Main menu

Direct RNA sequencing - sequence-specific (SQK-RNA004) (DSS_9197_v4_revK_29June2026)


1. Overview of the protocol

Utilice siempre la versión más reciente del protocolo.

MinKNOW 26.01 has updated RNA strand classification rules, resulting in improved sequencing performance and more accurate reporting in the MinKNOW UI and sequencing run reports.

What is changing?

In older versions of MinKNOW (25.09 or earlier), blocked pores - particularly common in "blocky" samples - could be misclassified as active strands, resulting in:

  • Reduced Q-scores over the course of a run.
  • Pore scans incorrectly reporting high pore occupancy later in the sequencing run.
  • Blocked pores not being efficiently ejected, limiting sequencing output.

The release of MinKNOW 26.01 corrects this behaviour by accurately classifying blocked pores.

How does this impact me?

  • Pore scans will more accurately reflect true pore availability.
  • Blocked pores will be ejected more effectively.
  • Sequencing performance may improve in some runs.

The improvements listed above will impact all sequencing runs, but will be especially noticeable on "blocky" samples. Users sequencing "non-blocky" samples will likely notice minimal or no noticeable change.

Please note: you may observe a decrease in the reported pore occupancy in the MinKNOW UI and MinKNOW reports. We emphasise that this is a measurement correction, with no performance regression.


Additional information for the MinKNOW 26.01 update can be found in the release notes:

Please ensure you always use the most recent version of the protocol.

Direct RNA Sequencing Kit features

This kit is highly recommended for:

  • Exploring attributes of native RNA, such as modified bases
  • Removing RT or PCR bias
  • Transcripts that are difficult to reverse transcribe

Introduction to the sequence-specific Direct RNA Sequencing protocol

This protocol describes how to carry out sequence-specific sequencing of native RNA using the Direct RNA Sequencing Kit (SQK-RNA004). Starting from total RNA, a second complementary cDNA strand is synthesised for stability by reverse transcription and with a custom-made sequence for a targeted reverse transcription adapter. Sequencing adapters are then attached to the RNA-cDNA hybrid for sequencing on either MinION™/GridION™ or PromethION™ Flow Cells RNA (FLO-MIN004RA or FLO-PRO004RA respectively). Please note, the complementary cDNA strand is not sequenced, but improves the RNA sequencing output.

This protocol is only designed for sequencing specific RNA (e.g. 16S rRNA) and cannot target specific mRNA of interest. To proceed with this protocol, you will need to order custom-made oligos, including one that is complementary to the 3' end of the target RNA sequence. These oligos will replace the Reverse Transcription Adapter (RTA) normally used for Direct RNA sequencing. For further information on how to design the RTA sequence, please refer to 'Designing oligos for a targeted reverse transcription adapter ' under the Equipment and Consumables section.

The Table below shows the required oligo sequences, with the RNA 3' end-specific sequences in parenthesis:

Oligo A: 5’- /5PHOS/GGCTTCTTCTTGCTCTTAGGTAGTAGGTTC
Oligo B: 5’-GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGAAGAAGCC(TTTTTTTTTT)

We recommend a control experiment using the RNA Control Strand (RCS) is completed first to become familiar with the technology.

Steps in the sequencing workflow:

Prepare for your experiment

You will need to:

  • Extract your RNA, and check its length, quantity and purity. The quality checks performed during the protocol are essential in ensuring experimental success.
  • Ensure you have your sequencing kit, the correct equipment and third-party reagents.
  • Download the software for acquiring and analysing your data.
  • Check your flow cell(s) to ensure it has sufficient pores for a good sequencing run.

Library preparation

The Table below is an overview of the steps required in the library preparation, including timings and stopping points.

Library preparation Process Time Stop option
Reverse transcription Synthesise the complementary strand of the RNA with your custom-ordered adapter ~85 minutes At this stage the RT-RNA can be stored at -80°C for later use.

Please note, this is the only pause point in this protocol.
Adapter ligation and clean-up Attach the sequencing adapters to the RNA-cDNA hybrid ends 45 minutes We strongly recommend sequencing your library as soon as it is adapted.
Priming and loading the flow cell Prime the flow cell and load the prepared library for sequencing 10 minutes

direct-rna-sequencing-sequence-specific-workflow

Sequencing and analysis

You will need to:

  • Start a sequencing run using the MinKNOW™ software, which will collect raw data from the device and basecall the reads.

Unlike DNA, RNA is translocated through the nanopore in the 3'-5' direction. However, the basecalling algorithms automatically flip the data, and the reads are displayed 5'-3'.

Compatibility of this protocol

This protocol should only be used in combination with:

  • Direct RNA Sequencing Kit (SQK-RNA004)
  • MinION/GridION Flow Cell RNA (FLO-MIN004RA)
  • Flow Cell Wash Kit (EXP-WSH004) - This Wash Kit is compatible for removing library between washes but will not remove RNA-related blocking of nanopores.
  • MinION™ Mk1D - MinION Mk1D IT requirements
  • GridION™ - GridION IT requirements

2. Equipment and consumables

Material
  • 1 µg of total RNA in 8.5 µl
  • Custom-made oligos for a targeted reverse transcription adapter
  • Direct RNA Sequencing Kit (SQK-RNA004)

Consumibles
  • Celdas de flujo ARN MinION/GridION (FLO-MIN004RA) o celdas de flujo ARN PromethION (FLO-PRO004RA)
  • Módulo complementario NEBNext® Companion Module for Oxford Nanopore Technologies® Direct RNA Sequencing (E3440)
  • Agencourt RNAClean XP beads (Beckman Coulter®, A63987)
  • Etanol al 70 % recién preparado en agua sin nucleasas
  • Tubos de PCR de pared fina, 0,2 ml
  • Tubos Eppendorf DNA LoBind de 1,5 ml
  • Kit Qubit RNA HS Assay (ThermoFisher, Q32852)
  • Kit Qubit 1x dsDNA HS (ThermoFisher, Q33230)
  • Tubos Qubit™ Assay (Invitrogen, Q32856)

Instrumental
  • Dispositivos MinION, GridION o PromethION
  • Pantalla protectora celdas de flujo MinION/GridION o pantalla protectora celdas de flujo PromethION
  • Mezclador vórtex
  • Microcentrífuga
  • Termociclador
  • Hula mixer (mezclador de rotación suave)
  • Gradilla magnética, adecuada para tubos Eppendorf de 1,5 ml
  • Cubeta con hielo
  • Temporizador
  • Fluorímetro Qubit™ (o equivalente)
  • Pipeta y puntas P1000
  • Pipeta y puntas P200
  • Pipeta y puntas P100
  • Pipeta y puntas P20
  • Pipeta y puntas P10
  • Pipeta y puntas P2
  • Centrifugadora Eppendorf 5424 (o equivalente)

For this protocol, you will need 1 µg of total RNA in 8.5 µl.

Input RNA

It is important that the input RNA meets the quantity and quality requirements. Using too little or too much RNA, or RNA of poor quality (e.g. fragmented or containing chemical contaminants) can affect your library preparation.

For instructions on how to perform quality control of your RNA sample, please read the Input DNA/RNA QC protocol.

For further information on using RNA as input, please read the links below.

These documents can also be found in the DNA/RNA Handling page.

NEBNext® Companion Module for Oxford Nanopore Technologies® Direct RNA Sequencing

We recommend buying the NEBNext® Companion Module for Oxford Nanopore Technologies® Direct RNA Sequencing (NEB, E3440S), which contains all the NEB reagents needed for use with the Direct RNA Sequencing Kit.

The reagentes contained in the companion module are also available to purchase separately through NEB.

Designing oligos for a targeted reverse transcription adapter

The Reverse Transcription Adapter (RTA) supplied in the Direct RNA Sequencing Kit is designed to ligate to any RNA with a poly(A) tail. However, a custom RTA can be designed to target a specific RNA via the 3' end (for example, to only ligate to 16S rRNA). It is important to note that custom RTA can only target the 3’ end of RNA and cannot be used to enrich specific RNA with a poly(A) tail, see the Figure below for more details.

RNA004 sequence specific ligation cartoon

To perform this protocol, you will need to order oligo A and a specific version of oligo B. In oligo B, you will need to replace the 10(T) sequence with 10 bases complementary to the 3' end of your target RNA sequence. Both oligo A and oligo B are DNA.

Anneal oligo A and oligo B using a 1:1 ratio in 1.4 µM buffer (10 mM Tris-HCl, 50 mM NaCl, pH 7.5) by heating to 95º C for 2 minutes and letting the oligos cool down slowly (0.1º C/sec). This will function as the custom RTA to target a specific RNA.

Custom RTA

Sequences:
Oligo A: 5’- /5PHOS/GGCTTCTTCTTGCTCTTAGGTAGTAGGTTC
Oligo B: 5’-GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGAAGAAGCC(TTTTTTTTTT)

Replace the 10(T) sequence with 10 bases complementary to the 3' end of your target RNA sequence. All oligos should be HPLC purified.

Third-party reagents

We have validated and recommend the use of all the third-party reagents used in this protocol. Alternatives have not been tested by Oxford Nanopore Technologies.

For all third-party reagents, we recommend following the manufacturer's instructions to prepare the reagents for use.

Check your flow cell

We highly recommend that you check the number of pores in your flow cell prior to starting a sequencing experiment. This should be done within 12 weeks of purchasing your MinION/GridION or PromethION Fow Cell RNA. Oxford Nanopore Technologies will replace any unused flow cell with fewer than the number of pores listed in the Table below, when the result is reported within two days of performing the flow cell check, and when the storage recommendations have been followed. To do the flow cell check, please follow the instructions in the Flow Cell Check document.

Flow cell Minimum number of active pores covered by warranty
MinION/GridION Flow Cell RNA 800
PromethION Flow Cell RNA 5000

Direct RNA Sequencing Kit (SQK-RNA004) contents:

SQK-RNA004 tubes_25March2026

Name Acronym Cap colour No. of vials Fill volume per vial (μl)
RT Adapter RTA Blue 1 10
RNA Ligation Adapter RLA Green 1 45
RNA CS RCS Yellow 1 25
Wash Buffer WSB Orange 2 1,200
RNA Elution Buffer REB Black 1 300
Library Solution LIS White cap, pink label 1 600
Sequencing Buffer SB Red 1 700
RNA Flush Tether RFT Violet 1 200
Flow Cell Flush FCF White 1 8,000

Note: The RNA CS (RCS) is the control strand and contains the Enolase II from YHR174W, extracted from the yeast Saccharomyces cerevisiae. The reference FASTA files for the yeast is available here.

3. Library preparation

Material
  • 1 µg of total RNA in 8.5 µl
  • Custom-made, targeted reverse transcription adapter
  • Wash Buffer (WSB)
  • RNA Ligation Adapter (RLA)
  • RNA Elution Buffer (REB)

Consumibles
  • Agencourt RNAClean XP beads (Beckman Coulter®, A63987)
  • Induro® Reverse Transcriptase y 5× Induro® RT Reaction Buffer (incluidos en el NEBNext® Companion Module (NEB, E3440S))
  • Solución de dNTPs 10 mM (incluido en NEBNext® Companion Module (NEB, E3440S))
  • NEBNext® Quick Ligation Reaction Buffer (incluido en el NEBNext® Companion Module (NEB, E3440S))
  • T4 DNA Ligase (2M U/ml) (incluido en el NEBNext® Companion Module (NEB, E3440S))
  • Murine RNase Inhibitor (incluido en el NEBNext® Companion Module (NEB, E3440S))
  • Agua sin nucleasas (incluida en el NEBNext® Companion Module (NEB, E3440S))
  • Etanol al 70 % recién preparado en agua sin nucleasas
  • Tubos de PCR de pared fina, 0,2 ml
  • Tubos Eppendorf DNA LoBind de 1,5 ml
  • Kit Qubit RNA HS Assay (ThermoFisher, Q32852)
  • Kit Qubit 1x dsDNA HS (ThermoFisher, Q33230)
  • Tubos Qubit™ Assay (Invitrogen, Q32856)

Instrumental
  • Microcentrífuga
  • Mezclador vórtex
  • Termociclador
  • Hula mixer (mezclador de rotación suave)
  • Gradilla magnética, adecuada para tubos Eppendorf de 1,5 ml
  • Temporizador
  • Cubeta con hielo
  • Pipeta y puntas P1000
  • Pipeta y puntas P200
  • Pipeta y puntas P100
  • Pipeta y puntas P20
  • Pipeta y puntas P10
  • Pipeta y puntas P2
  • Fluorímetro Qubit™ (o equivalente)

Perform a flow cell check

We recommend performing a flow cell check before starting your library preparation to ensure you have a flow cell with sufficient pores for a good sequencing run.

To perform a flow cell check, please follow the instructions in the flow cell check document.

Prepare the NEBNext Quick Ligation Reaction Buffer and T4 DNA Ligase according to the manufacturer's instructions, and place on ice:

  1. Thaw the Quick Ligation Reaction Buffer at room temperature and place the T4 DNA Ligase on ice.

  2. Spin down the reagent tubes for 5 seconds.

  3. Ensure the reagents are fully mixed by performing 10 full volume pipette mixes. Note: Do NOT vortex the T4 DNA Ligase.

The NEBNext Quick Ligation Reaction Buffer may have a little precipitate. Allow the buffer to come to room temperature and pipette the buffer up and down several times to break up the precipitate, followed by vortexing the tube for several seconds to ensure the reagent is thoroughly mixed.

We do not recommend using the Quick T4 Ligase for this protocol. We have found that the T4 DNA Ligase (2M U/ml) works better. It needs to be used in combination with the Quick Ligation Reaction Buffer (NEB B6058).

Spin down the custom-made reverse transcription adapter and RNA Ligation Adapter (RLA), pipette mix and place on ice.

Thaw the Wash Buffer (WSB) and RNA Elution Buffer (REB) at room temperature and mix by vortexing. Then spin down and place on ice.

Prepare the RNA in nuclease-free water:

  • Transfer 1 µg of total RNA into a 0.2 ml thin-walled PCR tube.
  • Adjust the volume to 8.5 μl with nuclease-free water.
  • Mix thoroughly by gently flicking the tube to avoid unwanted shearing.
  • Spin down briefly in a microfuge.

In the same 0.2 ml thin-walled PCR tube, combine the reagents in the following order:

Reagent Volume
RNA 8.5 µl
NEBNext Quick Ligation Reaction Buffer 3 µl
Murine RNase Inhibitor 1 µl
Custom-made reverse transcription adapter 1 µl
T4 DNA Ligase 1.5 µl
Total 15 µl

Mix well by pipetting and spin down.

Incubate the reaction for 10 minutes at room temperature.

In a clean 1.5 ml Eppendorf DNA LoBind tube, combine the following reagents together to prepare the reverse transcription mix:

Reagent Volume
Nuclease-free water 13 µl
10 mM dNTPs 2 µl
5x Induro RT reaction buffer 8 µl
Total 23 µl
  • Mix well by pipetting and spin down.

Transfer the reverse transcription mix to the 0.2 ml PCR tube containing your RT-adapter ligated RNA and mix well by pipetting.

Add 2 µl of Induro Reverse Transcriptase to the reaction and mix well by pipetting.

Place the tube in a thermal cycler and incubate at 60°C for 30 minutes, then 70°C for 10 minutes. Bring the sample to 4°C before proceeding to the next step.

Spin down and transfer the sample to a clean 1.5 ml Eppendorf DNA LoBind tube.

Resuspend the stock of Agencourt RNAClean XP beads by vortexing.

Add 72 µl of resuspended Agencourt RNAClean XP beads to the reverse transcribed reaction and mix well by pipetting.

Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.

Freshly prepare 200 μl of 70% ethanol in nuclease-free water.

Spin down the sample and pellet on a magnetic rack. Keep the tube on the magnetic rack and pipette off the supernatant when clear and colourless.

Keeping the tube on magnetic rack, wash the beads with 150 µl of freshly prepared 70% ethanol, as described below:

  1. Add 150 µl of freshly prepared 70% ethanol to the tube and ensure the beads are pelleted on one side of the tube.
  2. Keeping the magnetic rack on the benchtop, rotate the tube by 180°. Wait for the beads to migrate towards the magnet and to form a pellet.
  3. Rotate the tube 180° again (back to the starting position), and wait for the beads to pellet again.

Carefully remove the 70% ethanol using a pipette and discard.

Spin down and place the tube back on the magnetic rack and wait until the eluate is clear and colourless. Keeping the tube on the magnetic rack, pipette off any residual ethanol.

Remove the tube from the magnetic rack and resuspend the pellet in 23 µl nuclease-free water. Incubate for 5 minutes at room temperature.

Pellet the beads on a magnetic rack until the eluate is clear and colourless.

Remove and retain 23 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.

At this stage the RT-RNA sample can be stored at -80°C for later use.

Please note, this is the only pause point in this protocol.

In the same 1.5 ml Eppendorf DNA LoBind tube, combine the reagents in the following order:

Reagent Volume
RT-RNA sample 23 µl
NEBNext Quick Ligation Reaction Buffer 8 µl
RNA Ligation Adapter (RLA) 6 µl
T4 DNA Ligase 3 µl
Total 40 µl

Mix well by pipetting.

Incubate the reaction for 10 minutes at room temperature.

Resuspend the stock of Agencourt RNAClean XP beads by vortexing.

Add 16 µl of resuspended Agencourt RNAClean XP beads to the reaction and mix well by pipetting.

Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.

Spin down the sample and pellet on the magnetic rack. Keep the tube on the magnetic rack for 5 minutes, then pipette off the supernatant when clear and colourless.

Add 150 μl of the Wash Buffer (WSB) to the beads. Close the tube lid and resuspend the beads by flicking the tube. Return the tube to the magnetic rack, allow the beads to pellet for 5 minutes, then pipette off the supernatant when clear and colourless.

Repeat the previous step.

Agitating the beads results in a more efficient removal of free adapter, compared to adding the wash buffer and immediately aspirating.

Spin down the tube and replace onto the magnetic rack. Wait until the beads have pelleted to pipette off any remaining Wash Buffer (WSB).

Remove the tube from the magnetic rack and resuspend the pellet in 13 µl RNA Elution Buffer (REB) by gently flicking the tube. Incubate for 10 minutes at room temperature.

Spin down and pellet the beads on the magnetic rack for 5 minutes until the eluate is clear and colourless.

Remove and retain 13 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.

Quantify 1 µl of reverse-transcribed and adapted RNA on a Qubit™ fluorometer using the Qubit™ 1x dsDNA HS assay.

The recovery aim in the final eluate is >30 ng.

Recovery quantities can vary between different inputs and library preparations. However, we always recommend taking forward the full volume of RNA library for the best sequencing results.

The reverse-transcribed and adapted RNA is now ready for loading into the flow cell.

The RNA library must be sequenced immediately and cannot be stored for later use.

4. Priming and loading the MinION/GridION Flow Cell

Material
  • Library Solution (LIS)
  • Sequencing Buffer (SB)
  • RNA Flush Tether (RFT)
  • Flow Cell Flush (FCF)

Consumibles
  • MinION/GridION Flow Cell RNA (FLO-MIN004RA)
  • Tubos Eppendorf DNA LoBind de 1,5 ml

Instrumental
  • MinION or GridION device
  • MinION/GridION Flow Cell Light Shield
  • Microcentrífuga
  • Mezclador vórtex
  • Pipeta y puntas P1000
  • Pipeta y puntas P200
  • Pipeta y puntas P100
  • Pipeta y puntas P20

Please note, this kit is only compatible with RNA flow cells (FLO-MIN004RA).

Sacar la celda de flujo de la nevera y dejar a temperatura ambiente durante 20 minutos, mejorará la visibilidad de la matriz durante el acondicionamiento y carga de la muestra.

Priming and loading a flow cell

We recommend all new users watch the 'Priming and loading your flow cell' video before your first run.

Thaw the Sequencing Buffer (SB), Library Solution (LIS), RNA Flush Tether (RFT) and Flow Cell Flush (FCF) at room temperature. Mix by vortexing and spin down where applicable.

To prepare the flow cell priming mix, combine the following reagents in a clean 1.5 ml Eppendorf DNA LoBind tube. Mix by vortexing and spin down

Reagent Volume per flow cell
RNA Flush Tether (RFT) 30 µl
Flow Cell Flush (FCF) 1,170 µl
Total 1,200 µl

Open the MinION or GridION device lid and slide the flow cell under the clip. Press down firmly on the priming port cover to ensure correct thermal and electrical contact.

Flow Cell Loading Diagram Step 1a

Flow Cell Loading Diagrams Step 1b

Complete a flow cell check to assess the number of pores available before loading the library.

This step can be omitted if the flow cell has been checked previously.

See the flow cell check document for more information.

Slide the flow cell priming port cover clockwise to open the priming port.

Flow Cell Loading Diagrams Step 2

Take care when drawing back buffer from the flow cell. Do not remove more than 20-30 µl, and make sure that the array of pores are covered by buffer at all times. Introducing air bubbles into the array can irreversibly damage the pores.

After opening the priming port, check for small air bubbles under the cover. Draw back a small volume to remove any bubbles:

  1. Set a P1000 pipette with a tip to 200 µl.
  2. Insert the tip into the priming port.
  3. Turn the wheel until the dial shows 220-230 µl and draw back 20-30 µl, or until you can see a small volume of buffer entering the pipette tip.

Note: Visually check that there is continuous buffer from the priming port across the sensor array.

Flow Cell Loading Diagrams Step 03 V5

Load 800 µl of the priming mix into the flow cell via the priming port, avoiding the introduction of air bubbles. Wait for five minutes. During this time, prepare the library for loading by following the steps below.

Flow Cell Loading Diagrams Step 04 V5

In a clean 1.5 ml Eppendorf DNA LoBind tube, prepare the library for loading as follows:

Reagent Volume per flow cell
Sequencing Buffer (SB) 37.5 µl
Library Solution (LIS) 25.5 µl
RNA library 12 µl
Total 75 µl

Complete the flow cell priming:

  1. Gently lift the SpotON sample port cover to make the SpotON sample port accessible.
  2. Load 200 µl of the priming mix into the flow cell priming port (not the SpotON sample port), avoiding the introduction of air bubbles.

Flow Cell Loading Diagrams Step 5

Flow Cell Loading Diagrams Step 06 V5

Mix the prepared library gently by pipetting up and down just prior to loading.

Add 75 μl of the prepared library to the flow cell via the SpotON sample port in a dropwise fashion. Ensure each drop flows into the port before adding the next.

Flow Cell Loading Diagrams Step 07 V5

Gently replace the SpotON sample port cover, making sure the bung enters the SpotON port, and gently close the priming port.

Step 8 update

Flow Cell Loading Diagrams Step 9

For optimal sequencing output, install the light shield on your flow cell as soon as the library has been loaded.

We recommend leaving the light shield on the flow cell after the library is loaded, including during any washing and reloading steps. The shield can be removed when the library has been removed from the flow cell.

Place the light shield onto the flow cell, as follows:

  1. Carefully place the leading edge of the light shield against the clip. Note: Do not force the light shield underneath the clip.

  2. Gently lower the light shield onto the flow cell. The light shield should sit around the SpotON cover, covering the entire top section of the flow cell.

J2264 - Light shield animation Flow Cell FAW optimised

The MinION Flow Cell Light Shield is not secured to the flow cell. Therefore, careful handling is required after installation.

Close the device lid and set up a sequencing run on MinKNOW.

When a flow cell is inserted into the MinION Mk1D, the device lid will sit on top of the flow cell, leaving a small gap around the sides. This is normal and has no impact on the performance of the device.

Please refer to this FAQ regarding the device lid.

MinION Mk1D with flow cell

5. Data acquisition and basecalling

How to start sequencing

Once you have loaded your flow cell, the sequencing run can be started on MinKNOW, our sequencing software that controls the device, data acquisition and real-time basecalling. For more detailed information on setting up and using MinKNOW, please see the MinKNOW protocol.

MinKNOW can be used and set up to sequence in multiple ways:

  • On a computer either directly or remotely connected to a sequencing device.
  • Directly on a GridION or PromethION 24/48 sequencing device.

For more information on using MinKNOW on a sequencing device, please see the device user manuals:


To start a sequencing run on MinKNOW:

1. Navigate to the start page and click Start sequencing.

2. Fill in your experiment details, such as name and flow cell position and sample ID.

3. Select the Direct RNA Sequencing Kit (SQK-RNA004) on the Kit selection page.

4. Configure the sequencing and output parameters for your sequencing run or keep to the default settings on the Run configuration tab.

Note: If basecalling was turned off when a sequencing run was set up, basecalling can be performed post-run on MinKNOW. For more information, please see the MinKNOW protocol.

5. Click Start to initiate the sequencing run.

Data analysis after sequencing

After sequencing has completed on MinKNOW, the flow cell can be reused or returned, as outlined in the Flow cell reuse and returns section.

After sequencing and basecalling, the data can be analysed. For further information about options for basecalling and post-basecalling analysis, please refer to the Data Analysis document.

In the Downstream analysis section, we outline further options for analysing your data.

6. Flow cell reuse and returns

Material
  • Flow Cell Wash Kit (EXP-WSH004) o Flow Cell Wash Kit XL (EXP-WSH004-XL)

Our Flow Cell Wash Kit (EXP-WSH004 or EXP-WSH004-XL) is compatible with RNA Flow Cells and the Direct RNA Sequencing Kit (SQK-RNA004).

However, please be aware that:

  • The DNase I present in the wash kit will not help to recover blocked pores in your flow cell following Direct RNA sequencing.
  • Instead, it will wash off most of the library from the array and remove all adapter from the remaining sample, preventing it from being recaptured and sequenced. This will allow a subsequent library to be loaded.

If you would like to reuse the flow cell after your sequencing experiment is complete, please follow the Flow Cell Wash Kit protocol and store the washed flow cell at +2°C to +8°C.

The Flow Cell Wash Kit protocol is available on the Nanopore Community.

We recommend you to wash the flow cell as soon as possible after you stop the run. However, if this is not possible, leave the flow cell on the device and wash it the next day.

Alternatively, follow the returns procedure to send the flow cell back to Oxford Nanopore.

Instructions for returning flow cells can be found here.

If you encounter issues or have questions about your sequencing experiment, please refer to the Troubleshooting Section in this protocol.

7. Downstream analysis

Post-basecalling analysis

There are several options for further analysing your basecalled data:

EPI2ME workflows

For in-depth data analysis, Oxford Nanopore Technologies offers a range of bioinformatics tutorials and workflows available in EPI2ME. The platform provides a vehicle where workflows deposited in GitHub by our Research and Applications teams can be showcased with descriptive texts, functional bioinformatics code and example data.

Research analysis tools

Oxford Nanopore Technologies' Research division has created a number of analysis tools, which are available in the Oxford Nanopore GitHub repository. The tools are aimed at advanced users, and contain instructions for how to install and run the software. They are provided as-is, with minimal support.

Community-developed analysis tools

If a data analysis method for your research question is not provided in any of the resources above, please refer to the resource centre and search for bioinformatics tools for your application. Numerous members of the Nanopore Community have developed their own tools and pipelines for analysing nanopore sequencing data, most of which are available on GitHub. Please be aware that these tools are not supported by Oxford Nanopore Technologies, and are not guaranteed to be compatible with the latest chemistry/software configuration.

8. Issues during RNA extraction and library preparation

Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

We also have an FAQ section available on the Nanopore Community Support section.

If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

Low sample quality

Observation Possible cause Comments and actions
Low RNA integrity (RNA integrity number <9.5 RIN, or the rRNA band is shown as a smear on the gel) The RNA degraded during extraction Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page.
RNA has a shorter than expected fragment length The RNA degraded during extraction Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page.

We recommend working in an RNase-free environment, and to keep your lab equipment RNase-free when working with RNA.

9. Issues during an RNA sequencing run

Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

We also have an FAQ section available on the Nanopore Community Support section.

If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

Fewer pores at the start of sequencing than after Flow Cell Check

Observation Possible cause Comments and actions
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check An air bubble was introduced into the nanopore array After the Flow Cell Check it is essential to remove any air bubbles near the priming port before priming the flow cell. If not removed, the air bubble can travel to the nanopore array and irreversibly damage the nanopores that have been exposed to air. The best practice to prevent this from happening is demonstrated in videos for how to load a MinION Flow Cell and how to load a PromethION Flow Cell.
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check The flow cell is not correctly inserted into the device Stop the sequencing run, remove the flow cell from the sequencing device and insert it again, checking that the flow cell is firmly seated in the device and that it has reached the target temperature. If applicable, try a different position on the device (GridION/PromethION).
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check Contaminations in the library damaged or blocked the pores The pore count during the Flow Cell Check is performed using the QC DNA molecules present in the flow cell storage buffer. At the start of sequencing, the library itself is used to estimate the number of active pores. Because of this, variability of about 10% in the number of pores is expected. A significantly lower pore count reported at the start of sequencing can be due to contaminants in the library that have damaged the membranes or blocked the pores. Alternative RNA extraction or purification methods may be needed to improve the purity of the input material. The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

MinKNOW script failed

Observation Possible cause Comments and actions
MinKNOW shows "Script failed"
Restart the computer and then restart MinKNOW. If the issue persists, please collect the MinKNOW log files and contact Technical Support. If you do not have another sequencing device available, we recommend storing the flow cell and the loaded library at 4°C and contact Technical Support for further storage guidance.

Pore occupancy below 40%

Observation Possible cause Comments and actions
Pore occupancy <40% Not enough library was loaded on the flow cell Ensure you load the recommended amount of good quality library in the relevant library prep protocol onto your flow cell. Please quantify the library before loading and calculate mols using tools like the NEBio Calculator, choosing "RNA ss: mass to moles"
Pore occupancy close to 0 No tether on the flow cell Tethers are adding during flow cell priming (FCT tube). Make sure Flow Cell Tether (FCT) was added to Flow Cell Flush (FCF) before priming.

Large proportion of inactive pores

Observation Possible cause Comments and actions
Large proportion of inactive/unavailable pores (shown as light blue in the channels panel and pore activity plot. Pores or membranes are irreversibly damaged) Air bubbles have been introduced into the flow cell Air bubbles introduced through flow cell priming and library loading can irreversibly damage the pores. Watch the how to load a MinION Flow Cell or how to load a PromethION Flow Cell videos for best practice.
Large proportion of inactive/unavailable pores Contaminants are present in the sample The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

Temperature fluctuation

Observation Possible cause Comments and actions
Temperature fluctuation The flow cell has lost contact with the device Check that there is a heat pad covering the metal plate on the back of the flow cell. Re-insert the flow cell and press it down to make sure the connector pins are firmly in contact with the device. If the problem persists, please contact Technical Services.

Failed to reach target temperature

Observation Possible cause Comments and actions
MinKNOW shows "Failed to reach target temperature" The instrument was placed in a location that is colder than normal room temperature, or a location with poor ventilation (which leads to the flow cells overheating) MinKNOW has a default timeframe for the flow cell to reach the target temperature. Once the timeframe is exceeded, an error message will appear and the sequencing experiment will continue. However, sequencing at an incorrect temperature may lead to a decrease in throughput and lower q-scores. Please adjust the location of the sequencing device to ensure that it is placed at room temperature with good ventilation, then re-start the process in MinKNOW. Please refer to this link for more information on MinION temperature control.
Oxford Nanopore Technologies, the Wheel icon, AmPORE-TB, EPI2ME, GridION, MinION, MinKNOW, PromethION, P2 Solo, and P2 are registered trademarks or the subject of trademark applications of Oxford Nanopore Technologies plc in various countries. Information contained herein may be protected by copyright, patents or patents pending of Oxford Nanopore Technologies plc. All other brands and names contained are the property of their respective owners. Oxford Nanopore Technologies products are RUO. Products labelled/branded as Oxford Nanopore Diagnostics may be RUO or may be regulated as in‐vitro diagnostic devices in some jurisdictions, please check individual product labelling. ONT plc is a member of the producer compliance scheme run by ERP UK Ltd, who manage the submission of documentation in support of WEEE compliance for ONT plc’s manufacture and supply of Electrical and Electronic equipment in the UK. ONT’s WEEE PRN is WEE/MM3828AA.

Last updated: 6/30/2026

Opciones de documento

MinION
Idioma:

Getting started

Buy a MinION starter pack Nanopore store Sequencing service providers Channel partners

Quick links

Intellectual property Cookie policy Corporate reporting Privacy policy Terms, conditions and policies Modern slavery policy Accessibility

About Oxford Nanopore

Contact us News Media resources & contacts Investor centre Careers BSI 27001 accreditationBSI 90001 accreditationBSI mark of trust
Spanish flag