flow cell | Tethers are adding during flow cell priming (FLT/FCT tube). Make sure FLT/FCT was added to FB/FCF before priming. |
Longitud de lectura más corta de lo esperado
| Observación | Posible causa | Comentarios y acciones recomendadas |
|---|---|---|
| Longitud de lectura más corta de lo esperado | Fragmentación no deseada de la muestra de ADN | La longitud de lectura refleja la longitud del fragmento de la muestra de ADN. La muestra de ADN se puede fragmentar durante la extracción de la preparación de la biblioteca. 1. Consulte la sección de buenas prácticas de los métodos de extracción en la página Extraction Methods de la comunidad Nanopore. 2. Visualizar la distribución de la longitud de los fragmentos de las muestras de ADN en un gel de agarosa antes de proceder a la preparación de la biblioteca.  En la imagen superior, la muestra 1 contiene alto peso molecular, mientras que la muestra 2 se ha fragmentado.3. Durante la preparación de la biblioteca, evitar pipetear y agitar en vórtex cuando se mezclen los reactivos. Dar suaves golpes con el dedo o invertir el vial es suficiente. |
Gran proporción de poros no disponibles
| Observación | Posible causa | Comentarios y acciones recomendadas |
|---|---|---|
Gran proporción de poros no disponibles (se muestran en azul oscuro en el panel de canales y en el gráfico de actividad de poros)  Conforme pasa el tiempo, el gráfico de actividad de poros de arriba muestra una proporción creciente de poros no disponibles. | Hay contaminantes presentes en la muestra | Algunos contaminantes se pueden eliminar de los poros mediante la función de desbloqueo incorporada en MinKNOW. Si funciona, el estado de los poros cambiará a "sequencing pores" (secuenciación de poros). Si la porción poros no disponibles se mantiene elevada o aumenta, pruebe una de las siguientes opciones: 1. Realizar un enjuague de nucleasa con el kit de lavado Flow Cell Wash Kit (EXP-WSH004) 2. Realizar varios ciclos de PCR para intentar diluir cualquier contaminante que pueda estar causando problemas. |
Gran proporción de poros inactivos
| Observación | Posible causa | Comentarios y acciones recomendadas |
|---|---|---|
| Gran proporción de poros inactivos/no disponibles (se muestran en azul claro en el panel de canales y en el gráfico de actividad de poros. Los poros o membranas están dañados de manera irreversible) | Se han introducido burbujas de aire en la celda de flujo | Las burbujas de aire introducidas durante el cebado de la celda y la carga de la biblioteca pueden dañar los poros de forma permanente. Para conocer las buenas prácticas de cebado y carga de la celda de flujo, ver el vídeo Priming and loading your flow cell |
| Gran proporción de poros inactivos/no disponibles | Ciertos compuestos copurificados con ADN | Compuestos conocidos, incluidos los polisacáridos, se asocian generalmente con el ADN genómico de las plantas. 1. Consulte la página Plant leaf DNA extraction method. 2. Limpiar usando el kit QIAGEN PowerClean Pro. 3. Realizar una amplificación del genoma completo con la muestra original de ADNg utilizando el kit QIAGEN REPLI-g. |
| Gran proporción de poros inactivos/no disponibles | Hay contaminantes presentes en la muestra | Los efectos de los contaminantes se muestran en la página Contaminants. Probar con un método de extracción alternativo que no provoque el arrastre de contaminantes. |
Reducción de la velocidad de secuenciación y del índice de calidad Qscore en una fase avanzada de la secuenciación
| Observación | Posible causa | Comentarios y acciones recomendadas |
|---|---|---|
| Reducción de la velocidad de secuenciación y el índice de calidad Qscore en una fase avanzada de la secuenciación | En la química del kit 9 (p. ej., SQK-LSK109), cuando la celda de flujo está sobrecargada con la biblioteca se observa un consumo rápido de combustible (consulte el protocolo correspondiente a su biblioteca de ADN para ver las recomendaciones) | Añadir más combustible a la celda de flujo, siguiendo las instrucciones en el protocolo de MinKNOW. En futuros experimentos, cargar cantidades menores de biblioteca en la celda de flujo. |
Fluctuación de la temperatura
| Observación | Posible causa | Comentarios y acciones recomendadas |
|---|---|---|
| Fluctuación de la temperatura | La celda de flujo ha perdido contacto con el dispositivo | Comprobar que una almohadilla térmica cubra la placa metálica de la parte posterior de la celda de flujo. Reinsertar la celda de flujo y presionar para asegurarse de que las clavijas del conector estén bien conectadas al dispositivo. Si el problema continúa, contacte con el servicio de asistencia técnica. |
Error al intentar alcanzar la temperatura deseada
| Observación | Posible causa | Comentarios y acciones recomendadas |
|---|---|---|
| MinKNOW muestra el mensaje "Error al intentar alcanzar la temperatura deseada" | El dispositivo ha sido colocado en un lugar a una temperatura ambiente inferior a la media o en un lugar con escasa ventilación (lo que provoca el sobrecalientamiento de las celdas de flujo). | MinKNOW tiene un tiempo predeterminado para que las celdas de flujo alcancen la temperatura fijada. Una vez acabado el tiempo, aparece un mensaje de error, pero el experimento de secuenciación continua. Secuenciar a una temperatura incorrecta puede llevar a una disminución en el rendimiento y a generar un índice de calidad Qscore menor. Corrija la ubicación del dispositivo, procure que esté a temperatura ambiente y tenga buena ventilación; a continuación, reinicie el proceso en MinKNOW. Para obtener más información sobre el control de temperatura de MinKNOW Mk 1B, consulte la sección de preguntas frecuentes, FAQ. |
Last updated: 9/30/2024
Document options
