Influenza A RNA


Keller, M.W. et al., Direct RNA Sequencing of the Coding Complete Influenza A Virus Genome. Nature Scientific Reports, 8, 14408

Materials

  • 200–2000 µl MDCK cell culture or embryonated chicken egg allantoic fluid
  • TRIzol (Invitrogen)
  • Phase Lock GelTM tubes (VWR) - optional
  • RNase-free glycogen or GlycoBlue™ Coprecipitant (ThermoFisher)- optional
  • 75% freshly-prepared ethanol
  • Isopropanol
  • Nuclease-free water or TE buffer
  • 1.5 ml Eppendorf DNA LoBind tubes
  • 1.5 ml Eppendorf tubes
  • Custom Reverse Transcription Adapter (RTA) for library prep (see below)

Methods

  1. Critical Step: Ensure you start with at least 3X more TRIzol than the volume of your starting material. Extract 250 µl of sample in a 1.5 ml Eppendorf DNA LoBind tube. For example, if you have 1000 µl starting material, four tubes will be used.

  2. Follow the standard TRIzol protocol, using a Phase Lock GelTM tube to trap the organic phase. Add 1 µg RNase-free glycogen to the first isopropanol precipitation. Then use standard 1.5 ml tubes for the pelleting steps.

  3. Optional Step: GlycoBlue Coprecipitant can be used to make the pellet visible.

  4. Critical Step: If the extractions were performed in multiple tubes, when resuspending the pellet in ethanol, use the same 1 ml of ethanol to serially resuspend all the pellets.

  5. Elute the RNA in 10–100 µl nuclease-free water or TE buffer.

Results

  • Yield: 10-1100 ng

Sequencing performance

Libraries were prepared using the Direct RNA Sequencing Kit with a custom RTA:

Name Sequence
RTA-A /5phos/GGCTTCTTCTTGCTCTTAGGTAGTAGGTTC
RTA-B GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGAAGAAGCCTTTTTTTTTT
RTA-B-U12 GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGAAGAAGCCAGCAAAAGCAGG
RTA-A-U12.4 GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGAAGAAGCCAGCGAAAGCAGG

The custom RTAs can be purchased from IDT, with each of the modified RTA-B strands already duplexed to the RTA-A strand. The RTA-A has a 5’ phosphate modification for ligation. The regions of reverse complementarity between the RTA strands are underlined, and the target sequences are coloured.

  • Read length profile:

Flu RNA

Last updated: 7/11/2023

Document options