Direct RNA sequencing - sequence-specific (SQK-RNA004)

Oxford Nanopore Technologies
Document type icon

Protocol

Direct RNA sequencing - sequence-specific (SQK-RNA004) VDSS_9197_v4_revB_20Sep2023

This protocol:

  • is for selecting RNA targets of your choice for sequencing native RNA.
  • uses total RNA as starting input material.
  • requires no fragmentation.
  • takes ~2 hours for library preparation.

For Research Use Only

This is an Early Access product.

For more information about our Early Access programmes, please see this article on product release phases.

FOR RESEARCH USE ONLY

Overview

This protocol:

  • is for selecting RNA targets of your choice for sequencing native RNA.
  • uses total RNA as starting input material.
  • requires no fragmentation.
  • takes ~2 hours for library preparation.

For Research Use Only

This is an Early Access product.

For more information about our Early Access programmes, please see this article on product release phases.

Document version: DSS_9197_v4_revB_20Sep2023

1. Overview of the protocol

IMPORTANTE

Este es un producto de acceso anticipado

Para tener más información sobre los programas de acceso anticipado, consulte este artículo sobre las fases de lanzamiento del producto.

Procure usar la versión más reciente del protocolo.

Direct RNA Sequencing Kit features

This kit is highly recommended for users who:

  • are exploring attributes of native RNA such as modified bases.
  • would like to remove RT or PCR bias.
  • have transcripts that are difficult to reverse transcribe.

Introduction to the sequence-specific Direct RNA Sequencing protocol

This protocol describes how to carry out sequence-specific sequencing of native RNA using the Direct RNA Sequencing Kit (SQK-RNA004). Starting from total RNA, a second complementary cDNA strand is synthesised for stability by reverse transcription with a custom-ordered sequence targeted reverse transcription adapter. Sequencing adapters are then attached to the RNA-cDNA hybrid for sequencing on either MinION or PromethION RNA Flow Cells (FLO-MIN004RA / FLO-PRO004RA respectively). Please note, the complementary cDNA strand is not sequenced, but improves the RNA sequencing output.

This protocol is designed for sequencing specific RNA (e.g. 16 rRNA) but cannot target specific mRNA of interest. To proceed with this protocol, you will need to order custom oligos, including one that is complementary to the 3' end of the target RNA sequence. These oligos will replace the Reverse Transcription Adapter (RTA) normally used for direct RNA sequencing. For further information on how to design custom RTA, please see the Equipment and Consumables section. Below are the oligo sequences required, with the RNA 3' end-specific sequences in parenthesis:

Oligo A: 5’- /5PHOS/GGCTTCTTCTTGCTCTTAGGTAGTAGGTTC Oligo B: 5’-GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGAAGAAGCC(TTTTTTTTTT)

We recommend a control experiment using the RNA Control Strand (RCS) is completed first to become familiar with the technology.

Steps in the sequencing workflow:

Prepare for your experiment

You will need to:

  • Extract your RNA, and check its length, quantity and purity. The quality checks performed during the protocol are essential in ensuring experimental success.
  • Ensure you have your sequencing kit, the correct equipment and third-party reagents
  • Download the software for acquiring and analysing your data
  • Check your flow cell(s) to ensure it has enough pores for a good sequencing run

Library preparation

The table below is an overview of the steps required in the library preparation, including timings and stopping points.

Library preparation Process Time Stop option
Reverse transcription Synthesise the complementary strand of the RNA with your custom-ordered adapter ~85 minutes At this stage the RT-RNA can be stored at -80°C for later use.

Please note, this is the only pause point in this protocol.
Adapter ligation and clean-up Attach the sequencing adapters to the RNA-cDNA hybrid ends 45 minutes Attach sequencing adapters to the ends of the RNA-cDNA hybrid.

We strongly recommend sequencing your library as soon as it is adapted.
Priming and loading the flow cell Prime the flow cell and load the prepared library for sequencing 5 minutes

Sequence specific RNA004 workflow resize

Sequencing and analysis

You will need to:

  • Start a sequencing run using the MinKNOW software, which will collect raw data from the device and basecall the reads
IMPORTANTE

Unlike DNA, RNA is translocated through the nanopore in the 3'-5' direction. However, the basecalling algorithms automatically flip the data, and the reads are displayed 5'-3'.

IMPORTANTE

Compatibility of this protocol

This protocol should only be used in combination with:

2. Equipment and consumables

Material
  • 1 µg of total RNA in 8.5 µl
  • Custom-ordered sequence targeted reverse transcription adapter
  • Direct RNA Sequencing Kit (SQK-RNA004)
Consumibles
  • Induro® Reverse Transcriptase (NEB, M0681)
  • 10 mM dNTP solution (e.g. NEB, cat # N0447)
  • NEBNext® Quick Ligation Reaction Buffer (NEB, B6058)
  • T4 DNA Ligase 2M U/ml (NEB, cat # M0202M)
  • Murine RNase Inhibitor (NEB, M0314)
  • Agencourt RNAClean XP beads (Beckman Coulter™, cat # A63987)
  • Agua sin nucleasas (p. ej., ThermoFisher AM9937)
  • Freshly prepared 70% ethanol in nuclease-free water
  • Tubos de PCR de pared fina (0,2 ml)
  • Tubos de 1,5 ml Eppendorf DNA LoBind
  • Qubit RNA HS Assay Kit (ThermoFisher, cat # Q32852)
  • Qubit 1x dsDNA BR Assay Kit (ThermoFisher, cat # Q33265)
  • Tubos de ensayo Qubit™ (Invitrogen Q32856)
Instrumental
  • Mezclador Hula (mezclador giratorio suave)
  • Separador magnético, adecuado para tubos Eppendorf de 1,5 ml
  • Microcentrífuga
  • Mezclador vórtex
  • Cubeta con hielo
  • Temporizador
  • Thermal cycler
  • Qubit fluorometer (or equivalent for QC check)
  • Pipeta y puntas P1000
  • Pipeta y puntas P200
  • Pipeta y puntas P100
  • Pipeta y puntas P20
  • Pipeta y puntas P10
  • Pipeta y puntas P2
  • Eppendorf 5424 centrifuge (or equivalent)

For this protocol, you will need 1 µg of total RNA in 8.5 µl

Input RNA

It is important that the input RNA meets the quantity and quality requirements. Using too little or too much RNA, or RNA of poor quality (e.g. fragmented or containing chemical contaminants) can affect your library preparation.

For instructions on how to perform quality control of your RNA sample, please read the Input DNA/RNA QC protocol.

For further information on using RNA as input, please read the links below.

These documents can also be found in the DNA/RNA Handling page.

Custom-ordered sequence targeted reverse transcription adapter sequence

The Reverse Transcription Adapter (RTA) supplied in the Direct RNA Sequencing kit is designed to ligate to any RNA with a poly(A) tail. However, users can customise their own RTA to target a specific RNA via the 3' end (for example, to only ligate to 16S rRNA). It is important to note that custom RTA can only target the 3’ end of RNA and cannot be used to enriched specific RNA with a poly(A) tail, see the picture below for more details.

RNA004 sequence specific ligation cartoon

To perform this protocol, you will need to order oligo A and a specific version of oligo B. In oligo B you will need to replace the 10(T) sequence with 10 bases complementary to the 3' end of your target RNA sequence. Both oligo A and oligo B are DNA.

Anneal oligo A and oligo B 1:1 at 1.4 µM in buffer (10 mM Tris-HCl pH 7.5, 50 mM NaCl) by heating to 95º C for 2 minutes and letting them cool down slowly (0.1º C/sec). This directly replaces RTA in the protocol.

Custom RTA

Sequences:
Oligo A: 5’- /5PHOS/GGCTTCTTCTTGCTCTTAGGTAGTAGGTTC
Oligo B: 5’-GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGAAGAAGCC(TTTTTTTTTT)

Replace the 10(T) sequence with 10 bases complementary to the 3' end of your target RNA sequence. All oligos should be HPLC purified.

Reactivos de otros fabricantes

Oxford Nanopore Technologies ha probado y recomienda el uso de todos los reactivos de otros fabricantes citados en este protocolo. No se han evaluado otras alternativas.

Se recomienda preparar estos reactivos siguiendo las instrucciones del fabricante.

Verificar la celda de flujo

Antes de empezar el experimento de secuenciación, recomendamos verificar el número de poros disponibles, presentes en la celda de flujo. La comprobación deberá realizarse en los primeros tres meses desde su adquisición, si se trata de celdas de flujo MinION, GridION o PromethION, y en las primeras cuatro semanas tras la compra de celdas de flujo Flongle. Oxford Nanopore Technologies sustituirá cualquier celda de flujo con un número de poros inferior al indicado en la tabla siguiente, siempre y cuando el resultado se notifique dentro de los dos días siguientes a la comprobación y se hayan seguido las instrucciones de almacenamiento. Para verificar la celda de flujo, siga las instrucciones del documento Flow Cell Check.

Celda de flujo Número mínimo de poros activos cubierto por la garantía
Flongle 50
MinION/GridION 800
PromethION 5000

Direct RNA Sequencing Kit (SQK-RNA004) contents:

SQK-RNA004 tubes LH edit

Name Acronym Cap colour No. of vials Fill volume per vial (μl)
RT Adapter RTA Blue 1 10
RNA Ligation Adapter RLA Green 1 45
RNA CS RCS Yellow 1 25
Wash Buffer WSB Orange 2 1,200
RNA Elution Buffer REB Black 1 300
Library Solution LIS White cap, pink label 1 600
Sequencing Buffer SB Red 1 700
RNA Flush Tether RFT Pink 1 200
Flow Cell Flush FCF White 1 8,000

Note: The RNA CS (RCS) is the calibration strand and contains the Enolase II from YHR174W, extracted from the yeast saccharomyces cerevisiae. The reference FASTA files for the yeast is available here.

3. Library preparation

Material
  • 1 µg of total RNA in 8.5 µl
  • Custom-ordered sequence targeted reverse transcription adapter
  • Wash Buffer (WSB)
  • RNA Ligation Adapter (RLA)
  • RNA Elution Buffer (REB)
Consumibles
  • Agencourt RNAClean XP beads (Beckman Coulter™, cat # A63987)
  • Induro Reverse Transcriptase and 5x Induro RT Reaction Buffer (NEB, M0681)
  • 10 mM dNTP solution (e.g. NEB, cat # N0447)
  • NEBNext® Quick Ligation Reaction Buffer (NEB, B6058)
  • T4 DNA Ligase 2M U/ml (NEB, cat # M0202M)
  • Murine RNase Inhibitor (NEB, M0314)
  • Agua sin nucleasas (p. ej., ThermoFisher AM9937)
  • Freshly prepared 70% ethanol in nuclease-free water
  • Tubos de PCR de pared fina (0,2 ml)
  • Tubos de 1,5 ml Eppendorf DNA LoBind
  • Qubit 1x dsDNA HS Assay Kit (ThermoFisher, Q33230)
  • Qubit RNA HS Assay Kit (ThermoFisher, cat # Q32852)
  • Tubos de ensayo Qubit™ (Invitrogen Q32856)
Instrumental
  • Mezclador Hula (mezclador giratorio suave)
  • Thermal cycler
  • Magnetic rack
  • Fluorímetro Qubit (o equivalente para el control de calidad)
  • Ice bucket with ice
  • P1000 pipette and tips
  • P200 pipette and tips
  • P100 pipette and tips
  • P20 pipette and tips
  • Pipeta y puntas P10
  • P2 pipette and tips

Prepare the NEBNext Quick Ligation Reaction Buffer and T4 DNA Ligase according to the manufacturer's instructions, and place on ice:

  1. Thaw the reagents at room temperature.

  2. Spin down the reagent tubes for 5 seconds.

  3. Ensure the reagents are fully mixed by performing 10 full volume pipette mixes. Note: Do NOT vortex the T4 DNA Ligase.

The NEBNext Quick Ligation Reaction Buffer may have a little precipitate. Allow the mixture to come to room temperature and pipette the buffer up and down several times to break up the precipitate, followed by vortexing the tube for several seconds to ensure the reagent is thoroughly mixed.

IMPORTANTE

We do not recommend using the Quick T4 Ligase for this protocol. We have found that the T4 DNA Ligase (2M U/ml - NEB M0202M) works better. It needs to be used in combination with the Quick Ligation Reaction Buffer (NEB B6058).

Spin down the custom-ordered sequence targeted reverse transcription adapter and RNA Ligation Adapter (RLA), pipette mix and place on ice.

Thaw the Wash Buffer (WSB) and RNA Elution Buffer (REB) at room temperature and mix by vortexing. Then spin down and place on ice.

Prepare the RNA in nuclease-free water:

  • Transfer 1 µg of total RNA into a 0.2 ml thin-walled PCR tube.
  • Adjust the volume to 8.5 μl with nuclease-free water.
  • Mix thoroughly by flicking the tube to avoid unwanted shearing.
  • Spin down briefly in a microfuge.

In the same 0.2 ml thin-walled PCR tube, combine the reagents in the following order:

Reagent Volume
RNA 8.5 µl
NEBNext Quick Ligation Reaction Buffer 3 µl
Murine RNase Inhibitor 1 µl
Custom-ordered reverse transcription adapter 1 µl
T4 DNA Ligase 1.5 µl
Total 15 µl

Mix by pipetting and spin down.

Incubate the reaction for 10 minutes at room temperature.

In a clean 1.5 ml DNA LoBind Eppendorf tube, combine the following reagents together to make the reverse transcription master mix:

Reagent Volume
Nuclease-free water 13 µl
10 mM dNTPs 2 µl
5x Induro RT reaction buffer 8 µl
Total 23 µl

Transfer the reverse transcriptase master mix to the 0.2 ml PCR tube containing your adapter-ligated RNA and mix by pipetting.

Add 2 µl of Induro Reverse Transcriptase to the reaction and mix by pipetting.

Place the tube in a thermal cycler and incubate at 60°C for 30 minutes, then 70°C for 10 minutes, and bring the sample to 4°C before proceeding to the next step.

Transfer the sample to a clean 1.5 ml Eppendorf DNA LoBind tube.

Resuspend the stock of Agencourt RNAClean XP beads by vortexing.

Add 72 µl of resuspended Agencourt RNAClean XP beads to the reverse transcription reaction and mix by pipetting.

Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.

Prepare 200 μl of fresh 70% ethanol in nuclease-free water.

Centrifugar la muestra y precipitar en un imán. Dejar el tubo en el imán y retirar el sobrenadante con una pipeta.

Keep the tube on magnet until the supernatant is clear and colourless before washing the beads with 150 µl of freshly prepared 70% ethanol, as described below:

  1. Keeping the magnetic rack on the benchtop, rotate the tube by 180°. Wait for the beads to migrate towards the magnet and to form a pellet.
  2. Rotate the tube 180° again (back to the starting position), and wait for the beads to pellet again.

Carefully remove the 70% ethanol using a pipette and discard.

Spin down and place the tube back on the magnet until the eluate is clear and colourless. Keep the tubes on the magnet and pipette off any residual ethanol.

Remove the tube from the magnetic rack and resuspend the pellet in 23 µl nuclease-free water. Incubate for 5 minutes at room temperature.

Pellet the beads on a magnet until the eluate is clear and colourless.

Remove and retain 23 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.

MEDIDA OPCIONAL

At this stage the RT-RNA sample can be stored at -80°C for later use.

Please note, this is the only pause point in this protocol.

In the same 1.5 ml Eppendorf DNA LoBind tube, combine the reagents in the following order:

Reagent Volume
RT-RNA sample 23 µl
NEBNext Quick Ligation Reaction Buffer 8 µl
RNA Ligation Adapter (RLA) 6 µl
T4 DNA Ligase 3 µl
Total 40 µl

Mix by pipetting.

Incubate the reaction for 10 minutes at room temperature.

Resuspend the stock of Agencourt RNAClean XP beads by vortexing.

Add 16 µl of resuspended Agencourt RNAClean XP beads to the reaction and mix by pipetting.

Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.

Spin down the sample and pellet on a magnet. Keep the tube on the magnet for 5 minutes, and pipette off the supernatant when clear and colourless.

Add 150 μl of the Wash Buffer (WSB) to the beads. Close the tube lid and resuspend the beads by flicking the tube. Return the tube to the magnetic rack, allow the beads to pellet for 5 minutes and pipette off the supernatant when clear and colourless.

Repetir el paso anterior.

IMPORTANTE

Agitating the beads results in a more efficient removal of free adapter, compared to adding the wash buffer and immediately aspirating.

Spin down the tube and replace onto the magnetic rack until the beads have pelleted to pipette off any remaining Wash Buffer (WSB).

Remove the tube from the magnetic rack and resuspend the pellet in 13 µl RNA Elution Buffer (REB) by the gently flicking the tube. Incubate for 10 minutes at room temperature.

Pellet the beads on a magnet for 5 minutes until the eluate is clear and colourless.

Remove and retain 13 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.

Quantify 1 µl of reverse-transcribed and adapted RNA using the Qubit fluorometer DNA HS assay.

The recovery aim in the final eluate is > 30 ng.

Recovery quantities can vary between different inputs and library preparations. However, we always recommend taking forward the full volume of RNA library for the best sequencing results.

FIN DEL PROCESO

The reverse-transcribed and adapted RNA is now ready for loading into the flow cell.

IMPORTANTE

The RNA library must be sequenced immediately and cannot be stored for later use.

4. Priming and loading the SpotON flow cell

Material
  • Library Solution (LIS)
  • Sequencing Buffer (SB) (tampón de secuenciación)
  • RNA Flush Tether (RFT)
  • Flow Cell Flush (FCF) (enjuague de celda de flujo)
Consumibles
  • Celda de flujo MinION/GridION
  • Agua sin nucleasas (p. ej., ThermoFisher AM9937)
  • Tubos de 1,5 ml Eppendorf DNA LoBind
Instrumental
  • Dispositivo MinION o GridION
  • Pantalla protectora para celdas de flujo MinION
  • Pipeta y puntas P1000
  • Pipeta y puntas P100
  • Pipeta y puntas P20
  • Pipeta y puntas P10
IMPORTANTE

Please note, this kit is only compatible with RNA flow cells (FLO-MIN004RA).

CONSEJO

Cebado y carga de la celda de flujo

Se recomienda a los nuevos usuarios que miren el vídeo Priming and loading your flow cell antes de realizar su primer experimento.

Thaw the Sequencing Buffer (SB), Library Solution (LIS), RNA Flush Tether (RFT) and Flow Cell Flush (FCF) at room temperature. Mix by vortexing and spin down.

To prepare the flow cell priming mix in a clean 1.5 ml Eppendorf DNA LoBind tube, combine the following reagents. Mix by vortexing and spin down at room temperature.

Reagent Volume per flow cell
RNA Flush Tether (RFT) 30 µl
Flow Cell Flush (FCF) 1,170 µl
Total 1,200 µl

Abrir la tapa del dispositivo MinION o GridION y deslizar la celda de flujo debajo del clip. Presionar la celda de flujo con firmeza para asegurar un contacto eléctrico y térmico adecuados.

Flow Cell Loading Diagrams Step 1a

Flow Cell Loading Diagrams Step 1b

MEDIDA OPCIONAL

Antes de cargar la biblioteca, verifique la celda de flujo para determinar el número de poros disponible.

Si se ha verificado con anterioridad la cantidad de poros presentes en la celda de flujo, este paso se puede omitir.

Dispone de más información en las instrucciones de comprobación de la celda de flujo, del protocolo de MinKNOW.

Para abrir el puerto de cebado de la celda de flujo, deslizar la tapa en el sentido de las agujas del reloj.

Flow Cell Loading Diagrams Step 2

IMPORTANTE

Tenga cuidado a la hora de extraer el tampón. No retire más de 20-30 μl y asegúrese de que el tampón cubra la matriz de poros en todo momento. La introducción de burbujas de aire en la matriz puede dañar los poros de manera irreversible.

Tras abrir el puerto de cebado, verificar si hay una burbuja de aire bajo la tapa. Retirar una pequeña cantidad de tampón para quitar las burbujas:

  1. Ajustar una pipeta P1000 a 200 μl.
  2. Introducir la punta de la pipeta en el puerto de cebado.
  3. Girar la rueda hasta que el indicador de volumen marque 220-230 μl o hasta que se pueda ver una pequeña cantidad de tampón entrar en la punta de la pipeta.

Nota: Comprobar que haya un flujo continuo de tampón circulando desde el puerto de cebado a través de la matriz de poros.

Flow Cell Loading Diagrams Step 03 V5

Cargar 800 μl de mezcla de cebado en el puerto de cebado, evitando introducir burbujas de aire. Esperar 5 minutos. Durante este tiempo, preparar la biblioteca para cargar siguiendo los pasos a continuación.

Flow Cell Loading Diagrams Step 04 V5 SPANISH

In a new 1.5 ml Eppendorf DNA LoBind tube, prepare the library for loading as follows:

Reagent Volume per flow cell
Sequencing Buffer (SB) 37.5 µl
Library Solution (LIS) 25.5 µl
RNA library 12 µl
Total 75 µl

Completar el cebado de la celda de flujo:

  1. Levantar suavemente la tapa del puerto de muestra SpotON.
  2. Cargar 200 µl de mezcla de cebado en el puerto de cebado (no en el puerto de muestra SpotON), evitando introducir burbujas de aire.

Flow Cell Loading Diagrams Step 5

Flow Cell Loading Diagrams Step 06 V5 SPANISH 2

Mezclar la biblioteca pipeteando suavemente, justo antes de cargar.

Añadir, gota a gota, 75 μl de la biblioteca preparada en el puerto de muestra SpotON. Procurar que cada gota fluya hacia adentro del puerto antes de añadir la siguiente.

Flow Cell Loading Diagram Step 07 V5 SPANISH

Volver a colocar con cuidado, la tapa del puerto de muestra SpotON, procurando que el tapón encaje en el agujero y cerrar el puerto de cebado.

Step 8 update - SPANISH

Flow Cell Loading Diagrams Step 9 SPANISH

IMPORTANTE

Para obtener resultados de secuenciación óptimos, instale la pantalla protectora justo después de cargar la biblioteca.

Recomendamos poner la pantalla protectora en la celda de flujo y dejarla puesta mientras la biblioteca esté cargada, incluyendo los lavados y pasos de recarga. Retirar la pantalla cuando se haya extraído la biblioteca de la celda de flujo.

Colocar la pantalla protectora de la siguiente manera:

  1. Colocar con cuidado el borde delantero de la pantalla protectora contra el clip. Nota: No hacer fuerza sobre ella.

  2. Colocar la pantalla protectora con suavidad sobre la celda de flujo. La pieza debe asentarse alrededor de la tapa SpotON y debe cubrir por completo la sección superior de la celda de flujo.

J2264 - Light shield animation Flow Cell FAW optimised. SPANISH

ATENCIÓN

La pantalla protectora no está fijada a la celda de flujo. Una vez colocada, es necesario manipularla con cuidado.

FIN DEL PROCESO

Cerrar la tapa del dispositivo y configurar un experimento de secuenciación en MinKNOW.

5. Adquisición de datos e identificación de bases

Cómo empezar a secuenciar

Una vez cargada la celda de flujo, se puede iniciar el experimento en MinKNOW -el programa de secuenciación que gestiona el dispositivo, la adquisición de datos y la identificación de bases en tiempo real. Encontrará intrucciones de uso más detalladas en el protocolo de MinKNOW.

MinKNOW se puede configurar y utilizar para secuenciar de diferentes maneras:

  • En un ordenador conectado a un dispositivo de secuenciación, ya sea directamente o en remoto.
  • Directamente desde un dispositivo de secuenciación GridION, MinION Mk1C o PromethION 24/48.

Encontrará más información sobre el uso de MinKNOW en los manuales de usuario de los dispositivos:

Para empezar un experimento de secuenciación en MinKNOW:

1. Ir a la página de inicio y pulsar "Iniciar secuenciación". start

2. Introducir los datos del experimento, como el nombre, la posición de la celda de flujo y el identificador de muestra. Grid start seq

3. En la pestaña Kit, seleccionar el kit de secuenciación usado durante la preparación de la biblioteca. kit selection

4. En las pestañas Run Options/Opciones de ejecución y Análisis, es posible configurar los parámetros de secuenciación adaptándolos al experimento o mantener la configuración predeterminada.

Nota: Si la identificación de bases estaba desactivada durante la configuración de un experimento, se puede activar en MinKNOW en la fase posejecución. Para más información, consulte el protocolo de MinKNOW.

5. En la pestaña Output/Datos de salida, es posible elegir entre configurar los parámetros de salida o mantener la configuración predeterminada. step5c

6. En la pestaña Review/Revisar, revisar las opciones seleccionadas y pulsar Start/Empezar. Step6

Análisis de datos tras la secuenciación

Una vez la secuenciación ha finalizado, la celda de flujo se puede reutilizar o devolver, como se indica en la sección Reutilización y devoluciones de celdas de flujo.

Tras la secuenciación y la identificación de bases, se puede proceder a analizar los datos. Si desea más información sobre las opciones de identificación de bases y de análisis posterior, consulte el documento Data Analysis.

En la sección Downstream analysis/Análisis posterior, le presentamos otras opciones para analizar los datos.

6. Reutilización y devoluciones de las celdas de flujo (1)

Material
  • Flow Cell Wash Kit (EXP-WSH004) or Flow Cell Wash Kit XL (EXP-WSH004-XL)
IMPORTANTE

Our Flow Cell Wash Kit (EXP-WSH004 or EXP-WSH004-XL) is compatible with RNA Flow Cells and the Direct RNA Sequencing Kit (SQK-RNA004).

However, please be aware that:

  • The wash kit doesn’t work as nuclease flush for Direct RNA sequencing: it won’t recover blocked pores.
  • It works as a flush to reload new sample: it will wash off most of the library from the array and remove all adapter from the remaining sample, preventing it from being captured and sequencing. This will allow subsequent library loads.

Si al terminar el experimento desea volver a usar la celda de flujo, siga las instrucciones del protocolo Flow Cell Wash Kit y guarde la celda de flujo lavada a 2-8 ⁰C.

El protocolo Flow Cell Wash Kit está disponible en la comunidad Nanopore.

CONSEJO

Una vez terminado el experimento, recomendamos lavar la celda de flujo cuanto antes. Si no es posible, se puede dejar en el dispositivo y lavar al día siguiente.

Otra posibilidad es seguir el procedimiento de devolución para lavar la celda de flujo y enviarla a Oxford Nanopore.

Aquí puede encontrar las instrucciones para devolver celdas de flujo.

Nota: Antes de proceder a su devolución, las celdas de flujo deben lavarse con agua desionizada.

IMPORTANTE

Ante cualquier duda o pregunta acerca del experimento de secuenciación, consulte la guía de resolución de problemas, Troubleshooting Guide, que se encuentra en la versión en línea de este protocolo.

7. Análisis posterior

Análisis posterior a la identificación de bases

Existen varias opciones para completar el análisis de los datos de bases identificadas:

1. Plataforma EPI2ME

La plataforma EPI2ME es un servicio de análisis de datos, alojado en la red, desarrollado por Metrichor Ltd., filial de Oxford Nanopore Technologies. EPI2ME ofrece una serie de procesos de análisis, p. ej., de identificación metagenómica, identificación de especies a partir de un código (barcoding), alineación e identificación de variantes estructurales. El análisis no requiere equipo ni capacidad computacional extra y proporciona un informe fácil de interpretar con los resultados. Para obtener información sobre cómo realizar un proceso de análisis en EPI2ME, siga las instrucciones del protocolo, empezando por la sección "Starting data analysis".

2. EPI2ME Labs, tutoriales y procesos de trabajo

Para realizar un análisis de datos más exhaustivo, Oxford Nanopore Technologies ofrece una serie de tutoriales y procesos de trabajo de bioinformática, disponibles en EPI2ME Labs, que encontrará en la sección del mismo nombre de la comunidad Nanopore. La plataforma proporciona un espacio donde los proyectos que depositan en GitHub nuestros equipos de Investigación y Aplicaciones, se pueden exponer con textos descriptivos, código bioinformático funcional y datos de ejemplo.

3. Herramientas de análisis para la investigación

El departamento de Investigación de Oxford Nanopore Technologies ha creado una serie de herramientas de análisis que están disponibles en el repositorio Oxford Nanopore de GitHub. Las herramientas están diseñadas para usuarios avanzados y contienen instrucciones sobre cómo instalar y ejecutar el programa. Estas herramientas están públicamente disponibles y cuentan con un mantenimiento mínimo.

4. Herramientas de análisis desarrolladas por la comunidad

Si no se proporciona en ninguno de los recursos anteriores un método de análisis que responda a las necesidades de investigación requeridas, puede consultar la sección Bioinformatics del centro de recursos Resource Centre. Varios miembros de la comunidad Nanopore han desarrollado sus propias herramientas y segmentaciones para analizar datos de secuenciación por nanoporos. La mayoría de ellos está disponible en GitHub. Nótese que Oxford Nanopore Technologies no desarrolla ni mantiene esas herramientas y no garantiza que sean compatibles con la última configuración de química/software.

8. Issues during RNA extraction and library preparation

A continuación hay una lista de los problemas más frecuentes, con algunas posibles causas y soluciones propuestas.

También disponemos de una página de preguntas frecuentes, FAQ, en la sección Support de la comunidad Nanopore.

Si ha probado las soluciones propuestas y continúa teniendo problemas, póngase en contacto con el departamento de asistencia técnica, bien por correo electrónico (support@nanoporetech.com) o a través del Live Chat de la comunidad Nanopore.

Low sample quality

Observation Possible cause Comments and actions
Low RNA integrity (RNA integrity number <9.5 RIN, or the rRNA band is shown as a smear on the gel) The RNA degraded during extraction Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page.
RNA has a shorter than expected fragment length The RNA degraded during extraction Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page.

We recommend working in an RNase-free environment, and to keep your lab equipment RNase-free when working with RNA.

9. Issues during an RNA sequencing run

A continuación hay una lista de los problemas más frecuentes, con algunas posibles causas y soluciones propuestas.

También disponemos de una página de preguntas frecuentes, FAQ, en la sección Support de la comunidad Nanopore.

Si ha probado las soluciones propuestas y continúa teniendo problemas, póngase en contacto con el departamento de asistencia técnica, bien por correo electrónico (support@nanoporetech.com) o a través del Live Chat de la comunidad Nanopore.

Fewer pores at the start of sequencing than after Flow Cell Check

Observation Possible cause Comments and actions
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check An air bubble was introduced into the nanopore array After the Flow Cell Check it is essential to remove any air bubbles near the priming port before priming the flow cell. If not removed, the air bubble can travel to the nanopore array and irreversibly damage the nanopores that have been exposed to air. The best practice to prevent this from happening is demonstrated in this video.
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check The flow cell is not correctly inserted into the device Stop the sequencing run, remove the flow cell from the sequencing device and insert it again, checking that the flow cell is firmly seated in the device and that it has reached the target temperature. If applicable, try a different position on the device (GridION/PromethION).
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check Contaminations in the library damaged or blocked the pores The pore count during the Flow Cell Check is performed using the QC DNA molecules present in the flow cell storage buffer. At the start of sequencing, the library itself is used to estimate the number of active pores. Because of this, variability of about 10% in the number of pores is expected. A significantly lower pore count reported at the start of sequencing can be due to contaminants in the library that have damaged the membranes or blocked the pores. Alternative RNA extraction or purification methods may be needed to improve the purity of the input material. The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

Error en el script de MinKNOW

Observación Posible causa Comentarios y acciones recomendadas
MinKNOW muestra el mensaje "Error en el script"
Reiniciar el ordenador y reiniciar MinKNOW. Si el problema continúa, reúna los archivos de registro MinKNOW log files y contacte con el servicio de asistencia técnica. Si no dispone de otro dispositivo de secuenciación, recomendamos que guarde la celda de flujo con la biblioteca cargada a 4 °C y contacte con el servicio de asistencia técnica para recibir recomendaciones de almacenamiento adicionales.

Pore occupancy below 40%

Observation Possible cause Comments and actions
Pore occupancy <40% Not enough library was loaded on the flow cell Ensure you load the recommended amount of good quality library in the relevant library prep protocol onto your flow cell. Please quantify the library before loading and calculate mols using tools like the NEBio Calculator, choosing "RNA ss: mass to moles"
Pore occupancy close to 0 No tether on the flow cell Tethers are adding during flow cell priming (FCT tube). Make sure Flow Cell Tether (FCT) was added to Flow Cell Flush (FCF) before priming.

Large proportion of inactive pores

Observation Possible cause Comments and actions
Large proportion of inactive/unavailable pores (shown as light blue in the channels panel and pore activity plot. Pores or membranes are irreversibly damaged) Air bubbles have been introduced into the flow cell Air bubbles introduced through flow cell priming and library loading can irreversibly damage the pores. Watch the Priming and loading your flow cell video for best practice
Large proportion of inactive/unavailable pores Contaminants are present in the sample The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

Fluctuación de la temperatura

Observación Posible causa Comentarios y acciones recomendadas
Fluctuación de la temperatura La celda de flujo ha perdido contacto con el dispositivo Comprobar que una almohadilla térmica cubra la placa metálica de la parte posterior de la celda de flujo. Reinsertar la celda de flujo y presionar para asegurarse de que las clavijas del conector están bien conectadas al dispositivo. Si el problema continúa, contacte con el servicio de asistencia técnica.

Error al intentar alcanzar la temperatura deseada

Observación Posible causa Comentarios y acciones recomendadas
MinKNOW muestra el mensaje "Error al intentar alcanzar la temperatura deseada" El dispositivo ha sido colocado en un lugar a una temperatura ambiente inferior a la media o en un lugar con escasa ventilación (lo que provoca el sobrecalientamiento de las celdas de flujo). MinKNOW tiene un tiempo predeterminado para que las celdas de flujo alcancen la temperatura fijada. Una vez acabado el tiempo, aparece un mensaje de error, pero el experimento de secuenciación continua. Secuenciar a una temperatura incorrecta puede llevar a una disminución en el rendimiento y a generar un índice de calidad Qscore menor. Corrija la ubicación del dispositivo de secuenciación para asegurarse de que se encuentra a temperatura ambiente y con buena ventilación; a continuación, reinicie el proceso en MinKNOW. Para obtener más información sobre el control de temperatura de MinKNOW Mk 1B, consulte la sección de preguntas frecuentes, FAQ.

Last updated: 7/31/2024

Document options

MinION