Ligation sequencing gDNA - exome enrichment (SQK-LSK110)

Oxford Nanopore Technologies
Document type icon

MinION: Protocol

Ligation sequencing gDNA - exome enrichment (SQK-LSK110) V EXS_9118_v110_revI_10Nov2020

For enrichment of a specific target region for:

  • Highest yield
  • Depth of coverage of region
  • Larger number of target regions
  • If amplification is impractical
  • Compatible with R10.3 flow cells

For Research Use Only

This is a Legacy product This kit is soon to be discontinued and we recommend all customers to upgrade to the latest chemistry for their relevant kit which is available on the Store. If customers require further support for any ongoing critical experiments using a Legacy product, please contact Customer Support via email: support@nanoporetech.com.

FOR RESEARCH USE ONLY

Descripción general

For enrichment of a specific target region for:

  • Highest yield
  • Depth of coverage of region
  • Larger number of target regions
  • If amplification is impractical
  • Compatible with R10.3 flow cells

For Research Use Only

This is a Legacy product This kit is soon to be discontinued and we recommend all customers to upgrade to the latest chemistry for their relevant kit which is available on the Store. If customers require further support for any ongoing critical experiments using a Legacy product, please contact Customer Support via email: support@nanoporetech.com.

Document version: EXS_9118_v110_revI_10Nov2020

1. Overview of the protocol

IMPORTANTE

This is a Legacy product

This kit is soon to be discontinued and we recommend all customers to upgrade to the latest chemistry for their relevant kit which is available on the Store. If customers require further support for any ongoing critical experiments using a Legacy product, please contact Customer Support via email: support@nanoporetech.com. For further information on please see the product update page.

Exome sequencing protocol features

Use this protocol if you:

  • Are not interested in analysing the entire genome
  • Want greater depth of coverage of a specific exonic region
  • Want to analyse a large number of target regions

Introduction to exome sequencing

This protocol describes how to carry out exome sequencing using the Ligation Sequencing Kit (SQK-LSK110) and the Agilent SureSelect method.

Steps in the sequencing workflow:

Prepare for your experiment

You will need to:

  • Ensure you have your sequencing kit, the correct equipment and third-party reagents
  • Download the software for acquiring and analysing your data
  • Check your flow cell to ensure it has enough pores for a good sequencing run

Library preparation

You will need to:

  • Fragment your DNA
  • Ligate PCR adapters to the DNA ends and amplify the fragments
  • Hybridise the DNA to probes provided in the Agilent SureSelect Exome kit, and perform a pulldown
  • Elute and amplify the pulled-down fragments
  • Prepare the DNA ends for adapter attachment
  • Attach sequencing adapters supplied in the kit to the DNA ends
  • Prime the flow cell, and load your DNA library into the flow cell

Exome sequencing

Sequencing and analysis

You will need to:

  • Start a sequencing run using the MinKNOW software, which will collect raw data from the device and convert it into basecalled reads
  • Start the EPI2ME software and select a workflow for Human Exome mapping, or use minimap2 to align the reads to the human reference genome.

We recommend using the standard SureSelect Target Enrichment System protocol from Agilent Technologies with the following differences:

  • The DNA in this protocol is sheared with dsDNA Fragmentase rather than in a Covaris g-TUBE
  • DNA purification in this protocol is carried out using Agencourt AMPure XP beads instead of QIAquick PCR purification
  • DNA End-prep is carried out using the NEBNext Ultra II End Repair/dA-Tailing Module instead of the Agilent method
  • Ligation of PCR adapters is carried out using the NEB Blunt/TA Ligase Master Mix instead of the Agilent method
  • No desalting of the capture solution is necessary
  • LongAMP Taq is used for amplification of the DNA post-hybridisation
IMPORTANTE

This protocol is for the preparation of a single sample. Multiple samples can be prepared in parallel; each sample will require a separate pull-down and will need to be run on a separate flow cell.

IMPORTANTE

Compatibility of this protocol

This protocol should only be used in combination with:

  • Ligation Sequencing Kit (SQK-LSK110)
  • Control Expansion (EXP-CTL001)
  • PCR Expansion (EXP-PCA001)
  • FLO-MIN106 (R9.4.1) flow cells
  • Flow Cell Wash Kit (EXP-WSH004)

2. Equipment and consumables

Material
  • 3 µg high molecular weight human genomic DNA
  • Sequence capture kit (e.g. Agilent SureSelect Human All Exon, Cat# 232866)
  • Custom primer mix, 10 μM (IDT) - see below for sequences
  • Ligation Sequencing Kit (SQK-LSK110)
  • PCR Expansion (EXP-PCA001)
Consumibles
  • NEBNext dsDNA Fragmentase (M0348L)
  • NEB Blunt/TA Ligase Master Mix (NEB, cat # M0367)
  • NEBNext Ultra II End Repair/dA-tailing Module (NEB E7546) (Módulo de reparación de extremos/Adición de dA)
  • NEBNext Quick Ligation Module (NEB E6056) (Módulo de ligación rápida)
  • Agencourt AMPure XP beads (Beckman Coulter, A63881)
  • Cot-1 DNA (ThermoFisher Scientific 15279-011)
  • Dynabeads MyOne Streptavidin T1 (ThermoFisher Scientific, 65601)
  • Blocking oligo at 1 mM, sequence 5'-AGGTTAAACACCCAAGCAGACGCCGCAATATCAGCACCAACAGAAACAACC-3'
  • LongAmp Taq 2X Master Mix (e.g. NEB, cat # M0287)
  • Agua sin nucleasas (p. ej., ThermoFisher AM9937)
  • Etanol al 80 % recién preparado con agua sin nucleasas
  • Etanol al 70 % recién preparado en agua sin nucleasas
  • 0.5 M EDTA, pH 8 (Thermo Scientific, R1021)
  • Tubos de 1,5 ml Eppendorf DNA LoBind
  • Tubos de PCR de pared fina (0,2 ml)
  • 0.2 ml 96 well PCR plate
Instrumental
  • Mezclador Hula (mezclador giratorio suave)
  • Separador magnético, adecuado para tubos Eppendorf de 1,5 ml
  • Microcentrífuga
  • Mezclador vórtex
  • Termociclador
  • Cubeta con hielo
  • Temporizador
  • SpeedVac
  • Pipeta y puntas P1000
  • Pipeta y puntas P200
  • Pipeta y puntas P100
  • Pipeta y puntas P20
  • Pipeta y puntas P10
  • Pipeta y puntas P2
Equipo opcional
  • Standard gel electrophoresis equipment
  • Bioanalizador Agilent (o equivalente)
  • Qubit fluorometer (or equivalent for QC check)
  • Centrifuga Eppendorf 5424 (o equivalente)

For this protocol, you will need 3 µg high molecular weight human genomic DNA.

Cantidad de muestra inicial de ADN

Cómo realizar un control de calidad de la muestra inicial de ADN

Es importante que la muestra de ADN cumpla con los requisitos de cantidad y calidad. Usar demasiado ADN, poco o de mala calidad (p. ej., que esté muy fragmentado, que contenga ARN o contaminantes químicos), puede afectar a la preparación de la biblioteca.

Para realizar un control de calidad en la muestra de ADN, consulte el protocolo Input DNA/ RNA QC

Contaminantes químicos

Dependiendo de cómo se extraiga el ADN de la muestra cruda, ciertos contaminantes químicos pueden permanecer en el ADN purificado, lo cual afecta la eficacia de la preparación de la biblioteca y la calidad de la secuenciación. Encontrará más información sobre contaminantes en la página Contaminants de la comunidad Nanopore.

Custom primer mix sequences

Please order these sequences at 10 μM from IDT:

Forward primer: 5’ CAATTCGGTCTCCAGTGACTTGCCTGTCGCTCTATCTTC 3’ Reverse Primer: 5’ CAATTCGGTCTCCCACTTTTCTGTTGGTGCTGATATTGC 3’

Ligation Sequencing Kit (SQK-LSK110) contents

SQK-LSK110 kit contents

Name Acronym Cap colour No. of vials Fill volume per vial (µl)
DNA CS DCS Yellow 1 35
Adapter Mix F AMX-F Green 1 40
Ligation Buffer LNB Clear 1 200
L Fragment Buffer LFB White cap, orange stripe on label 2 1,800
S Fragment Buffer SFB Grey 2 1,800
Sequencing Buffer II SBII Red 1 500
Elution Buffer EB Black 1 200
Loading Beads II LBII Pink 1 360
Loading Solution LS White cap, pink sticker on label 1 360
Flush Buffer FB Blue 6 1,170
Flush Tether FLT Purple 1 200

3. Computer requirements and software

Requisitos informáticos para el MinION Mk1B

Para secuenciar con el MinION Mk1B es necesario tener un ordenador o portátil de alto rendimiento, que pueda soportar la velocidad de adquisición de datos. Encontrará más información en el documento MinION Mk1B IT Requirements.

Requisitos informáticos para el MinION Mk1C

El MinION Mk1C contiene ordenador y pantalla integrados, lo que elimina la dependencia de cualquier accesorio para generar y analizar datos de nanoporos. Encontrará más información en el documento MinION Mk1C IT Requirements.

Software for nanopore sequencing

MinKNOW

The MinKNOW software controls the nanopore sequencing device, collects sequencing data and basecalls in real time. You will be using MinKNOW for every sequencing experiment to sequence, basecall and demultiplex if your samples were barcoded.

For instructions on how to run the MinKNOW software, please refer to the MinKNOW protocol.

EPI2ME (optional)

The EPI2ME cloud-based platform performs further analysis of basecalled data, for example alignment to the Lambda genome, barcoding, or taxonomic classification. You will use the EPI2ME platform only if you would like further analysis of your data post-basecalling.

For instructions on how to create an EPI2ME account and install the EPI2ME Desktop Agent, please refer to the EPI2ME Platform protocol.

Verificar la celda de flujo

Antes de empezar el experimento de secuenciación, recomendamos verificar el número de poros disponibles, presentes en la celda de flujo. La comprobación deberá realizarse en las primeras 12 semanas desde su adquisición, si se trata de celdas de flujo MinION, GridION o PromethION, y en las primeras cuatro semanas tras la compra de celdas de flujo Flongle. Oxford Nanopore Technologies sustituirá cualquier celda de flujo con un número de poros inferior al indicado en la tabla siguiente, siempre y cuando el resultado se notifique dentro de los dos días siguientes a la comprobación y se hayan seguido las instrucciones de almacenamiento. Para verificar la celda de flujo, siga las instrucciones del documento Flow Cell Check.

Celda de flujo Número mínimo de poros activos cubierto por la garantía
Flongle 50
MinION/GridION 800
PromethION 5000

4. DNA fragmentation

Material
  • 3 µg high molecular weight human genomic DNA
Consumibles
  • NEBNext dsDNA Fragmentase (M0348L)
  • Agua sin nucleasas (p. ej., ThermoFisher AM9937)
  • Agencourt AMPure XP beads (Beckman Coulter, A63881)
  • Etanol al 80 % recién preparado con agua sin nucleasas
  • 0.5 M EDTA, pH 8 (Thermo Scientific, R1021)
  • Tubos de 1,5 ml Eppendorf DNA LoBind
  • Tubos de PCR de pared fina (0,2 ml)
Instrumental
  • Mezclador vórtex
  • Mezclador Hula (mezclador giratorio suave)
  • Separador magnético, adecuado para tubos Eppendorf de 1,5 ml
  • Cubeta con hielo
  • Microcentrífuga
  • Termociclador
Equipo opcional
  • Bioanalizador Agilent (o equivalente)
  • Centrifuga Eppendorf 5424 (o equivalente)

Prepare the DNA in nuclease-free water.

  • Transfer 3 μg genomic DNA into a 1.5 ml Eppendorf DNA LoBind tube
  • Adjust the volume to 16 μl with nuclease-free water
  • Mix thoroughly by flicking the tube to avoid unwanted shearing
  • Spin down briefly in a microfuge

In a 0.2 ml thin-walled PCR tube, mix the following:

Reagent Volume
DNA 16 µl
10x Fragmentase Reaction Buffer v2 2 µl
Total 18 µl

Vortex the tube for 3 seconds, and spin down.

Add 2 μl dsDNA Fragmentase to the tube.

Incubate the reaction for 28 minutes at 37°C.

CONSEJO

Fragmentation timing

Samples may fragment at different rates; 28 mins has shown to be the optimum time for NA12878 DNA extracted with the QIAGEN Genomic-tip. Users may wish to titrate fragmentation times of 25–32 mins if the fragmented yield is low.

Stop the fragmentation reaction by adding 5 μl of 0.5 M EDTA to the tube.

Vortex the tube for 3 seconds, and spin down.

Resuspend the AMPure XP beads by vortexing.

Transferir la muestra a un tubo nuevo de 1,5 ml Eppendorf DNA Lobind.

Add 15 µl of resuspended AMPure XP beads to the reaction and mix by pipetting.

Incubate on a Hula mixer (rotator mixer) for 10 minutes at room temperature.

Spin down the sample and pellet the beads on a magnet for 5 mins.

Remove and retain the supernatant in a new 1.5 ml Eppendorf DNA LoBind tube.

Note: Do not discard the supernatant.

Add 40 µl of resuspended AMPure XP beads to the reaction and mix by flicking the tube.

Incubate on a Hula mixer (rotator mixer) for 10 minutes at room temperature.

Prepare 500 μl of fresh 80% ethanol in nuclease-free water.

Spin down the sample and pellet the beads on a magnet for 5 minutes. Keep the tube on the magnet until the eluate is clear and colourless, and pipette off the supernatant.

Keep the tube on the magnet and wash the beads with 200 µl of freshly prepared 80% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.

Repeat the previous step.

Centrifugar y colocar el tubo de nuevo en el imán. Retirar con una pipeta cualquier residuo de etanol. Dejar secar el agregado durante 30 s aproximadamente, sin dejar que se agriete.

Remove the tube from the magnetic rack and resuspend pellet in 21 µl nuclease-free water. Incubate for 2 minutes at room temperature.

Precipitar las microesferas en un imán, durante al menos 1 minuto, hasta que el eluido se vuelva claro e incoloro.

Remove and retain 21 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.

Run a 1 μl aliquot on an Agilent Bioanalyzer to determine fragment length.

The fragment length distribution is expected to be similar to the trace below: Agilent

FIN DEL PROCESO

Take the fragmented DNA in 20 µl into the end-prep step. However, at this point it is also possible to store the sample at 4°C overnight.

5. End-prep

Material
  • Fragmented DNA in 20 µl
Consumibles
  • Tubos de PCR de pared fina (0,2 ml)
  • Tubos de 1,5 ml Eppendorf DNA LoBind
  • Agua sin nucleasas (p. ej., ThermoFisher AM9937)
  • NEBNext Ultra II End repair/dA-tailing Module (NEB E7546)
  • Agencourt AMPure XP beads (Beckman Coulter™, A63881)
  • Etanol al 80 % recién preparado con agua sin nucleasas
Instrumental
  • Pipeta y puntas P1000
  • Pipeta y puntas P100
  • Pipeta y puntas P10
  • Thermal cycler
  • Microcentrífuga
  • Mezclador Hula (mezclador giratorio suave)
  • Gradilla magnética
  • Cubeta con hielo

In a 0.2 ml thin-walled PCR tube, mix the following:

Between each addition, pipette mix 10-20 times.

Reagent Volume
Fragmented DNA 20 µl
Ultra II End-prep reaction buffer 7 µl
Ultra II End-prep enzyme mix 3 µl
Nuclease-free water 30 µl
Total 60 µl

Ensure the components are thoroughly mixed by pipetting, and spin down.

Using a thermal cycler, incubate at 20°C for 30 minutes and 65°C for 30 mins.

Resuspend the AMPure XP beads by vortexing.

Transferir la muestra de ADN a un tubo Eppendorf DNA Lobind de 1,5 ml.

Add 60 µl of resuspended AMPure XP beads to the end-prep reaction and mix by flicking the tube.

Incubar en el mezclador Hula (o mezclador giratorio suave) durante 5 minutos a temperatura ambiente.

Prepare 500 μl of fresh 80% ethanol in nuclease-free water.

Centrifugar la muestra y precipitar en un imán hasta que el sobrenadante se vuelva claro e incoloro. Dejar el tubo en el imán y retirar el sobrenadante con una pipeta.

Keep the tube on the magnet and wash the beads with 200 µl of freshly prepared 80% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.

Repetir el paso anterior.

Centrifugar y colocar el tubo de nuevo en el imán. Retirar con una pipeta cualquier residuo de etanol. Dejar secar el agregado durante 30 s aproximadamente, sin dejar que se agriete.

Remove the tube from the magnetic rack and resuspend pellet in 31 µl nuclease-free water. Incubate for 2 minutes at room temperature.

Precipitar las microesferas en un imán, durante al menos 1 minuto, hasta que el eluido se vuelva claro e incoloro.

Remove and retain 31 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.

Quantify 1 µl of end-prepped DNA using a Qubit fluorometer.

FIN DEL PROCESO

Take forward ~300 ng of end-prepped DNA in 30 µl into adapter ligation. However, at this point it is also possible to store the sample at 4°C overnight.

6. Ligation of PCR adapters

Material
  • 300 ng end-prepped DNA in 30 µl
  • PCR Adapter (PCA)
Consumibles
  • Agua sin nucleasas (p. ej., ThermoFisher AM9937)
  • NEB Blunt/TA Ligase Master Mix (NEB, cat # M0367)
  • Agencourt AMPure XP beads (Beckman Coulter, A63881)
  • Etanol al 80 % recién preparado con agua sin nucleasas
  • Tubos de 1,5 ml Eppendorf DNA LoBind
Instrumental
  • Separador magnético, adecuado para tubos Eppendorf de 1,5 ml
  • Mezclador Hula (mezclador giratorio suave)
  • Qubit fluorometer (or equivalent for QC check)
  • Microcentrífuga
  • Mezclador vórtex

Add the reagents in the order given below, mixing by pipetting 10-20 times between each sequential addition:

Reagent Volume
End-prepped DNA 30 µl
PCR Adapters (PCA) 20 µl
NEB Blunt/TA Ligase Master Mix 50 µl
Total 100 µl

Ensure the components are thoroughly mixed by pipetting, and spin down.

Incubar la reacción durante 10 minutos a temperatura ambiente.

Resuspend the AMPure XP beads by vortexing.

Add 100 µl of resuspended AMPure XP beads to the end-prep reaction and mix by pipetting.

End-prep cleanup demo

Incubar en el hula mixer (o mezclador rotatorio) durante 5 minutos a temperatura ambiente.

Prepare 500 μl of fresh 80% ethanol in nuclease-free water.

Centrifugar la muestra y precipitar en un imán. Dejar el tubo en el imán y retirar el sobrenadante con una pipeta.

Keep the tube on the magnet and wash the beads with 200 µl of freshly prepared 80% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.

Repetir el paso anterior.

Centrifugar y colocar el tubo de nuevo en el imán. Retirar con una pipeta cualquier residuo de etanol. Dejar secar el agregado durante 30 s aproximadamente, sin dejar que se agriete.

Remove the tube from the magnetic rack and resuspend pellet in 49 µl nuclease-free water. Incubate for 2 minutes at room temperature.

Precipitar las microesferas en un imán, durante al menos 1 minuto, hasta que el eluido se vuelva claro e incoloro.

Remove and retain 49 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.

Quantify 1 µl of adapted DNA using a Qubit fluorometer.

FIN DEL PROCESO

Take forward 48 µl of the adapted DNA into the PCR reaction. However, at this point it is also possible to store the sample at 4°C overnight.

7. PCR

Material
  • Primer Mix (PRM)
Consumibles
  • LongAmp Taq 2X Master Mix (e.g. NEB, cat # M0287)
  • Agencourt AMPure XP beads (Beckman Coulter, A63881)
  • Agua sin nucleasas (p. ej., ThermoFisher AM9937)
  • Etanol al 80 % recién preparado con agua sin nucleasas
  • Tubos de 1,5 ml Eppendorf DNA LoBind
  • Tubos de PCR de pared fina (0,2 ml)
Instrumental
  • Termociclador
  • Cubeta con hielo
  • Separador magnético, adecuado para tubos Eppendorf de 1,5 ml
  • Mezclador Hula (mezclador giratorio suave)
  • Mezclador vórtex
  • Qubit fluorometer (or equivalent for QC check)

In a 0.2 ml thin-walled PCR tube mix the following:

Reagent Volume
LongAmp Taq 2X Master Mix 50 µl
PRM Adapters (10 μM) 2 µl
Template DNA 48 µl
Total 100 µl

Amplify using the following cycling conditions:

Cycle step Temperature Time No. of cycles
Initial denaturation 95 °C 3 mins 1
Denaturation 98 °C 20 secs 6 (b)
Annealing 62 °C (a) 15 secs (a) 6 (b)
Extension 65 °C (c) 3 mins 6 (b)
Final extension 65 °C 3 mins 1
Hold 4 °C ∞

a. This is specific to the Oxford Nanopore primer and should be maintained

b. Adjust accordingly if input quantities are altered

c. This temperature is determined by the type of polymerase that is being used (given here for LongAmp Taq polymerase)

Resuspend the AMPure XP beads by vortexing.

Add 100 μl of the resuspended AMPure XP beads to the sample, and mix by flicking the tube.

Incubar en el hula mixer (o mezclador rotatorio) durante 5 minutos a temperatura ambiente.

Prepare 500 μl of fresh 80% ethanol in nuclease-free water.

Centrifugar la muestra y precipitar en un imán. Dejar el tubo en el imán y retirar el sobrenadante con una pipeta.

Keep the tube on the magnet and wash the beads with 200 µl of freshly prepared 80% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.

Repetir el paso anterior.

Centrifugar y colocar el tubo de nuevo en el imán. Retirar con una pipeta cualquier residuo de etanol. Dejar secar el agregado durante 30 s aproximadamente, sin dejar que se agriete.

Remove the tube from the magnetic rack and resuspend the pellet in 35 µl nuclease-free water. Incubate for 2 minutes at room temperature.

Precipitar las microesferas en un imán, durante al menos 1 minuto, hasta que el eluido se vuelva claro e incoloro.

Remove and retain 35 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.

Quantify 2 µl of amplified DNA using a Qubit fluorometer.

FIN DEL PROCESO

Take forward 300–1000 ng amplified DNA into the hybridisation step. However, at this point it is also possible to store the sample at 4°C overnight.

8. Hybridisation

Material
  • Sequence capture kit (e.g. Agilent SureSelect Human All Exon, Cat# 232866)
Consumibles
  • Cot-1 DNA (ThermoFisher Scientific 15279-011)
  • Agua sin nucleasas (p. ej., ThermoFisher AM9937)
  • Tubos de PCR de pared fina (0,2 ml)
  • Blocking oligo at 1 mM, sequence 5'-AGGTTAAACACCCAAGCAGACGCCGCAATATCAGCACCAACAGAAACAACC-3'
Instrumental
  • SpeedVac
  • Termociclador
  • Cubeta con hielo
  • Mezclador vórtex
  • Microcentrífuga

In a clean 1.5 ml Eppendorf DNA LoBind tube, mix the following:

Reagent Volume
DNA library 300–1000 ng
Cot-1 DNA 5 µg
Blocking oligo top 1 µl

The volume of the reaction can be variable, as the water is evaporated in step 2. After this, the DNA is reconstituted to a set volume.

Evaporate the water in a SpeedVac at 45ºC for approximately 1 hour.

Poke one or more holes in the lid with a narrow gauge needle. You can also break off the cap, cover with parafilm, and poke a hole in the parafilm.

Reconstitute with nuclease-free water to a final volume of 9 µl. Pipette up and down along the sides of the tube for optimal recovery.

Mix thoroughly by vortexing and spin down for 1 minute.

Move the 9 µl DNA library sample to a 0.2 µl thin-walled PCR tube, close the tube and incubate in the thermal cycler using the following program:

Stage Temperature Time
Step 1 95°C 5 min
Step 2 65°C 5 min
Step 3 65°C Hold

You will now need to prepare the Hybridisation Buffer mix and the RNase Block ready to be combined with the Capture Library reagent from the SureSelect kit. This will then be combined with the adapted, amplified DNA sample.

Once the sample tube is in the thermal cycler, mix the reagents in the table below to make the Hybridisation Buffer:

Reagent Volume for 1 reaction
SureSelect Hyb 1 (orange cap or bottle) 6.63 µl
SureSelect Hyb 2 (red cap) 0.27 µl
SureSelect Hyb 3 (yellow cap or bottle) 2.65 µl
SureSelect Hyb 4 (black cap or bottle) 3.45 µl
Total 13 µl

In the event of precipitation, warm the Hybridisation Buffer at 65°C for 5 minutes. Otherwise, keep buffer at room temperature until it is used for the Hybridisation mix.

Dilute the SureSelect RNase Block (purple cap) in nuclease-free water. Keep the mixture on ice.

RNase block dilution (parts RNase block:water) Volume of diluted RNase block
25% (1:3) 2 μl
IMPORTANTE

Please note that the 1:3 ratio of the RNase Block dilution is different to the SureSelect protocol.

Prepare the Capture Library Hybridisation Mix according to the table below. Only keep the mixture at room temperature until it is added to sample tube.

Reagent Volume for 1 reaction
Hybridisation buffer mixture 13 µl
25% RNase Block solution 2 µl
Capture library (red cap) ≥3 Mb 5 µl
Total 20 µl
IMPORTANTE

Do not keep solutions containing the Capture Library at room temperature for longer than 10 mins.

Keeping all reagents at 65°C, add 20 µl of the Capture Hybridisation Mix to the tube containing 9 µl adapted and amplified DNA sample.

Mezclar con la pipeta.

Replace the cap on the tube.

IMPORTANTE

The tube must be closed to minimise evaporation and avoid a negative impact on your results.

Incubate the tube for 16–24 hours at 65°C with a heated lid set at 105°C.

FIN DEL PROCESO

Take your sample forward into the next step.

We do not recommend pausing your library prep at this stage by storing your sample at 4°C overnight.

9. Pull-down

Material
  • Sequence capture kit (e.g. Agilent SureSelect Human All Exon, Cat# 232866)
Consumibles
  • Dynabeads MyOne Streptavidin T1 (ThermoFisher Scientific, 65601)
  • Tubos de PCR de pared fina (0,2 ml)
  • Agua sin nucleasas (p. ej., ThermoFisher AM9937)
Instrumental
  • Termociclador
  • Mezclador vórtex
  • Gradilla magnética
  • Multichannel pipette and tips
  • Plate mixer
  • Microfuge
  • Cubeta con hielo
IMPORTANTE

It is important to maintain bead suspensions at 65°C during the washing procedure below to ensure specificity of capture. Make sure that the SureSelect Wash Buffer 2 is pre-warmed to 65°C before use. Do not use a tissue incubator, or other devices with significant temperature fluctuations, for the incubation steps.

The hybrid capture protocol uses the SureSelect Target Enrichment Box 1 reagents (stored at room temperature), as well as Dynabeads MyOne Streptavidin T1 magnetic beads.

Warm the SureSelect Wash Buffer 2 at 65°C.

Resuspend the Dynabeads MyOne Streptavidin T1 magnetic beads by vortexing.

Add 50 µl of the beads to a fresh 1.5 ml Eppendorf DNA LoBind tube.

Add 200 µl of SureSelect Binding Buffer to the beads.

Mezclar con la pipeta.

Place on a magnetic rack, allow beads to pellet and pipette off supernatant.

Repeat steps 4–6 twice more for a total of three washes.

Resuspend the beads in 200 µl of SureSelect Binding Buffer.

Keep the hybridisation tube at 65°C. Using a multichannel pipette, transfer the whole volume (~25–29 µl) of the hybridisation mixture from the 65°C reaction to the tube containing 200 µl of washed streptavidin beads.

Pipette up and down until beads are fully resuspended.

Incubate the tube on a Hula mixer for 30 mins at room temperature. Make sure the sample is mixing in the tube.

Centrifugar la muestra y precipitar en un imán hasta que el sobrenadante se vuelva claro e incoloro. Dejar el tubo en el imán y retirar el sobrenadante con una pipeta.

Resuspend the beads in 200 µl of SureSelect Wash Buffer 1.

Pipette up and down until beads are fully resuspended.

Incubate the reaction for 15 minutes at room temperature.

Centrifugar la muestra y precipitar en un imán hasta que el sobrenadante se vuelva claro e incoloro. Dejar el tubo en el imán y retirar el sobrenadante con una pipeta.

Resuspend the beads in 200 µl of Wash Buffer 2 pre-warmed at 65°C.

Pipette up and down until beads are fully resuspended.

Transfer the sample to a 0.2 ml thin-walled PCR tube.

Incubate the tube for 10 minutes at 65°C in the thermal cycler.

Transferir la muestra a un tubo nuevo de 1,5 ml Eppendorf DNA Lobind.

Place on a magnetic rack, allow beads to pellet and pipette off supernatant.

Repeat the wash steps 17–22 twice more for a total of three washes. Make sure all of the wash buffer has been removed during the final wash.

Add 96 µl of nuclease-free water to the sample, and pipette up and down to resuspend the beads. Keep the sample on ice.

Captured DNA remains on the streptavidin beads during the post-capture amplification step.

10. Elution and amplification of DNA

Material
  • Custom primer mix, 10 μM (IDT) - see below for sequences
Consumibles
  • Tubos de PCR de pared fina (0,2 ml)
  • LongAmp Taq 2X Master Mix (e.g. NEB, cat # M0287)
  • Etanol al 80 % recién preparado con agua sin nucleasas
  • Agua sin nucleasas (p. ej., ThermoFisher AM9937)
  • Agencourt AMPure XP beads (Beckman Coulter, A63881)
  • 1.5 ml Eppendorf DNA LoBind tubes
Instrumental
  • Termociclador
  • Cubeta con hielo
  • Separador magnético, adecuado para tubos Eppendorf de 1,5 ml
  • Mezclador Hula (mezclador giratorio suave)
  • Mezclador vórtex

Custom primer mix sequences

Please order these sequences at 10 μM from IDT:

Forward primer: 5’ CAATTCGGTCTCCAGTGACTTGCCTGTCGCTCTATCTTC 3’ Reverse Primer: 5’ CAATTCGGTCTCCCACTTTTCTGTTGGTGCTGATATTGC 3’

Split the sample into 2x 48 µl aliquots, and prepare the following reaction in duplicate.

In a 0.2 ml thin-walled PCR tube, mix the following:

Reagent Volume
LongAmp Taq 2x Master Mix 50 µl
Custom primer mix 2 µl
Template DNA 48 µl
Total 100 µl

Amplify using the following cycling conditions:

Cycle step Temperature Time No. of cycles
Initial denaturation 95°C 3 mins 1
Denaturation 98°C 20 secs 14 (b)
Annealing 62°C (a) 15 secs (a) 14 (b)
Extension 65°C (c) 3 mins 14 (b)
Final extension 65°C 3 mins 1
Hold 4°C ∞

a. This is specific to the primer mix and should be maintained

b. Adjust accordingly if input quantities are altered

c. This temperature is determined by the type of polymerase that is being used (given here for LongAmp Taq polymerase)

Place the amplified sample on a magnetic rack. Once the solution is clear, transfer the supernatant into a clean 1.5 ml Eppendorf DNA Lo-Bind tube. The beads can now be discarded.

Resuspend the AMPure XP beads by vortexing.

Add 180 µl of resuspended AMPure XP beads to the reaction and mix by pipetting.

Incubar en el hula mixer (o mezclador rotatorio) durante 5 minutos a temperatura ambiente.

Prepare sufficient fresh 80% ethanol in nuclease-free water.

Centrifugar la muestra y precipitar en un imán. Dejar el tubo en el imán y retirar el sobrenadante con una pipeta.

Keep the tube on the magnet and wash the beads with 200 µl of freshly prepared 80% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.

Repetir el paso anterior.

Centrifugar y colocar el tubo de nuevo en el imán. Retirar con una pipeta cualquier residuo de etanol. Dejar secar el agregado durante 30 s aproximadamente, sin dejar que se agriete.

Remove the tube from the magnetic rack and resuspend pellet in 25 µl nuclease-free water. Incubate for 2 minutes at room temperature.

Precipitar las microesferas en un imán, durante al menos 1 minuto, hasta que el eluido se vuelva claro e incoloro.

Remove and retain 25 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube. Pool the two samples together to yield 50 µl eluted sample.

CHECKPOINT

Cuantificar 1 μl de muestra eluida utilizando un fluorímetro Qubit.

Run a 1 μl aliquot on an Agilent Bioanalyzer to determine fragment length.

The fragment length distribution is expected to be similar to the trace below: Agilent2

11. End-prep

Material
  • 500 ng–1 µg captured DNA in 48 µl
Consumibles
  • NEBNext Ultra II End Repair/dA-tailing Module (NEB E7546) (Módulo de reparación de extremos/Adición de dA)
  • Etanol al 70 % recién preparado en agua sin nucleasas
  • Tubos de 1,5 ml Eppendorf DNA LoBind
  • Agua sin nucleasas (p. ej., ThermoFisher AM9937)
  • Agencourt AMPure XP beads (Beckman Coulter, A63881)
Instrumental
  • Termociclador
  • Separador magnético, adecuado para tubos Eppendorf de 1,5 ml
  • Mezclador Hula (mezclador giratorio suave)
  • Mezclador vórtex
  • Cubeta con hielo
Equipo opcional
  • Qubit fluorometer (or equivalent for QC check)

Perform end-repair and dA-tailing as follows:

Mix the following reagents in a 1.5 ml Eppendorf DNA LoBind tube:

Reagent Volume
DNA 48 µl
Ultra II End-prep reaction buffer 7 µl
Ultra II End-prep enzyme mix 3 µl
Nuclease-free water 2 µl
Total 60 µl

Mix gently by flicking the tube, and spin down.

Transfer the sample to a 0.2 ml thin-walled PCR tube.

Using a thermal cycler, incubate at 20°C for 30 minutes and 65°C for 30 mins.

Resuspend the AMPure XP beads by vortexing.

Transferir la muestra a un tubo nuevo de 1,5 ml Eppendorf DNA Lobind.

Add 60 µl of resuspended AMPure XP beads to the end-prep reaction and mix by pipetting.

Incubar en el hula mixer (o mezclador rotatorio) durante 5 minutos a temperatura ambiente.

Prepare 500 μl of fresh 70% ethanol in nuclease-free water.

Centrifugar la muestra y precipitar en un imán. Dejar el tubo en el imán y retirar el sobrenadante con una pipeta.

Keep the tube on the magnet and wash the beads with 200 µl of freshly prepared 70% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.

Repetir el paso anterior.

Centrifugar y colocar el tubo de nuevo en el imán. Retirar con una pipeta cualquier residuo de etanol. Dejar secar el agregado durante 30 s aproximadamente, sin dejar que se agriete.

Remove the tube from the magnetic rack and resuspend pellet in 31 µl nuclease-free water. Incubate for 2 minutes at room temperature.

Precipitar las microesferas en un imán, durante al menos 1 minuto, hasta que el eluido se vuelva claro e incoloro.

Remove and retain 31 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.

Quantify 1 µl of end-prepped DNA using a Qubit fluorometer - recovery aim >300 ng.

FIN DEL PROCESO

Take forward approximately 300 ng of end-prepped DNA in 30 µl into adapter ligation.

12. Adapter ligation and clean-up

Material
  • Adapter Mix F (AMX F)
  • Ligation Buffer (LNB) (tampón de ligación) del kit Ligation Sequencing Kit
  • Short Fragment Buffer (SFB) (tampón para fragmentos cortos)
  • Elution Buffer (EB) (tampón de elución) del kit de Oxford Nanopore
Consumibles
  • NEBNext Quick Ligation Module (NEB E6056) (Módulo de ligación rápida)
  • Tubos de 1,5 ml Eppendorf DNA LoBind
  • Agencourt AMPure XP beads (Beckman Coulter™, A63881)
  • Nuclease-free water (e.g. ThermoFisher, AM9937)
Instrumental
  • Gradilla magnética
  • Microcentrífuga
  • Mezclador vórtex
  • Pipeta y puntas P1000
  • Pipeta y puntas P100
  • Pipeta y puntas P20
  • Pipeta y puntas P10
IMPORTANTE

Although the recommended third-party ligase is supplied with its own buffer, the ligation efficiency of Adapter Mix (AMX) is higher when using Ligation Buffer supplied within the Ligation Sequencing Kit.

Spin down the Adapter Mix F (AMX-F) and Quick T4 Ligase, and place on ice.

Descongelar el vial Ligation Buffer (LNB) a temperatura ambiente, centrifugar y mezclar con la pipeta. Debido a su viscosidad, la agitación en vórtex de este tampón es ineficaz. Tras descongelar y mezclar, colocar en hielo inmediatamente.

Descongelar el vial Elution Buffer (EB) a temperatura ambiente, agitar en vórtex, centrifugar y colocar en hielo.

Thaw one tube of Short Fragment Buffer (SFB) at room temperature and mix by vortexing. Then spin down and place on ice.

In a 1.5 ml Eppendorf DNA LoBind tube, mix in the following order:

Reagent Volume
DNA sample from the previous step 30 µl
Nuclease-free water 30 µl
Ligation Buffer (LNB) 25 µl
NEBNext Quick T4 DNA Ligase 10 µl
Adapter Mix F (AMX-F) 5 µl
Total 100 µl

Ensure the components are thoroughly mixed by pipetting, and spin down.

Incubar la reacción durante 10 minutos a temperatura ambiente.

IMPORTANTE

If you have omitted the AMPure purification step after DNA repair and end-prep, do not incubate the reaction for longer than 10 minutes.

Resuspend the AMPure XP beads by vortexing.

Add 40 µl of resuspended AMPure XP beads to the reaction and mix by flicking the tube.

Incubar en el mezclador Hula (o mezclador giratorio suave) durante 5 minutos a temperatura ambiente.

Centrifugar la muestra y precipitar en un imán. Dejar el tubo en el imán y retirar el sobrenadante con una pipeta.

Wash the beads by adding 250 μl Short Fragment Buffer (SFB) - do NOT use Long Fragment buffer (LFB). Flick the beads to resuspend, then return the tube to the magnetic rack and allow the beads to pellet. Remove the supernatant using a pipette and discard.

Repetir el paso anterior.

Centrifugar y colocar el tubo de nuevo en el imán. Retirar con una pipeta cualquier residuo de sobrenadante. Dejar secar el agregado durante 30 s aproximadamente, sin dejar que se agriete.

Quitar el tubo de la gradilla magnética y resuspender el agregado en 15 µl de Elution Buffer (EB). Centrifugar e incubar durante 10 minutos a temperatura ambiente. Tratándose de ADN de alto peso molecular, incubar a 37 ⁰C puede mejorar la recuperación de fragmentos largos.

Precipitar las microesferas en un imán, durante al menos 1 minuto, hasta que el eluido se vuelva claro e incoloro.

Extraer 15 μl del eluido que contiene la biblioteca de ADN y conservar en un tubo de 1,5 ml Eppendorf DNA LoBind.

Deshechar las microesferas precipitadas.

CHECKPOINT

Cuantificar 1 μl de muestra eluida utilizando un fluorímetro Qubit.

Use the average fragment size determined at the end of the “Elution and amplification of DNA” step to calculate the molarity of the sample.

Take 50 fmol of library and make up the volume to 12 μl with EB.

FIN DEL PROCESO

La biblioteca preparada se usará para cargar la celda de flujo. Conservar la biblioteca en hielo o a 4 °C hasta el momento de cargar.

CONSEJO

Library storage recommendations

We recommend storing libraries in Eppendorf DNA LoBind tubes at 4°C for short term storage or repeated use, for example, reloading flow cells between washes. For single use and long-term storage of more than 3 months, we recommend storing libraries at -80°C in Eppendorf DNA LoBind tubes. For further information, please refer to the DNA library stability Know-How document.

MEDIDA OPCIONAL

If quantities allow, the library may be diluted in Elution Buffer (EB) for splitting across multiple flow cells.

Additional buffer for doing this can be found in the Sequencing Auxiliary Vials expansion (EXP-AUX002), available to purchase separately. This expansion also contains additional vials of Sequencing Buffer II (SQII) and Loading Beads II (LBII), required for loading the libraries onto flow cells.

13. Priming and loading the SpotON flow cell

Material
  • Flush Buffer (FB)
  • Flush Tether (FLT)
  • Loading Beads II (LBII)
  • Sequencing Buffer II (SBII)
  • Loading Solution (LS)
Consumibles
  • Tubos de 1,5 ml Eppendorf DNA LoBind
Instrumental
  • MinION device
  • SpotON Flow Cell
  • Pipeta y puntas P1000
  • Pipeta y puntas P100
  • Pipeta y puntas P20
CONSEJO

Priming and loading a MinION flow cell

We recommend all new users watch the 'Priming and loading your flow cell' video before your first run.

Using the Loading Solution

We recommend using the Loading Beads II (LBII) for loading your library onto the flow cell for most sequencing experiments. However, if you have previously used water to load your library, you must use Loading Solution (LS) instead of water. Note: some customers have noticed that viscous libraries can be loaded more easily when not using Loading Beads II.

Thaw the Sequencing Buffer II (SBII), Loading Beads II (LBII) or Loading Solution (LS, if using), Flush Tether (FLT) and one tube of Flush Buffer (FB) at room temperature before mixing the reagents by vortexing and spin down at room temperature.

To prepare the flow cell priming mix, add 30 µl of thawed and mixed Flush Tether (FLT) directly to the tube of thawed and mixed Flush Buffer (FB), and mix by vortexing at room temperature.

Open the MinION device lid and slide the flow cell under the clip.

Press down firmly on the flow cell to ensure correct thermal and electrical contact.

Flow Cell Loading Diagrams Step 1a

Flow Cell Loading Diagrams Step 1b

MEDIDA OPCIONAL

Antes de cargar la biblioteca, verifique la celda de flujo para determinar el número de poros disponible.

Si se ha verificado con anterioridad la cantidad de poros presentes en la celda de flujo, este paso se puede omitir.

Dispone de más información en las instrucciones de comprobación de la celda de flujo, del protocolo de MinKNOW.

Abrir el puerto de cebado de la celda de flujo, deslizando la tapa en el sentido de las agujas del reloj.

Flow Cell Loading Diagrams Step 2

IMPORTANTE

Tenga cuidado a la hora de extraer el tampón de la celda de flujo. No retire más de 20-30 μl y asegúrese de que el tampón cubra la matriz de poros en todo momento. La introducción de burbujas de aire en la matriz puede dañar los poros de manera irreversible.

Tras abrir el puerto de cebado, verificar si hay una burbuja de aire bajo la tapa. Retirar una pequeña cantidad de tampón para quitar las burbujas:

  1. Ajustar una pipeta P1000 a 200 μl.
  2. Introducir la punta de la pipeta en el puerto de cebado.
  3. Girar la rueda hasta que el indicador de volumen marque 220-230 μl o hasta que se pueda ver una pequeña cantidad de tampón entrar en la punta de la pipeta.

Nota: Comprobar que haya un flujo continuo de tampón circulando desde el puerto de cebado a través de la matriz de poros.

Flow Cell Loading Diagrams Step 03 V5

Cargar 800 μl de solución en el puerto de cebado, evitando introducir burbujas de aire. Esperar 5 minutos. Durante este tiempo, preparar la biblioteca para cargar siguiendo los pasos a continuación.

Flow Cell Loading Diagrams Step 04 V5 SPANISH

Thoroughly mix the contents of the Loading Beads II (LBII) by pipetting.

IMPORTANTE

The Loading Beads II (LBII) tube contains a suspension of beads. These beads settle very quickly. It is vital that they are mixed immediately before use.

In a new tube, prepare the library for loading as follows:

Reagent Volume per flow cell
Sequencing Buffer II (SBII) 37.5 µl
Loading Beads II (LBII) mixed immediately before use, or Loading Solution (LS), if using 25.5 µl
DNA library 12 µl
Total 75 µl

Note: Load the library onto the flow cell immediately after adding the Sequencing Buffer II (SBII) and Loading Beads II (LBII).

Completar el cebado de la celda de flujo:

  1. Levantar suavemente la tapa del puerto de carga SpotON.
  2. Cargar 200 µl de solución en el puerto de cebado (no en el puerto de muestra SpotON), evitando introducir burbujas de aire.

Flow Cell Loading Diagrams Step 5

Flow Cell Loading Diagrams Step 06 V5 SPANISH 2

Mezclar la biblioteca pipeteando suavemente, justo antes de cargar.

Añadir, gota a gota, 75 μl de la biblioteca preparada en el puerto de muestra SpotON. Procurar que cada gota fluya hacia adentro del puerto antes de añadir la siguiente.

Flow Cell Loading Diagram Step 07 V5 SPANISH

Gently replace the SpotON sample port cover, making sure the bung enters the SpotON port, close the priming port and replace the MinION device lid.

Flow Cell Loading Diagrams Step 8

Flow Cell Loading Diagrams Step 9

14. Data acquisition and basecalling

Aspectos generales del análisis de datos de nanoporos

Para obtener una descripción completa del análisis de datos de nanoporos, que incluya distintas posibilidades para el análisis de identificación y postidentificicación de bases, consultar el documento Data Analysis.

Cómo empezar a secuenciar

El programa MinKNOW realiza el control del dispositivo de secuenciación, la adquisición de datos y la identificación de bases en tiempo real. Una vez que el usuario ha instalado MinKNOW en su ordenador, hay diferentes maneras de llevar a cabo la secuenciación:

1. Adquisición de datos e identificación de bases en tiempo real con el programa MinKNOW.

Seguir las instrucciones del protocolo de MinKNOW, desde el apartado "Starting a sequencing run" hasta el final del apartado "Completing a MinKNOW run".

2. Adquisición de datos e identificación de bases en tiempo real con el dispositivo GridION.

Seguir las instrucciones del manual de usuario de GridION.

3. Adquisición de datos e identificación de bases en tiempo real con el dispositivo MinION Mk1C.

Seguir las instrucciones del manual de usuario de MinION Mk1C.

4. Adquisición de datos e identificación de bases en tiempo real con el dispositivo PromethION.

Seguir las instrucciones de los manuales de usuario de PromethION o PromethION 2 Solo.

5. Adquisición de datos e identificación de bases posterior mediante MinKNOW.

Seguir las instrucciones del protocolo de MinKNOW, desde el apartado "Starting a sequencing run" hasta el final del apartado "Completing a MinKNOW run". Al configurar los parámetros del experimento, ajustar la pestaña Basecalling (Identificación de bases) en posición de APAGADO. Al terminar el experimento de secuenciación, seguir las instrucciones del apartado "Post-run analysis" del protocolo de MinKNOW.

15. Downstream analysis

FASTQ Human Exome workflow in EPI2ME

Human Exome is an EPI2ME™ workflow for aligning basecalled reads to a set of reference sequences from Ensembl using the minimap2 aligner, covering the entire human exome. Alignments are performed against full gene sequences, including exons and introns, but currently not against flanking regions. The reference sequences are taken from the feature strand of the most recent human genome assembly, GRCh38.

The experiment report gives details on sequence length, accuracy, quality score and the amount of data generated during the experiment. It is possible to align to a number of human reference genes, and view more details about alignment coverage and accuracy.

For more information, please refer to the Workflows section in the EPI2ME protocol.

Suggested workflow

  1. Align reads to the human reference genome (GRCh38 or GRCh37) using minimap2. We recommend using -k parameter value 13
  2. (Optional) Remove reads that do not overlap with pull-down regions

Example data

Expected mean target coverage from one MinION Mk 1B flow cell: sequence depth

Aligned read length: Read length

Other data analysis options

1. Bioinformatics tutorials

For more in-depth data analysis, Oxford Nanopore Technologies offers a range of bioinformatics tutorials, which are available in the Bioinformatics resource section of the Community. The tutorials take the user through installing and running pre-built analysis pipelines, which generate a report with the results. The tutorials are aimed at biologists who would like to analyse data without the help of a dedicated bioinformatician, and who are comfortable using the command line.

2. Research analysis tools

Oxford Nanopore Technologies' Research division has created a number of analysis tools, which are available in the Oxford Nanopore GitHub repository. The tools are aimed at advanced users, and contain instructions for how to install and run the software. They are provided as-is, with minimal support.

3. Community-developed analysis tools

If a data analysis method for your research question is not provided in any of the resources above, we recommend the Community-developed data analysis tool library. Numerous members of the Nanopore Community have developed their own tools and pipelines for analysing nanopore sequencing data, most of which are available on GitHub. Please be aware that these tools are not supported by Oxford Nanopore Technologies, and are not guaranteed to be compatible with the latest chemistry/software configuration.

16. Reutilización y devoluciones de las celdas de flujo

Material
  • Flow Cell Wash Kit (EXP-WSH004) (kit de lavado de celda de flujo)

Si al terminar el experimento desea volver a usar la celda de flujo, siga las instrucciones del protocolo Flow Cell Wash Kit y guarde la celda de flujo lavada a 2-8 ⁰C.

El protocolo Flow Cell Wash Kit está disponible en la comunidad Nanopore.

CONSEJO

Una vez terminado el experimento, recomendamos lavar la celda de flujo cuanto antes. Si no es posible, se puede dejar en el dispositivo y lavar al día siguiente.

Otra posibilidad es seguir el procedimiento de devolución para lavar la celda de flujo y enviarla a Oxford Nanopore.

Aquí puede encontrar las instrucciones para devolver celdas de flujo.

Nota: Antes de proceder a su devolución, las celdas de flujo deben lavarse con agua desionizada.

IMPORTANTE

Ante cualquier duda o pregunta acerca del experimento de secuenciación, consulte la guía de resolución de problemas, Troubleshooting Guide, que se encuentra en la versión en línea de este protocolo.

17. Problemas durante la extracción de ADN/ARN y la preparación de bibliotecas

A continuación hay una lista de los problemas más frecuentes, con algunas posibles causas y soluciones propuestas.

También disponemos de una página de preguntas frecuentes, FAQ, en la sección Support de la comunidad Nanopore.

Si ha probado las soluciones propuestas y continúa teniendo problemas, póngase en contacto con el departamento de asistencia técnica, bien por correo electrónico (support@nanoporetech.com) o a través del Live Chat de la comunidad Nanopore.

Baja calidad de la muestra

Observación Posible causa Comentarios y acciones recomendadas
Baja pureza del ADN (la lectura del Nanodrop para ADN OD 260/280 es <1,8 y OD 260/230 es <2,0-2,2) El método de extracción de ADN no proporciona la pureza necesaria Los efectos de los contaminantes se muestran en la página Contaminants. Pruebe con un método de extracción alternativo que no provoque el arrastre de contaminantes.

Considere realizar un paso adicional de limpieza SPRI.
Baja integridad del ARN (número de integridad del ARN <9,5 RIN o la banda ARNr se muestra como una mancha en el gel). El ARN se degradó durante la extracción Probar un método de extracción de ARN diferente. Encontrará más información sobre RIN en la página RNA Integrity Number. Asimismo, dispone de información adicional en la página DNA/RNA Handling.
El ARN tiene una longitud de fragmento más corta de lo esperado El ARN se degradó durante la extracción Probar un método de extracción de ARN diferente. Encontrará más información sobre RIN en la página RNA Integrity Number. Asimismo, dispone de información adicional en la página DNA/RNA Handling.

Cuando se trabaje con ARN, recomendamos que el espacio de trabajo y el instrumental de laboratorio estén libres de ribonucleasas.

Escasa recuperación de ADN tras la limpieza con microesferas magnéticas AMPure

Observación Posible causa Comentarios y acciones recomendadas
Escasa recuperación Pérdida de ADN debido a una proporción de microesferas magnéticas AMPure por muestra inferior a lo previsto. 1. Las microesferas magnéticas AMPure precipitan con rapidez; antes de añadirlas a la muestra hay que asegurarse de que estén bien resuspendidas.

2. Si la proporción de microesferas por muestra es inferior a 0.4:1, los fragmentos de ADN, sean del tamaño que sean, se perderán durante la limpieza.
Escasa recuperación Los fragmentos de ADN son más cortos de lo esperado Cuanto menor sea la proporción de microesferas magnéticas AMPure por muestra, más rigurosa será la selección de fragmentos largos frente a los cortos. Determinar siempre la longitud de la muestra de ADN en un gel de agarosa u otros métodos de electroforesis en gel, y, a continuación, calcular la cantidad adecuada de microesferas magnéticas que se debe utilizar. SPRI cleanup
Escasa recuperación tras la preparación de extremos El paso de lavado utilizó etanol a <70 % Cuando se utilice etanol a <70 %, el ADN se eluirá de las microesferas magnéticas. Asegúrese de utilizar el porcentaje correcto.

18. Issues during the sequencing run

A continuación hay una lista de los problemas más frecuentes, con algunas posibles causas y soluciones propuestas.

También disponemos de una página de preguntas frecuentes, FAQ, en la sección Support de la comunidad Nanopore.

Si ha probado las soluciones propuestas y continúa teniendo problemas, póngase en contacto con el departamento de asistencia técnica, bien por correo electrónico (support@nanoporetech.com) o a través del Live Chat de la comunidad Nanopore.

Menos poros al inicio de la secuenciación que después de verificar la celda de flujo

Observación Posible causa Comentarios y acciones recomendadas
MinKNOW presentó al inicio de la secuenciación un número de poros inferior al indicado durante la comprobación de la celda de flujo Se introdujo una burbuja de aire en la matriz de nanoporos Tras comprobar el número de poros presente en la celda de flujo, es imprescindible quitar las burbujas que haya cerca del puerto de cebado. Si no se quitan, pueden desplazarse a la matriz de nanoporos y dañar de manera irreversible los nanoporos expuestos al aire. En este vídeo se muestran algunas buenas prácticas para evitar que esto ocurra.
MinKNOW presentó al inicio de la secuenciación un número de poros inferior al indicado durante la comprobación de la celda de flujo La celda de flujo no está colocada correctamente Detener el ciclo de secuenciación, quitar la celda de flujo del dispositivo e insertarla de nuevo. Comprobar que está firmemente asentada en el dispositivo y que ha alcanzado la temperatura deseada. Si procede, probar con una posición diferente del dispositivo (GriION/PromethION).
MinKNOW presentó al inicio de la secuenciación un número de poros inferior al indicado durante la comprobación de la celda de flujo La presencia de contaminantes en la biblioteca ha dañado o bloqueado los poros El número de poros resultante tras la comprobación de la celda de flujo se realiza usando el control de calidad de las moléculas de ADN presentes en el tampón de almacenamiento de la celda de flujo. Al inicio de la secuenciación, se utiliza la misma biblioteca para estimar el número de poros activos. Por este motivo, se estima que puede haber una variabilidad del 10 % en el número de poros detectados. Tener un número de poros considerablemente inferior al inicio de la secuenciación puede deberse a la presencia de contaminantes en la biblioteca que hayan dañado las membranas o bloqueado los poros. Para mejorar la pureza del material de entrada tal vez sea necesario usar métodos de purificación o extracción de ADN/ARN alternativos. Los efectos de los contaminantes están descritos en la página Contaminants. Se recomienda, probar con un método de extracción alternativo que no provoque el arrastre de contaminantes.

Error en el script de MinKNOW

Observación Posible causa Comentarios y acciones recomendadas
MinKNOW muestra el mensaje "Error en el script"
Reiniciar el ordenador y reiniciar MinKNOW. Si el problema continúa, reúna los archivos de registro MinKNOW log files y contacte con el servicio de asistencia técnica. Si no dispone de otro dispositivo de secuenciación, recomendamos que guarde la celda de flujo con la biblioteca cargada a 4 °C y contacte con el servicio de asistencia técnica para recibir recomendaciones de almacenamiento adicionales.

Pore occupancy below 40%

Observation Possible cause Comments and actions
Pore occupancy <40% Not enough library was loaded on the flow cell Ensure you load the recommended amount of good quality library in the relevant library prep protocol onto your flow cell. Please quantify the library before loading and calculate mols using tools like the Promega Biomath Calculator, choosing "dsDNA: µg to pmol"
Pore occupancy close to 0 The Ligation Sequencing Kit was used, and sequencing adapters did not ligate to the DNA Make sure to use the NEBNext Quick Ligation Module (E6056) and Oxford Nanopore Technologies Ligation Buffer (LNB, provided in the sequencing kit) at the sequencing adapter ligation step, and use the correct amount of each reagent. A Lambda control library can be prepared to test the integrity of the third-party reagents.
Pore occupancy close to 0 The Ligation Sequencing Kit was used, and ethanol was used instead of LFB or SFB at the wash step after sequencing adapter ligation Ethanol can denature the motor protein on the sequencing adapters. Make sure the LFB or SFB buffer was used after ligation of sequencing adapters.
Pore occupancy close to 0 No tether on the flow cell Tethers are adding during flow cell priming (FLT/FCT tube). Make sure FLT/FCT was added to FB/FCF before priming.

Longitud de lectura más corta de lo esperado

Observación Posible causa Comentarios y acciones recomendadas
Longitud de lectura más corta de lo esperado Fragmentación no deseada de la muestra de ADN La longitud de lectura refleja la longitud del fragmento de la muestra de ADN. La muestra de ADN se puede fragmentar durante la extracción de la preparación de la biblioteca.

1. Consulte la sección de buenas prácticas de los métodos de extracción en la página Extraction Methods de la comunidad Nanopore.

2. Visualizar la distribución de la longitud de los fragmentos de las muestras de ADN en un gel de agarosa antes de proceder a la preparación de la biblioteca. DNA gel2 En la imagen superior, la muestra 1 contiene alto peso molecular, mientras que la muestra 2 se ha fragmentado.

3. Durante la preparación de la biblioteca, evitar pipetear y agitar en vórtex cuando se mezclen los reactivos. Dar suaves golpes con el dedo o invertir el vial es suficiente.

Gran proporción de poros no disponibles

Observación Posible causa Comentarios y acciones recomendadas
Gran proporción de poros no disponibles (se muestran en azul oscuro en el panel de canales y en el gráfico de actividad de poros)

image2022-3-25 10-43-25 Conforme pasa el tiempo, el gráfico de actividad de poros de arriba muestra una proporción creciente de poros no disponibles.		 Hay contaminantes presentes en la muestra Algunos contaminantes se pueden eliminar de los poros mediante la función de desbloqueo incorporada en MinKNOW. Si funciona, el estado de los poros cambiará a "sequencing pores" (secuenciación de poros). Si la porción poros no disponibles se mantiene elevada o aumenta, pruebe una de las siguientes opciones:

1. Realizar un enjuague de nucleasa con el kit de lavado Flow Cell Wash Kit (EXP-WSH004)
2. Realizar varios ciclos de PCR para intentar diluir cualquier contaminante que pueda estar causando problemas.

Gran proporción de poros inactivos

Observación Posible causa Comentarios y acciones recomendadas
Gran proporción de poros inactivos/no disponibles (se muestran en azul claro en el panel de canales y en el gráfico de actividad de poros. Los poros o membranas están dañados de manera irreversible) Se han introducido burbujas de aire en la celda de flujo Las burbujas de aire introducidas durante el cebado de la celda y la carga de la biblioteca pueden dañar los poros de forma permanente. Para conocer las buenas prácticas de cebado y carga de la celda de flujo, ver el vídeo Priming and loading your flow cell
Gran proporción de poros inactivos/no disponibles Ciertos compuestos copurificados con ADN Compuestos conocidos, incluidos los polisacáridos, se asocian generalmente con el ADN genómico de las plantas.

1. Consulte la página Plant leaf DNA extraction method.
2. Limpiar usando el kit QIAGEN PowerClean Pro.
3. Realizar una amplificación del genoma completo con la muestra original de ADNg utilizando el kit QIAGEN REPLI-g.
Gran proporción de poros inactivos/no disponibles Hay contaminantes presentes en la muestra Los efectos de los contaminantes se muestran en la página Contaminants. Probar con un método de extracción alternativo que no provoque el arrastre de contaminantes.

Reducción de la velocidad de secuenciación y del índice de calidad Qscore en una fase avanzada de la secuenciación

Observación Posible causa Comentarios y acciones recomendadas
Reducción de la velocidad de secuenciación y el índice de calidad Qscore en una fase avanzada de la secuenciación En la química del kit 9 (p. ej., SQK-LSK109), cuando la celda de flujo está sobrecargada con la biblioteca se observa un consumo rápido de combustible (consulte el protocolo correspondiente a su biblioteca de ADN para ver las recomendaciones) Añadir más combustible a la celda de flujo, siguiendo las instrucciones en el protocolo de MinKNOW. En futuros experimentos, cargar cantidades menores de biblioteca en la celda de flujo.

Fluctuación de la temperatura

Observación Posible causa Comentarios y acciones recomendadas
Fluctuación de la temperatura La celda de flujo ha perdido contacto con el dispositivo Comprobar que una almohadilla térmica cubra la placa metálica de la parte posterior de la celda de flujo. Reinsertar la celda de flujo y presionar para asegurarse de que las clavijas del conector estén bien conectadas al dispositivo. Si el problema continúa, contacte con el servicio de asistencia técnica.

Error al intentar alcanzar la temperatura deseada

Observación Posible causa Comentarios y acciones recomendadas
MinKNOW muestra el mensaje "Error al intentar alcanzar la temperatura deseada" El dispositivo ha sido colocado en un lugar a una temperatura ambiente inferior a la media o en un lugar con escasa ventilación (lo que provoca el sobrecalientamiento de las celdas de flujo). MinKNOW tiene un tiempo predeterminado para que las celdas de flujo alcancen la temperatura fijada. Una vez acabado el tiempo, aparece un mensaje de error, pero el experimento de secuenciación continua. Secuenciar a una temperatura incorrecta puede llevar a una disminución en el rendimiento y a generar un índice de calidad Qscore menor. Corrija la ubicación del dispositivo, procure que esté a temperatura ambiente y tenga buena ventilación; a continuación, reinicie el proceso en MinKNOW. Para obtener más información sobre el control de temperatura de MinKNOW Mk 1B, consulte la sección de preguntas frecuentes, FAQ.

Guppy – no input .fast5 was found or basecalled

Observation Possible cause Comments and actions
No input .fast5 was found or basecalled input_path did not point to the .fast5 file location The --input_path has to be followed by the full file path to the .fast5 files to be basecalled, and the location has to be accessible either locally or remotely through SSH.
No input .fast5 was found or basecalled The .fast5 files were in a subfolder at the input_path location To allow Guppy to look into subfolders, add the --recursive flag to the command

Guppy – no Pass or Fail folders were generated after basecalling

Observation Possible cause Comments and actions
No Pass or Fail folders were generated after basecalling The --qscore_filtering flag was not included in the command The --qscore_filtering flag enables filtering of reads into Pass and Fail folders inside the output folder, based on their strand q-score. When performing live basecalling in MinKNOW, a q-score of 7 (corresponding to a basecall accuracy of ~80%) is used to separate reads into Pass and Fail folders.

Guppy – unusually slow processing on a GPU computer

Observation Possible cause Comments and actions
Unusually slow processing on a GPU computer The --device flag wasn't included in the command The --device flag specifies a GPU device to use for accelerate basecalling. If not included in the command, GPU will not be used. GPUs are counted from zero. An example is --device cuda:0 cuda:1, when 2 GPUs are specified to use by the Guppy command.

Last updated: 3/10/2023

Document options

MinION