MinION: Protocol

Rapid metagenomic sequencing for surveillance of bacterial, fungal and viral pathogens using SQK-RPB114.24 V RMS_9215_v114_revA_11Dec2024

This protocol:

is a rapid method to perform metagenomic sequencing for identification of bacterial, fungal and viral pathogens.
consists of a two-in-one method that splits sample into bacterial/fungal sample preparation and viral/acellular sample preparation.
provides a recommended host depletion and extraction method for respiratory samples.
uses a shotgun approach to RT-PCR.
involves tagmentation, barcoding and PCR amplification.
is compatible with R10.4.1 flow cells.

For Research Use Only

This is an Early Access product For more information about our Early Access programmes, please see this article on product release phases.

FOR RESEARCH USE ONLY

Descripción general

This protocol:

is a rapid method to perform metagenomic sequencing for identification of bacterial, fungal and viral pathogens.
consists of a two-in-one method that splits sample into bacterial/fungal sample preparation and viral/acellular sample preparation.
provides a recommended host depletion and extraction method for respiratory samples.
uses a shotgun approach to RT-PCR.
involves tagmentation, barcoding and PCR amplification.
is compatible with R10.4.1 flow cells.

For Research Use Only

This is an Early Access product For more information about our Early Access programmes, please see this article on product release phases.

Document version: RMS_9215_v114_revA_11Dec2024

1. Overview of protocol

Introduction to the rapid metagenomic sequencing protocol

This protocol outlines a method to perform agnostic metagenomic sequencing from extracted nucleic acid.

The method offers two options for sample preparation depending on your target sample and input:

The DNA-only bacterial/fungal sample preparation utilises SQK-RPB114.24 reagents to tagment all DNA in the extract for amplification and sequencing.
The DNA/RNA viral sample preparation has been optimised by Oxford Nanopore Technologies, and is derived from a method established by Josh Quick and Ingra M. Claro which utilises a shotgun approach using 9N primers to randomly reverse transcribe RNA and subsequently PCR-amplify DNA/RNA present in a sample.

Other areas of note:

The performance of this method is reliant on sample type and was optimised for respiratory samples.
While effort is made to reduce host background, sample types that are less complex/have less nucleic acid background are likely to perform better.

This protocol uses the Rapid PCR Barcoding Kit V14 (SQK-RPB114.24), which allows the potential to use up to 24 barcodes in one sequencing experiment.

Steps in the sequencing workflow:

Prepare for your experiment

You will need to:

Ensure you have your sequencing kit, the correct equipment and third-party reagents
Extract your DNA/RNA if not using the respiratory sample processing workflow in this protocol
Download the software for acquiring and analysing your data
Check your flow cell to ensure it has enough pores for a good sequencing run

Host depletion and extraction

If using the recommended respiratory sample host depletion and extraction, ensure you have the correct third-party reagents
Ensure you have fresh samples to use (not recommended for frozen/deactivated samples)

Library preparation

The table below is an overview of the steps required in the library preparation, including timings and optional stopping points.

Step	Process	Time	Stop option
Viral samples: reverse transcription	Reverse transcribe your RNA samples with the RLB RT 9N primer mix and the TSOmG template-switching oligo	~90 minutes
Bacterial/fungal samples: DNA tagmentation	Tagment your DNA using the Fragmentation Mix from the sequencing kit	10 minutes
PCR amplification	PCR your sample using the barcoded primer supplied in the sequencing kit	180 minutes	Optional: The PCR amplification can be performed and left at the hold temperature overnight.
Sample quantification and pooling	Quantify your barcoded PCR samples and pool them in equimolar ratios	15 minutes
Cleanup and quantification	Perform a purification on your pooled samples and quantify	15 minutes	4°C overnight
Adapter attachment and clean-up	Attach the sequencing adapters to the DNA ends	5 minutes	We strongly recommend sequencing your library as soon as it is adapted.
Priming and loading the flow cell	Prime the flow cell and load the prepared library for sequencing	5 minutes

Sequencing and analysis

You will need to:

Start a sequencing run using the MinKNOW software, which will collect raw data from the device and convert it into basecalled reads
Analyse your data using the wf-metagenomics workflow available through EPI2ME or the command line

IMPORTANTE

Compatibility of this protocol

This protocol should only be used in combination with:

Rapid PCR Barcoding Kit (SQK-RPB114.24)
R10.4.1 flow cells (FLO-MIN114)
Flow Cell Wash Kit (EXP-WSH004)
Rapid Adapter Auxiliary V14 (EXP-RAA114)
Sequencing Auxiliary Vials V14 (EXP-AUX003)
Flow Cell Priming Kit V14 (EXP-FLP004)
MinION Mk1B - MinION Mk1B IT requirements document
MinION Mk1C - MinION Mk1C IT requirements document
MinION Mk1D - MinION Mk1D IT requirements document
GridION - GridION IT requirements document

2. Equipment and consumables

Material

(FOR SAMPLE PREPARATION) Bacterial/fungal or viral/acellular sample inputs (see details below)
(FOR LIBRARY PREPARATION) Extracted nucleic acid
Rapid PCR Barcoding Kit 24 V14 (SQK-RPB114.24)

Consumibles

Celda de flujo MinION/GridION
Sputasol (Fisher, 11943262)
RT-PCR Grade Water (Fisher, 10289774)
Phosphate Buffer Saline (PBS) (Fisher, 11593377)
2X HL-SAN Buffer (4.5 M NaCl and 100 mM MgCl2) formulated using the two reagents below:
• Invitrogen 5M NaCl (Fisher, 10255984)
• Invitrogen 1M MgCl2 (Fisher, 10418464)
HL-SAN Triton Free DNase (ArticZymes, 70911-202)
Saponin solution (0.2% saponin in PBS) formulated using the reagent below:
• Saponin (Sigma-Aldrich, 47036-50G-F)
Matrix Lysing E tubes (Fisher, 11452420)
MagMAX Viral/Pathogen Nucleic Acid Isolation Kit (Fisher, 16346582)
12 µM RLB RT 9N primer (IDT - Sequence: 5’-TTTTTCGTGCGCCGCTTCAACNNNNNNNNN-3’)
12 µM TSOmG template-switching oligo (IDT - Sequence: 5’-GCTAATCATTGCTTTTTCGTGCGCCGCTTCAACATmGmGmG-3’)
10 mM dNTPs (Fisher, 10610851)
Maxima H Minus Reverse Transcriptase (Fisher, 13233159)
RNaseOUT (Fisher, 10777019)
LongAmp Hot Start Taq 2X Master Mix (NEB, M0533)
Thermolabile Exonuclease I (NEB, M0568)
Agencourt AMPure XP Beads (Beckman Coulter™, A63881)
Nuclease-free water (e.g. ThermoFisher, AM9937)
Seroalbúmina bovina (BSA) (50 mg/ml) (p. ej., Invitrogen™ UltraPure™ BSA 50 mg/ml, AM2616)
1.5 ml Eppendorf DNA LoBind tubes
Tubos de PCR de pared fina (0,2 ml)
Qubit dsDNA HS Assay Kit (ThermoFisher, Q32851)
Tubos de ensayo Qubit™ (Invitrogen Q32856)

Instrumental

Dispositivo MinION o GridION
Pantalla protectora de celdas de flujo MinION/GridION
Centrifuge e.g. Eppendorf max speed 15,000rpm (Fisher, 15881635)
Microcentrífuga
Temporizador
Mezclador vórtex
Thermomixer set at 37°C
Thermomixer set at 65°C
Gradilla magnética
Bead-beater (e.g. FastPrep-24™ Classic bead beating grinder and lysis system)
Termociclador
96-well PCR block
Ice bucket with ice
Mezclador Hula (mezclador giratorio suave)
Qubit fluorometer (or equivalent)
P1000 pipette and tips
Pipeta y puntas P200
P100 pipette and tips
P20 pipette and tips
Pipeta y puntas P10
P2 pipette and tips

Equipo opcional

Suitable biosafety equipment for your sample(s) (e.g. Microbiological Safety Cabinet II contamination level 3 or equivalent)

IMPORTANTE

Ensure pathogenic samples are handled in appropriate biosafety conditions.

Please adhere to the correct health and safety practices in accordance to your laboratory standards and local rules and regulations.

Note: We recommend as a minimum the use of a Class II Biological Safety Cabinet. Please consider that some organisms can survive bead-beating steps during extraction. Ensure you are taking the necessary precautions during your sample and library preparation.

For this protocol you will need the following sample input(s):

For sample preparation:

≥ 250 µl of Sputum/Endotracheal aspirates

≥ 250 µl of Bronchoalveolar lavages/Mini-BALs

≥ 500 µl of VTM/UTM-stored oral/nasal swabs (only suitable for viral samples)

Note: If quantities allow, a sample can be processed for both bacterial/fungal sample preparation and viral sample preparation. Please note, each preparation type will differ in method and should be treated as a separate sample.

For library preparation:

Extracted nucleic acid from the sample types above

Cantidad de muestra inicial de ADN (1)

Cómo realizar un control de calidad de la muestra inicial de ADN

Es importante que la muestra de ADN cumpla con los requisitos de cantidad y calidad. Usar demasiado ADN, poco o de mala calidad (p. ej., que esté muy fragmentado, que contenga ARN o contaminantes químicos), puede afectar a la preparación de la biblioteca.

Para realizar un control de calidad en la muestra de ADN, consulte el protocolo Input DNA/ RNA QC

Contaminantes químicos

Dependiendo de cómo se extraiga el ADN de la muestra cruda, ciertos contaminantes químicos pueden permanecer en el ADN purificado, lo cual afecta la eficacia de la preparación de la biblioteca y la calidad de la secuenciación. Encontrará más información sobre contaminantes en la página Contaminants de la comunidad Nanopore.

MEDIDA OPCIONAL

Input controls

Negative internal controls

We recommend a negative control is included and processed as a real sample through the entire process to monitor for contamination events.

The negative control can be PBS or a third-party negative sample matrix.

Reactivos de otros fabricantes

Oxford Nanopore Technologies ha probado y recomienda el uso de todos los reactivos de otros fabricantes citados en este protocolo. No se han evaluado otras alternativas.

Recomendamos preparar estos reactivos siguiendo las instrucciones del fabricante.

Agencourt AMPure XP beads

Additional Agencourt AMPure XP beads may be required alongside the AMPure XP Beads (AXP) provided in the sequencing kit for the clean-up step following PCR amplification.

CONSEJO

Eppendorf tube orientation in centrifuge

For all centrifugation steps, ensure that tubes are loaded into the centrifuge with the hinge side of the tube facing outwards. This will assist in visual identification of the pellet.

Ensure gentle handling when removing the tubes from the centrifuge to avoid dislodging the pellet.

Verificar la celda de flujo

Antes de empezar el experimento de secuenciación, recomendamos verificar el número de poros disponibles, presentes en la celda de flujo. La comprobación deberá realizarse en las primeras 12 semanas desde su adquisición, si se trata de celdas de flujo MinION, GridION o PromethION, y en las primeras cuatro semanas tras la compra de celdas de flujo Flongle. Oxford Nanopore Technologies sustituirá cualquier celda de flujo con un número de poros inferior al indicado en la tabla siguiente, siempre y cuando el resultado se notifique dentro de los dos días siguientes a la comprobación y se hayan seguido las instrucciones de almacenamiento. Para verificar la celda de flujo, siga las instrucciones del documento Flow Cell Check.

Celda de flujo	Número mínimo de poros activos cubierto por la garantía
Flongle	50
MinION/GridION	800
PromethION	5000

IMPORTANTE

The Rapid Adapter (RA) used in this kit and protocol is not interchangeable with other sequencing adapters.

Rapid PCR Barcoding Kit 24 V14 (SQK-RPB114.24) contents

Name	Acronym	Cap colour	No. of vials	Fill volume per vial (µl)
Fragmentation Mix	FRM	Brown	1	160
Rapid Adapter	RA	Green	1	15
Adapter Buffer	ADB	Clear	1	100
AMPure XP Beads	AXP	Amber	3	1,200
Elution Buffer	EB	Black	2	500
EDTA	EDTA	Blue	1	700
Sequencing Buffer	SB	Red	1	700
Library Beads	LIB	Pink	1	600
Library Solution	LS	White cap, pink label	1	600
Flow Cell Flush	FCF	Clear	1	8,000
Flow Cell Tether	FCT	Purple	1	200
Rapid Barcode Primer 01-24	RLB01-24	Clear	24 (one per barcode)	15

Note: This product contains AMPure XP Reagent manufactured by Beckman Coulter, Inc. and can be stored at -20°C with the kit without detriment to reagent stability.

Rapid barcode primers

Component	Sequence
RLB01	AAGAAAGTTGTCGGTGTCTTTGTG
RLB02	TCGATTCCGTTTGTAGTCGTCTGT
RLB03	GAGTCTTGTGTCCCAGTTACCAGG
RLB04	TTCGGATTCTATCGTGTTTCCCTA
RLB05	CTTGTCCAGGGTTTGTGTAACCTT
RLB06	TTCTCGCAAAGGCAGAAAGTAGTC
RLB07	GTGTTACCGTGGGAATGAATCCTT
RLB08	TTCAGGGAACAAACCAAGTTACGT
RLB09	AACTAGGCACAGCGAGTCTTGGTT
RLB10	AAGCGTTGAAACCTTTGTCCTCTC
RLB11	GTTTCATCTATCGGAGGGAATGGA
RLB12	GTTGAGTTACAAAGCACCGATCAG
RLB13	AGAACGACTTCCATACTCGTGTGA
RLB14	AACGAGTCTCTTGGGACCCATAGA
RLB15	AGGTCTACCTCGCTAACACCACTG
RLB16	CGTCAACTGACAGTGGTTCGTACT
RLB17	ACCCTCCAGGAAAGTACCTCTGAT
RLB18	CCAAACCCAACAACCTAGATAGGC
RLB19	GTTCCTCGTGCAGTGTCAAGAGAT
RLB20	TTGCGTCCTGTTACGAGAACTCAT
RLB21	GAGCCTCTCATTGTCCGTTCTCTA
RLB22	ACCACTGCCATGTATCAAAGTACG
RLB23	CTTACTACCCAGTGAACCTCCTCG
RLB24	GCATAGTTCTGCATGATGGGTTAG

3. Host depletion and extraction

Material

Sputum/Endotracheal aspirates
Bronchoalveolar lavages/Mini-BALs
VTM/UTM-stored oral/nasal swabs (viral-arm only)

Consumibles

Sputasol (Fisher, 11943262)
RT-PCR Grade Water (Fisher, 10289774)
Phosphate Buffer Saline (PBS) (Fisher, 11593377)
2X HL-SAN Buffer (4.5 M NaCl and 100 mM MgCl2) formulated using the two reagents below:
• Invitrogen 5M NaCl (Fisher, 10255984)
• Invitrogen 1M MgCl2 (Fisher, 10418464)
HL-SAN Triton Free DNase (ArticZymes, 70911-202)
Saponin solution (0.2% saponin in PBS) formulated using the reagent below:
• Saponin (Sigma-Aldrich, 47036-50G-F)
Matrix Lysing E tubes (Fisher, 11452420)
MagMAX Viral/Pathogen Nucleic Acid Isolation Kit (Fisher, 16346582)
1.5 ml Eppendorf DNA LoBind tubes
15 ml Falcon tubes

Instrumental

Centrifuge e.g. Eppendorf max speed 15,000rpm (Fisher, 15881635)
Microfuge
Temporizador
Mezclador vórtex
Thermomixer set at 37°C
Thermomixer set at 65°C
Magnetic rack
Bead-beater (e.g. FastPrep-24™ Classic bead beating grinder and lysis system)
P1000 pipette and tips
Pipeta y puntas P200
P20 pipette and tips
Pipeta y puntas P10

Equipo opcional

Suitable biosafety equipment for your sample(s) (e.g. Microbiological Safety Cabinet II contamination level 3 or equivalent)

IMPORTANTE

Ensure you are keeping your bacterial/fungal samples separate from your viral samples.

If processing a mix of bacterial/fungal samples and viral samples, ensure you keep them separate to avoid following the wrong sample preparation method.

Both methods can be followed simultaneously if processing different sample types prior to library preparation. Please ensure you are following the correct method for each sample type.

Note: A sample can be processed for both bacterial/fungal sample preparation and viral sample preparation. Please follow the instructions below, where the supernatant is used for viral sample preparation and the pellet is used for bacterial/fungal sample preparation. Please note, each preparation type will differ in method and should be treated as a separate sample.

250 µl of sputum, endotracheal aspirate or other viscous samples (e.g. mucosal BAL).

500 µl of swab sample in transport media or other liquid samples.

MEDIDA OPCIONAL

Input controls

Negative internal controls

We recommend a negative control is included and processed as a real sample through the entire process to monitor for contamination events.

The negative control can be PBS or a third-party negative sample matrix.

In a fresh 15 ml falcon tube dispense 750 µl Sputasol.
Add 9.25 ml nuclease-free water.
Throughly mix by vortexing.

* Volumes can be adjusted to meet your experiment requirements.

Reagent	Quantity/Volume
Saponin (Sigma-Aldrich, 47036-50G-F)	0.01 g
Phosphate Buffer Saline (PBS)	5,000 µl
Total volume 0.2% saponin-PBS solution	5,000 µl

* Quantity/volumes can be adjusted to meet your experiment requirements.

The 0.2% saponin-PBS solution can be stored in the fridge (~4°C) for up to 30 days.

Reagent	Volume
Invitrogen 5M NaCl	4,500 µl
Invitrogen 1M MgCl2	500 µl
Total	5,000 µl

* Volumes can be adjusted to meet your experiment requirements.

The formulated 2X HLSAN Buffer can be stored at room temperature (~22°C) long-term.

Note: Transport Media and BAL samples do not require this unless they are mucoid.

To each sample, add an equal volume (1:1) of Sputasol working solution.
Mix by vortexing for 30 seconds.
Incubate at room temperature until liquefication (at least 5 minutes).

Tip: If the sample is still viscous or sticky after 5 minutes, repeat the process above. Full liquefication of sputum is important for good depletion and efficient extraction.

CONSEJO

Remember, your sample(s) can be processed for both viral sample preparation and bacterial/fungal sample preparation.

Please follow the instructions outlined below and treat each preparation as a separate sample.

Step	For viral sample preparation	For bacterial/fungal samples
1.	For each sample, transfer 300 µl of the supernatant (by aspirating from the top) to a separate new 1.5 ml Eppendorf tube.	OPTIONAL: the remaining pellet and supernatant from the sample used in the viral sample preparation can be taken forward and processed in the bacterial/fungal sample preparation as seen below
2.		Using a pipette, carefully remove most of the supernatant without disturbing the pellet, leaving enough volume to cover the pellet. Note: Ensure there is enough supernatant left (~50 µl) above the pellet so as to not disturb it.
3.		Thoroughly resuspend the pellet in 200 µl of the prepared 0.2% saponin-PBS solution. Mix by pipetting.
4.	Add the depletion reagent to the sample supernatant: • Add 10 µl of HLSAN enzyme. • Vortex mix for 3 seconds.	Add the depletion reagents to the resuspended pellet as follows: • Add 200 µl of the prepared 2X HLSAN Buffer. • Add 10 µl of HLSAN enzyme. • Vortex mix for 3 seconds.
5.	Incubate the reaction on a thermomixer at 37°C for 10 minutes at 1,000 rpm.	Incubate the reaction on a thermomixer at 37°C for 10 minutes at 1,000 rpm.
6.	To each tube containing the sample supernatant, prepare the following reaction: Ensure the reagents are mixed by inverting the tube multiple times. Avoid mixing the lysis reagents too vigorously or with any method that would lead to foam (e.g. vortexing). Note: A mastermix of the extraction reagents can be made and added together instead.
7.		Add 900 µl of PBS to your sample(s) and mix by pipetting.
8.		Centrifuge your sample(s) at 12,000 x g for 3 minutes.
9.		Using a pipette, carefully remove most of the supernatant without disturbing the pellet, leaving enough volume to cover the pellet. Ensure there is enough supernatant left (~50 µl) above the pellet so as to not disturb it.
10.		Resuspend pellet in 500 µl of PBS and mix by pipetting.
11.		For each sample, transfer whole volume of sample into a separate new bead-beating tube (matrix lysing E tubes).
12.		Insert the bead-beating tubes into the FastPrep-24 Classic bead beating grinder and lysis system and run the program as follows:
13.		Remove the bead-beating tubes from the Fast-prep device, and centrifuge for 30 seconds at max speed (>20,000 x g).
14.		For each sample, transfer 300 µl of the supernatant to a separate new 1.5 ml Eppendorf tube. Note: Avoid aspirating the beads from the bead-beating tube.
15.		To each tube containing the sample supernatant, prepare the following reaction: Ensure the reagents are mixed by inverting the tube multiple times. Avoid mixing the lysis reagents too vigorously or with any method that would lead to foam (e.g. vortexing). Note: A mastermix of the extraction reagents can be made and added together instead.

Hulamixer settings:

Orbital 15 rpm (10 seconds)
Reciprocal 70° (15 seconds)
Vibro/pause 5° (3 seconds)
5 minutes total.

Note: Tube inversion is crucial during this incubation, as the beads may collect at the bottom of the tube. We highly recommend the use of a hulamixer, however if this is not available, ensure the samples are manually inverted during the incubation.

Take care not to disturb the pelleted beads.

Note: Avoid techniques that will create foam when mixing your tubes. This can negatively impact sample recovery.

Dispose of the pelleted beads

FIN DEL PROCESO

Take your extracted sample forward into the library preparation section of this protocol.

Alternatively, if you are not using your sample immediately, store at -20°C.

4. Reverse transcription and PCR

Material

For viral sample preparation: 10 µl of extracted nucleic acid from previous step
For bacterial/fungal sample preparation: 3 µl of extracted nucleic acid from previous step
Fragmentation Mix (FRM)
Rapid Barcode Primers (RLB01-24)

Consumibles

12 µM RLB RT 9N primer (IDT - Sequence: 5’-TTTTTCGTGCGCCGCTTCAACNNNNNNNNN-3’)
12 µM TSOmG template-switching oligo (IDT - Sequence: 5’-GCTAATCATTGCTTTTTCGTGCGCCGCTTCAACATmGmGmG-3’)
10 mM dNTPs (Fisher, 10610851)
Maxima H Minus Reverse Transcriptase (Fisher, 13233159)
RNaseOUT (Fisher, 10777019)
LongAmp Hot Start Taq 2X Master Mix (NEB, M0533)
Nuclease-free water (e.g. ThermoFisher, AM9937)
Tubos de 1,5 ml Eppendorf DNA LoBind
0.2 ml thin-walled PCR tubes

Instrumental

Mezclador Hula (mezclador giratorio suave)
Microfuge
Termociclador
96-well PCR block
Timer
Cubeta con hielo
P1000 pipette and tips
Pipeta y puntas P200
Pipeta y puntas P100
P20 pipette and tips
Pipeta y puntas P10
P2 pipette and tips

IMPORTANTE

Ensure you are following the correct steps in the method for your sample type.

The method differs for bacterial/fungal sample processing and for viral sample processing. Please ensure you keep track of your samples to ensure you are following the correct method.

Note: If a sample has been processed for both bacterial/fungal sample preparation and viral sample preparation, you will have two "separate" samples to process and barcode in library preparation.

Reagents	1. Thaw at room temperature	2. Briefly spin down	3. Mix well by pipetting
Fragmentation Mix (FRM)	Not frozen	✓	✓
Rapid Barcode Primer 1-24 (RLB01-24)	✓	✓	✓
RLB RT 9N primer (12 µM)	✓	✓	✓
TSOmG template-switching oligo (2 μM)	✓	✓	✓
10 mM dNTP solution	✓	✓	✓
Maxima H Minus Reverse Transcriptase	Not frozen	✓	✓
Maxima H Minus 5x RT Buffer	✓	✓	✓
LongAmp Taq 2X Master Mix	✓	✓	✓
RNaseOUT	Not frozen	✓	✓

For viral sample preparation:

Take forward 10 µl of each viral nucleic acid extract.

Note: Quantifying viral samples is not recommended, as these will likely be below the limit of detection for Qubit HS or similar fluorescence-based quantification methods. Please proceed with the recommended volume of viral nucleic acid extract.

For bacterial/fungal samples:

Quantify 1 µl of each bacterial/fungal extraction using Qubit High Sensitivity.
- If the extract is more than 1 ng/µl: dilute to 1 ng/µl using nuclease-free water.
- If the extract is less than 1 ng/µl (or unquantifiable): no dilution is necessary, and extract is used directly.
Take forward 3 µl of each bacterial/fungal DNA extract.

Note: If processing both sample types we recommend preparing the viral samples first as they have a longer incubation time. The bacterial/fungal samples can be processed during the viral sample incubation.

Step	For viral sample preparation (RT reaction)	For bacterial/fungal samples (tagmentation)
1.	In a clean 0.2 ml thin-walled PCR tube, prepare the following master mix. Tip: Generate sufficient volume for each viral sample preparation + 1 extra volume for excess:
2.	Mix the master mix prepared above by vortexing and spin down briefly.
3.	Add 2 µl of the prepared mastermix to each of your 10 µl of viral nucleic acid extract.
4.	Incubate the reaction at 65°C for 5 minutes, then transfer the samples to ice immediately.
5.	Keep your samples on ice for 2 minutes.
6.	In a clean 0.2 ml thin-walled PCR tube, prepare the Maxima H master mix. Tip: Generate sufficient volume for each viral sample preparation + 1 extra volume for excess: Note: Add the Maxima H Enzyme last. Keep the master mix on ice. The master mix should be aliquoted to your samples and incubated relatively quickly, as the enzymes are not hot-start, and the reaction will start as soon as it comes in contact with your sample.
7.	Add 8 µl of the Maxima H master mix to each of your viral samples for a total combined volume of 20 µl.
8.	Pre-heat a PCR block to 42°C, then add your sample tubes and incubate using the following conditions:	During the RT reaction (viral samples), the bacterial/fungal samples can be prepared.
9.		To each of the 3 µl of bacterial/fungal DNA extract, add 1 µl of FRM, and mix gently by flicking the tube.
10.		Pre-heat a PCR block to 30°C, then add your sample tubes and incubate using the following conditions: .

Tip: Generate sufficient volume for each sample preparation + 1 extra volume for excess:

Reagent	Volume
LongAmp Hot Start Taq 2X Master Mix	25 µl
Nuclease-free water	20 µl
Total volume	45 µl

Mix by pipetting, taking care not to generate bubbles or foam.

Note: The non-hot start product, LongAmp Taq 2X Master Mix (e.g. NEB, cat # M0287) is also compatible with this method. If using this alternative, please ensure you follow the manufacturers instructions and prepare this reaction on ice.

Note: To make sample tracking easier, we recommend that the two types of sample preparation are given different blocks of barcodes:

e.g. Barcodes 1-4 for the viral samples and barcodes 5-8 for the bacterial/fungal samples.

For viral samples:

Add 5 µl RT sample to the reaction tube. Do not deviate from the recommended volume as this can lead to sub-optimal results.

Reagent	Volume
Master mix + barcode	46 µl
RT viral sample	5 µl
Total	51 µl

Note: If you are concerned that you will not reach the minimum molarity, we recommend assembling two separate reactions for your viral sample using the volumes above, and pooling following PCR. Do not alter the PCR volumes as this will result in poor performance of the PCR and lead to sub-optimal results.

For bacterial/fungal samples:

Add the full volume of tagmented sample to the reaction tube:

Reagent	Volume
Master mix + barcode	46 µl
Tagmented bacterial/fungal DNA sample	~4 µl
Total	50 µl

Cycle step	Temperature	Time	No. of cycles
Initial denaturation	95°C	45 seconds	1
Denaturation Annealing Extension	95°C 56°C 65°C	15 sec 15 sec 4 minutes	30
Final extension	65°C	6 minutes	1
Hold	10°C	∞

Note: Total PCR time 2 hours 43 minutes* (Timing may differ depending on equipment and ambient conditions).

Optional: The PCR amplification can be performed and left at the hold temperature overnight.

FIN DEL PROCESO

Take forward your sample into the clean up, quantification and adapter attachment step.

5. Clean-up, quantification and adapter attachment

Material

AMPure XP Beads (AXP)
Elution Buffer (EB)
Rapid Adapter (RA)
Adapter Buffer (ADB)

Consumibles

Thermolabile Exonuclease I (NEB, M0568)
Etanol al 80 %, recién preparado con agua sin nucleasas
Tubos de 1,5 ml Eppendorf DNA LoBind
Tubos de PCR de pared fina (0,2 ml)
Qubit dsDNA HS Assay Kit (ThermoFisher, Q32851)
Tubos de ensayo Qubit™ (Invitrogen Q32856)

Instrumental

Termociclador
Mezclador Hula (mezclador giratorio suave)
Gradilla magnética
Qubit fluorometer (or equivalent)
Timer
P1000 pipette and tips
Pipeta y puntas P200
P100 pipette and tips
P20 pipette and tips
Pipeta y puntas P10
P2 pipette and tips

Make a note of each samples concentration.

Note: Sample concentration may vary depending on input. Some of your samples might be below the limit of detection for the Qubit dsDNA HS Assay Kit. This is not an uncommon occurance.

Please proceed with all of your samples, following the recommendations in the instructions below.

Temperature	Time
37°C	10 minutes
80°C	1 minute
10°C	Hold

For example: if 10 barcodes were used, take forward 80 ng of each sample.

Note: In cases where the concentration of your sample PCR product is too low, take forward the maximum available volume.

Ensure you have accurately measured the volume of your pooled samples to maintain the 0.6X ratio of the AMPure XP beads (AXP).

Remove and retain the eluate which contains the DNA library in a clean 1.5 ml Eppendorf DNA LoBind tube
Dispose of the pelleted beads

MEDIDA OPCIONAL

Quantify 1 µl of eluted sample using a Qubit fluorometer and the Qubit dsDNA HS Assay Kit.

Expected yield of 10-40 ng/µl.

Reactivo	Volumen
Rapid Adapter (RA)	1,5 μl
Adapter Buffer (ADB)	3,5 μl
Total	5 μl

FIN DEL PROCESO

The prepared library is used for loading into the flow cell. Store the library on ice or at 4°C until ready to load.

6. Priming and loading the MinION and GridION Flow Cell

Material

Flow Cell Flush (FCF)
Flow Cell Tether (FCT)
Library Beads (LIB)
Sequencing Buffer (SB)

Consumibles

Celda de flujo MinION/GridION
Seroalbúmina bovina (BSA) (50 mg/ml) (p. ej., Invitrogen™ UltraPure™ BSA 50 mg/ml, AM2616)
Tubos de 1,5 ml Eppendorf DNA LoBind

Instrumental

Dispositivo MinION o GridION
Pantalla protectora de celdas de flujo MinION/GridION
Pipeta y puntas P1000
Pipeta y puntas P100
Pipeta y puntas P20
Pipeta y puntas P10

IMPORTANTE

Nótese, este kit es compatible solo con las celdas de flujo R10.4.1 (FLO-MIN114).

CONSEJO

Acondicionar y cargar la celda de flujo

Recomendamos a los usuarios que miren el vídeo Priming and loading your flow cell antes de realizar su primer experimento.

IMPORTANTE

Para obtener un rendimiento de secuenciación óptimo y mejorar el rendimiento de las celdas de flujo MinION R10.4.1 (FLO-MIN114), recomendamos añadir seroalbúmina bovina (BSA) en una concentración total de 0,2 mg/ml, a la mezcla de preparación de la celda de flujo.

Nota: No recomendamos utilizar ningún otro tipo de albúmina (p. ej., seroalbúmina humana recombinante).

Reactivos	Volumen por celda de flujo
Flow Cell Flush (FCF)	1,170 µl
Seroalbúmina bovina (BSA) a 50 mg/ml	5 µl
Flow Cell Tether (FCT)	30 µl
Volumen total	1,205 µl

MEDIDA OPCIONAL

Antes de cargar la biblioteca, verificar la celda de flujo para determinar el número de poros disponible.

Si se ha verificado la celda de flujo con anterioridad, este paso se puede omitir.

Dispone de más información en las instrucciones de comprobación de la celda de flujo, del protocolo de MinKNOW.

IMPORTANTE

Tenga cuidado a la hora de extraer solución amortiguadora de la celda de flujo. No retire más de 20-30 μl y asegúrese de que la solución cubra la matriz de poros en todo momento. La introducción de burbujas de aire en la matriz puede dañar los poros de manera irreversible.

Ajustar una pipeta P1000 a 200 μl.
Introducir la punta de la pipeta en el puerto de purgado.
Girar la rueda hasta que el indicador de volumen marque 220-230 μl o hasta que se pueda ver una pequeña cantidad de solución amortiguadora entrar en la punta de la pipeta.

Nota: Comprobar que haya un flujo continuo de solución amortiguadora circulando desde el puerto de purgado a través de la matriz de poros.

IMPORTANTE

El vial Library Beads (LIB) contiene microesferas en suspensión. Las microesferas sedimentan muy rápido; por eso, es fundamental mezclarlas justo antes de usar.

En la mayoría de experimentos de secuenciación recomendamos utilizar Library Beads (LIB). El reactivo Library Solution (LIS) está disponible en caso de utilizar bibliotecas más viscosas.

Reactivo	Volumen por celda de flujo
Sequencing Buffer (SB)	37,5 µl
Library Beads (LIB) mezcladas justo antes de usar, o Library Solution (LIS), si se requiere	25,5 µl
Biblioteca de ADN	12 µl
Total	75 µl

Levantar con suavidad la tapa del puerto de carga SpotON.
Cargar 200 µl de mezcla de acondicionamiento en el puerto de purgado (no en el puerto SpotON), evitando introducir burbujas de aire.

IMPORTANTE

Para obtener resultados de secuenciación óptimos, coloque la pantalla protectora sobre la celda de flujo justo después de cargar la biblioteca.

Recomendamos colocar la pantalla protectora en la celda de flujo y dejarla puesta mientras la biblioteca esté cargada, incluyendo los lavados y pasos de recarga. Retirar la pantalla cuando se haya extraído la biblioteca de la celda de flujo.

Colocar con cuidado el borde delantero de la pantalla protectora contra el clip. Nota: No hacer fuerza sobre ella.
Posar la pantalla protectora sobre la celda de flujo. La pieza debe asentarse alrededor de la tapa SpotON y cubrir por completo la sección superior de la celda de flujo.

ATENCIÓN

La pantalla protectora no está fijada a la celda de flujo. Una vez colocada, es necesario manipular la celda de flujo con cuidado.

FIN DEL PROCESO

Cerrar la tapa del dispositivo y configurar un experimento de secuenciación en MinKNOW.

7. Data acquisition and basecalling

IMPORTANTE

We do not recommend sequencing and performing data analysis simultaneously on your device.

To ensure the compute on your device can keep up with the requirements for sequencing and/or analysis, we strongly recommend against running both processes at the same time.

Ensure your sequencing run has completed before setting off data analysis. Data analysis will be performed post-sequencing.

Equally, we do not recommend starting a sequencing run if you are currently performing data analysis on your device.

How to start sequencing

The sequencing device control, data acquisition and real-time basecalling are carried out by the MinKNOW software. Please ensure MinKNOW is installed on your computer or device. Further instructions for setting up a sequencing run can be found in the MinKNOW protocol.

We recommend setting up your sequencing run using the basecalling and barcoding recommendations outlined below. All other parameters can be left to their default settings.

MinKNOW settings for rapid metagenomic sequencing

For fastest turnaround time and easiest analysis, basecalling should be performed live during the sequencing run using the High Accuracy (HAC) basecaller.

Below are the recommendations for MinKNOW settings:

Positions

Flow cell position: [user defined]

Experiment name: [user defined]

Flow cell type: FLO-MIN114

Sample ID: [user defined]

Kit

Kit selection: Rapid PCR Barcoding Kit (SQK-RPB114.24)

Run configuration

Sequencing and analysis

Basecalling: On [default]
Modified bases: Off
Model: High-accuracy basecalling (HAC) [default]

Barcoding: On [default]
Trim barcodes: Off [default]
Barcode both ends: Off [default]
Custom barcodes selection: Off [default]

Alignment: Off [default]

Adaptive sampling: Off [default]

Advanced options
Active channel selection: On [default]
Time between pore scans: 1.5 [default]
Reserve pores: On [default]

Data targets

Run limit: [user defined]*

*Sequencing time will depend on data requirements. For rapid information, data can be analysed after as little as 30 minutes of sequencing. Or to maximise data generation, you can sequence for up to 72 hours.

Output

Output format
.POD5: On [default]
.FASTQ: On [default]
.BAM: On

Filtering: On [default]
Qscore: 9 [default]
Minimum read length: 200 bp [default]

8. Downstream analysis

IMPORTANTE

We do not recommend sequencing and performing data analysis simultaneously on your device.

To ensure the compute on your device can keep up with the requirements for sequencing and/or analysis, we strongly recommend against running both processes at the same time.

Ensure your sequencing run has completed before setting off data analysis. Data analysis will be performed post-sequencing.

Equally, we do not recommend starting a sequencing run if you are currently performing data analysis on your device.

Post-basecalling analysis

We recommend performing downstream analysis using EPI2ME which facilitates bioinformatic analyses by allowing users to run Nextflow workflows in a desktop application. EPI2ME maintains a collection of bioinformatic workflows which are curated and actively maintained by experts in long-read sequence analysis.

Follow the instructions in the EPI2ME Installation guide to install the application on your device. For more information on how to use EPI2ME, refer to the EPI2ME Quick Start guide.

Your basecalled data generated by the sequencing software can be easily analysed using the wf-metagenomics workflow, a bioinformatic pipeline written in NextfFlow. This workflow provides identification and abundance estimation of taxa present in your sample.

Using the recommended database, human, fungal, bacterial, viral, archaea and protozoal sequences can be accurately identified using the workflow.

We recommend you always use the latest available version of the workflow. Further information about the usage and results provided by the workflow can be found in the wf-metagenomics EPI2ME documentation page.

Note: You can also run this workflow through command line. However, we only recommend this option for experienced users. For more information and the latest version of the workflow, please visit the wf-metagenomics page on GitHub. If using the workflow through commandline, the settings recommend for optimal workflow performance for this protocol are: --kraken2_confidence 0.01 --database_set PlusPF-8 --store_dir /path/to/database/download/directory/

*/path/to/database/download/directory/ is a placeholder, the exact location used will depend on the user system.

MEDIDA OPCIONAL

Test data is available on Github to test the wf-metagenomics workflow.

The test data can be found in the following repository: wf-metagenomics test data.

Running wf-metagenomics with EPI2ME

Within the EPI2ME app, new workflows can be installed by selecting the appropriate workflow under the "Available Workflows" tab in the Workflows section.

Already installed workflows can be found under the "Installed" tab.

You can test your installation using a small test dataset that is provided with the workflow:

1. Launch the EPI2ME app

2. Select View workflows

3. Select the wf-metagenomics workflow

4. Select Use demo data

5. Launch the workflow

6. Once the run has completed, results can be viewed under the "Report" tab. The workflow outputs an interactive html report.

Running the workflow

To run wf-metagenomics with the settings recommended for the dual arm metagenomics protocol:

1. Launch the EPI2ME app

2. Select View workflows

3. Select the wf-metagenomics workflow

4. Select Run this workflow.

5. Choose local or cloud option (if available).

6. In "Input Options", specify the input data for the workflow (either FASTQ or BAM).

7. In "Sample Options", provide a sample sheet in comma-separated values (csv) format.
We suggest you provide an alias for each barcode that describes both the sample and prep type (e.g. sample_A_viral, sample_A_bacterial).

8. In "Reference Options", choose PlusPF-8 database to ensure archaea, bacterial, viral, human, and fungal taxa can be identified by the workflow.

9. In "Kraken2 Options", set Confidence score threshold to 0.01

10. Click Launch workflow

11. Once the run has completed, results can be viewed under the "Report" tab. The workflow outputs an interactive html report.

Note: All options not specified should be left to their default values.

Optional: If you need to adjust the computational resource available to your workflow, you can change local CPU and memory allocation in the workflow setup.

9. Reutilización y devolución de celdas de flujo

Material

Flow Cell Wash Kit (EXP-WSH004)

El protocolo Flow Cell Wash Kit está disponible en la comunidad Nanopore.

CONSEJO

Una vez terminado el experimento, recomendamos lavar la celda de flujo cuanto antes. Si no es posible, se puede dejar en el dispositivo y lavar al día siguiente.

Aquí están las instrucciones para devolver celdas de flujo.

IMPORTANTE

Ante cualquier duda o pregunta acerca del experimento de secuenciación, consulte la guía de resolución de problemas, Troubleshooting Guide, que se encuentra en la versión en línea de este protocolo.

10. Problemas durante la extracción de ADN/ARN y la preparación de bibliotecas

A continuación hay una lista de los problemas más frecuentes, con algunas posibles causas y soluciones propuestas.

También disponemos de una página de preguntas frecuentes, FAQ, en la sección Support de la comunidad Nanopore.

Si ha probado las soluciones propuestas y continúa teniendo problemas, póngase en contacto con el departamento de asistencia técnica, bien por correo electrónico (support@nanoporetech.com) o a través del chat Live Support de la comunidad Nanopore.

Baja calidad de la muestra

Observaciones	Posibles causas	Comentarios y acciones recomendadas
Baja pureza del ADN (la lectura del Nanodrop para ADN OD 260/280 es <1,8 y OD 260/230 es <2,0-2,2)	El método de extracción de ADN no proporciona la pureza necesaria	Los efectos de los contaminantes se muestran en la página Contaminants. Probar con un método de extracción alternativo que no provoque el arrastre de contaminantes. Considere realizar un paso adicional de limpieza SPRI.
Baja integridad del ARN (número de integridad del ARN <9,5 RIN o la banda ARNr se muestra como una mancha en el gel).	El ARN se degradó durante la extracción	Probar un método de extracción de ARN diferente. Encontrará más información sobre el tema en la página RNA Integrity Number. Asimismo, dispone de información adicional en la página DNA/RNA Handling.
El ARN tiene una longitud de fragmento más corta de lo esperado	El ARN se degradó durante la extracción	Probar un método de extracción de ARN diferente. Encontrará más información sobre RIN en la página RNA Integrity Number. Asimismo, dispone de información adicional en la página DNA/RNA Handling. Al trabajar con ARN, recomendamos que el espacio de trabajo y el instrumental de laboratorio estén libres de ribonucleasas.

Escasa recuperación de ADN tras la limpieza con microesferas magnéticas AMPure

Observación	Posible causa	Comentarios y acciones recomendadas
Escasa recuperación	Pérdida de ADN debido a una proporción de microesferas magnéticas AMPure por muestra inferior a lo previsto.	1. Las microesferas magnéticas AMPure precipitan con rapidez; antes de añadirlas a la muestra hay que asegurarse de que estén bien resuspendidas. 2. Si la proporción de microesferas por muestra es inferior a 0.4:1, los fragmentos de ADN, sean del tamaño que sean, se perderán durante la limpieza.
Escasa recuperación	Los fragmentos de ADN son más cortos de lo esperado	Cuanto menor sea la proporción de microesferas magnéticas AMPure por muestra, más rigurosa será la selección de fragmentos largos frente a los cortos. Determinar siempre la longitud de la muestra de ADN en un gel de agarosa u otros métodos de electroforesis en gel, y, a continuación, calcular la cantidad adecuada de microesferas magnéticas que se debe utilizar.
Escasa recuperación tras la preparación de extremos	El paso de lavado utilizó etanol a <70 %	Cuando se utilice etanol a <70 %, el ADN se eluirá de las microesferas magnéticas. Asegúrese de utilizar el porcentaje correcto.

11. Problemas durante el experimento al utilizar un kit de secuenciación de base rápida

A continuación hay una lista de los problemas más frecuentes, con algunas posibles causas y soluciones propuestas.

También disponemos de una página de preguntas frecuentes, FAQ, en la sección Support de la comunidad Nanopore.

Menos poros al inicio de la secuenciación que tras verificar la celda de flujo

Observaciones	Posibles causas	Comentarios y acciones recomendadas
MinKNOW presentó al inicio de la secuenciación un número de poros inferior al indicado durante la comprobación de la celda de flujo	Se introdujo una burbuja de aire en la matriz de nanoporos	Tras comprobar el número de poros presente en la celda de flujo, y antes de acondicionarla, es imprescindible quitar las burbujas que haya cerca del puerto de purgado. Si no se quitan, pueden desplazarse a la matriz de nanoporos y dañar de manera irreversible los nanoporos expuestos al aire. En este vídeo se muestran algunas buenas prácticas para evitar que esto ocurra.
MinKNOW presentó al inicio de la secuenciación un número de poros inferior al indicado durante la comprobación de la celda de flujo	La celda de flujo no está colocada correctamente	Detener el ciclo de secuenciación, quitar la celda de flujo del dispositivo e insertarla de nuevo. Comprobar que está firmemente asentada en el dispositivo y que ha alcanzado la temperatura deseada. Si procede, probar con una posición diferente del dispositivo (GriION/PromethION).
MinKNOW presentó al inicio de la secuenciación un número de poros inferior al indicado durante la comprobación de la celda de flujo	La presencia de contaminantes en la biblioteca podría haber dañado o bloqueado los poros	El número de poros resultante tras la evaluación de la celda de flujo se realiza usando el control de calidad de las moléculas de ADN presentes en el tampón de almacenamiento de la celda de flujo. Al inicio de la secuenciación, se utiliza la misma biblioteca para estimar el número de poros activos. Por este motivo, se estima que puede haber una variabilidad del 10 % en el número de poros detectados. Tener un número de poros considerablemente inferior al inicio de la secuenciación podría deberse a la presencia de contaminantes en la biblioteca que hayan dañado las membranas o bloqueado los poros. Para mejorar la pureza del material de entrada tal vez sea necesario usar métodos de purificación o extracción de ADN/ARN alternativos. Los efectos de los contaminantes están descritos en la página Contaminants. Se recomienda, probar con un método de extracción alternativo que no provoque el arrastre de contaminantes.

Error en el script de MinKNOW

Observaciones	Posibles causas	Comentarios y acciones recomendadas
MinKNOW muestra el mensaje "Error en el script"		Reiniciar el ordenador y reiniciar MinKNOW. Si el problema continúa, reúna los archivos de registro MinKNOW log files y contacte con el servicio de asistencia técnica. Si no dispone de otro dispositivo de secuenciación, recomendamos que guarde la celda de flujo cargada a 4 °C y contacte con el servicio de asistencia técnica para recibir instrucciones de almacenamiento adicionales.

Ocupación de poro por debajo del 40 %

Observación	Posible causa	Comentarios y acciones recomendadas
Ocupación de poro <40 %	No se cargó suficiente cantidad de biblioteca en la celda de flujo	Procurar cargar la concentración correcta de una biblioteca de buena calidad en una celda de flujo MinION o GridION. Para comprobar la concentración requerida, consultar la sección Preparación de la biblioteca del protocolo. Cuantificar la biblioteca antes de cargarla y calcular moles con herramientas como la calculadora Biomath de Promega, (opción "dsDNA: μg to pmol").
Ocupación de poro próxima a 0	Se utilizó el kit Rapid Sequencing Kit V14 o Rapid Barcoding Kit V14 y los adaptadores de secuenciación no se ligaron al ADN	Seguir el protocolo paso a paso y utilizar los volúmenes y las temperaturas de incubación correctos. También se puede preparar una biblioteca de control con lambda para valorar la integridad de los reactivos.
Pore occupancy close to 0	No hay anclaje (tether) en la celda de flujo	Los anclajes se añaden durante el cebado de la celda de flujo (vial FCT). No olvide añadir el anclaje (vial FCT) al tubo de enjuague de la celda de flujo (vial FCF) antes del cebado.

Longitud de lectura más corta de lo esperado

Observaciones	Posibles causas	Comentarios y acciones recomendadas
Longitud de lectura más corta de lo esperado	Fragmentación no deseada de la muestra de ADN	La longitud de lectura refleja la longitud del fragmento de la muestra de ADN. La muestra de ADN se puede fragmentar durante la extracción y preparación de la biblioteca. 1. Consulte la sección de buenas prácticas de extracción en la página Extraction Methods de la comunidad Nanopore. 2. Visualizar la distribución de la longitud de los fragmentos de las muestras de ADN en un gel de agarosa antes de proceder a la preparación de la biblioteca. En la imagen superior, la muestra 1 contiene alto peso molecular, mientras que la muestra 2 se ha fragmentado. 3. Durante la preparación de la biblioteca, evitar pipetear y agitar en vórtex cuando se mezclen los reactivos. Dar suaves golpes con el dedo o invertir el vial es suficiente.

Gran proporción de poros no disponibles

Observaciones	Posibles causas	Comentarios y acciones recomendadas
Gran proporción de poros no disponibles (se muestran en azul en el panel de canales y en el gráfico de actividad de poros) Conforme pasa el tiempo, el gráfico de actividad de poros de arriba muestra una proporción creciente de poros "no disponibles".	Hay contaminantes presentes en la muestra	Algunos contaminantes se pueden eliminar de los poros mediante la función de desbloqueo incorporada en MinKNOW. Si funciona, el estado de los poros cambiará a "sequencing pores". Si la porción poros no disponibles se mantiene elevada o aumenta: 1. Realizar un purgado de nucleasa con el kit de lavado Flow Cell Wash Kit (EXP-WSH004) 2. Realizar varios ciclos de PCR para intentar diluir cualquier contaminante que pueda estar causando problemas.

Gran proporción de poros inactivos

Observaciones	Posibles causas	Comentarios y acciones recomendadas
Gran proporción de poros inactivos/no disponibles (se muestran en azul claro en el panel de canales y en el gráfico de actividad de poros. Los poros o membranas están dañados de manera irreversible)	Se han introducido burbujas de aire en la celda de flujo	Las burbujas de aire introducidas durante el acondicionamiento de la celda y carga de la biblioteca podrían dañar los poros de forma permanente. Para conocer las buenas prácticas de acondicionamiento y carga de la celda de flujo, ver el vídeo Priming and loading your flow cell
Gran proporción de poros inactivos/no disponibles	Ciertos compuestos copurificados con ADN	Compuestos conocidos, incluidos los polisacáridos, se asocian generalmente con el ADN genómico de las plantas. 1. Consulte los métodos de extracción de ADN en la página Plant leaf DNA extraction method. 2. Purificar con el kit QIAGEN PowerClean Pro. 3. Realizar una amplificación del genoma completo con la muestra original de ADNg utilizando el kit QIAGEN REPLI-g.
Gran proporción de poros inactivos/no disponibles	Hay contaminantes presentes en la muestra	Los efectos de los contaminantes se muestran en la página Contaminants. Probar con un método de extracción alternativo que no provoque el arrastre de contaminantes.

Fluctuación de la temperatura

Observaciones	Posibles causas	Comentarios y acciones recomendadas
Fluctuación de la temperatura	La celda de flujo ha perdido contacto con el dispositivo	Comprobar que una almohadilla térmica cubra la placa metálica de la parte posterior de la celda de flujo. Reinsertar la celda de flujo y presionar para asegurarse de que las clavijas del conector estén bien conectadas al dispositivo. Si el problema continúa, contacte con el servicio de asistencia técnica.

Error al intentar alcanzar la temperatura deseada

Observaciones	Posibles causas	Comentarios y acciones recomendadas
MinKNOW muestra el mensaje "Error al intentar alcanzar la temperatura deseada"	El dispositivo ha sido colocado en un lugar con una temperatura ambiente inferior a la media o en un lugar con escasa ventilación (lo que provoca el sobrecalientamiento de las celdas de flujo).	MinKNOW dispone de un tiempo predeterminado para que las celdas de flujo alcancen la temperatura fijada. Una vez transcurrido ese tiempo, aparece un mensaje de error, pero el experimento de secuenciación continúa. Secuenciar a una temperatura incorrecta puede provocar disminuciones en el rendimiento y generar índices de calidad Qscore menores. Corrija la ubicación del dispositivo, procurando que esté a temperatura ambiente y tenga buena ventilación; a continuación, reinicie el proceso en MinKNOW. Encontrará más información sobre el control de temperatura del MinION en este enlace.

Device:

London Calling 2025

Explore products

Documentation

Nanopore Learning

Rapid metagenomic sequencing for surveillance of bacterial, fungal and viral pathogens using SQK-RPB114.24

Introduction to the protocol

Sample preparation

Library preparation

Sequencing and data analysis

Resolución de problemas

Document versions

MinION: Protocol

Rapid metagenomic sequencing for surveillance of bacterial, fungal and viral pathogens using SQK-RPB114.24 V RMS_9215_v114_revA_11Dec2024

Contents

Introduction to the protocol

Sample preparation

Library preparation

Sequencing and data analysis

Resolución de problemas

Descripción general

1. Overview of protocol

Introduction to the rapid metagenomic sequencing protocol

Steps in the sequencing workflow:

IMPORTANTE

Compatibility of this protocol

2. Equipment and consumables

Material

Consumibles

Instrumental

Equipo opcional

IMPORTANTE

Ensure pathogenic samples are handled in appropriate biosafety conditions.

For this protocol you will need the following sample input(s):

Cantidad de muestra inicial de ADN (1)

Cómo realizar un control de calidad de la muestra inicial de ADN

Contaminantes químicos

MEDIDA OPCIONAL

Input controls

Reactivos de otros fabricantes

Agencourt AMPure XP beads

CONSEJO

Eppendorf tube orientation in centrifuge

Verificar la celda de flujo

IMPORTANTE

The Rapid Adapter (RA) used in this kit and protocol is not interchangeable with other sequencing adapters.

Rapid PCR Barcoding Kit 24 V14 (SQK-RPB114.24) contents

Rapid barcode primers

3. Host depletion and extraction

Material

Consumibles

Instrumental

Equipo opcional

IMPORTANTE

Ensure you are keeping your bacterial/fungal samples separate from your viral samples.

Ensure you have sufficient sample input. You will need:

MEDIDA OPCIONAL

Input controls

Prepare a working solution of Sputasol in nuclease-free water (1:13.33) as follows:

Prepare a 0.2% saponin-PBS solution:

Prepare the 2X HLSAN Buffer (4.5 M NaCl and 100 mM MgCl2) as follows:

Ensure your thermomixers are set to 37°C and 65°C.

Prepare your sputum, endotracheal (ETT), or any other mucoid sample(s):

For each sample, transfer 500 µl into a separate clean 1.5 ml Eppendorf tube.

Centrifuge for 5 minutes at 10,000 x g.

Carefully remove tubes from centrifuge without disturbing the solution.

CONSEJO

Remember, your sample(s) can be processed for both viral sample preparation and bacterial/fungal sample preparation.

Perform sample preparation side-by-side depending on your sample type:

Transfer all sample tubes to a thermomixer and incubate the reactions at 65°C for 5 minutes at 1,000 rpm.

Transfer the sample tube(s) to a hulamixer and incubate/mix at room temperature for 5 min.

Prepare 2 ml of fresh 80% ethanol per sample in nuclease-free water.

Briefly spin down the tube(s) and pellet on a magnetic rack until supernatant is clear and colourless (for at least 5 minutes). Keep the tube on the magnetic rack, and pipette off the supernatant.

Remove the tube from the magnetic rack and add 1 ml of Wash Buffer from the MagMAX kit. Gently mix by inverting the tube until fully resuspended.

Briefly spin down the tube(s) and pellet on a magnetic rack until supernatant is clear and colourless (for at least 2 minutes). Keep the tube on the magnetic rack, and pipette off the supernatant.

Remove the tube from the magnetic rack and add 1 ml of 80% ethanol. Gently mix by inverting the tube until fully resuspended.

Briefly spin down the tube(s) and pellet on a magnetic rack until supernatant is clear and colourless (for at least 2 minutes). Keep the tube on the magnetic rack, and pipette off the supernatant.

Remove the tube from the magnetic rack and add 500 µl of 80% ethanol. Gently mix by inverting the tube until fully resuspended.

Briefly spin down the tube(s) and pellet on a magnetic rack until supernatant is clear and colourless (for at least 2 minutes). Keep the tube on the magnetic rack, and pipette off the supernatant.

Keeping the tube on the magnetic rack, leave the lid open and allow to dry for ~2 minutes, but do not dry the pellet to the point of cracking.

Remove the tube from the magnetic rack and resuspend the pellet by pipetting in 20 µl of nuclease-free water. Ensure the pellet is fully resuspended by pipette mixing.