Ligation sequencing gDNA - Multiplex Ligation Sequencing Kit XL (SQK-MLK111.96-XL) (MLK_9144_v111_revJ_11Mar2026)
PromethION: Protocol
V MLK_9144_v111_revJ_11Mar2026
FOR RESEARCH USE ONLY.
Contents
Introduction to the protocol
Library preparation
- 4. DNA repair and end-prep
- 5. Native barcode ligation
- 6. Adapter ligation and clean-up
- 7. Priming and loading multiple flow cells on a PromethION
Sequencing and data analysis
Troubleshooting
1. Overview of the protocol
This is a Legacy product.
This product has been discontinued. Should you require any assistance or have questions, please contact our Customer Support: support@nanoporetech.com.
Multiplex Ligation Sequencing Kit XL features
This kit is recommended for users who:
- Want to optimise their sequencing experiment for output
- Wish to low-plex samples for Whole Genome Sequencing (WGS)
- Need a PCR-free method of multiplexing to preserve additional information, such as base modifications
- Require control over read length
- Would like to utilise upstream processes, such as size selection or whole genome amplification
Introduction to the manual Multiplex Ligation Sequencing Kit XL protocol
This protocol describes how to carry out native barcoding of genomic DNA using the Multiplex Ligation Sequencing Kit XL (SQK-MLK111.96-XL). This kit is designed to enable low-plex sequencing and this manual protocol outlines how to sequence two samples across one flow cell. This enables users to sequence 96 samples across 48 flow cells to provide an easier workflow for whole genome sequencing (WGS).
To efficiently load multiple PromethION Flow Cells, we recommend using the Loading multiple PromethION Flow Cells protocol as a guideline.
Steps in the sequencing workflow: Prepare for your experiment You will need to:
- Extract your DNA, and check its length, quantity and purity. The quality checks performed during the protocol are essential in ensuring experimental success.
- Ensure you have your sequencing kit, the correct equipment and third-party reagents
- Download the software for acquiring and analysing your data
- Check your flow cell to ensure it has enough pores for a good sequencing run
Prepare your library
You will need to:
- Repair the DNA, and prepare the DNA ends for adapter attachment
- Ligate Native barcodes supplied in the kit to the DNA ends
- Ligate sequencing adapters supplied in the kit to the DNA ends
- Prime the flow cell, and load your DNA library into the flow cell
Sequencing
You will need to:
- Start a sequencing run using the MinKNOW software, which will collect raw data from the device and convert it into basecalled reads
- Demultiplex barcoded reads in MinKNOW or the Guppy software
- Start the EPI2ME software and select a workflow for further analysis (this step is optional)
We do not recommend mixing barcoded libraries with non-barcoded libraries prior to sequencing.
Optional fragmentation and size selection
By default, the protocol contains no DNA fragmentation step, however in some cases it may be advantageous to fragment your sample. For example, when working with lower amounts of input gDNA (100 ng – 500 ng), fragmentation will increase the number of DNA molecules and therefore increase throughput. Instructions are available in the DNA Fragmentation section of Extraction methods.
Additionally, we offer several options for size-selecting your DNA sample to enrich for long fragments - instructions are available in the Size Selection section of Extraction methods.
Compatibility of this protocol
This protocol should only be used in combination with:
- Multiplex Ligation Sequencing Kit XL (SQK-MLK111.96-XL)
- R9.4.1 flow cells (FLO-PRO002)
- Flow Cell Wash Kit (EXP-WSH004)
2. Equipment and consumables
Material
- Multiplex Ligation Sequencing Kit XL (SQK-MLK111.96-XL)
- 1000 ng gDNA per sample
Consumibles
- Mezcla maestra de ligasa NEB Blunt/TA (NEB, M0367)
- NEBNext® Quick Ligation Reaction Buffer (NEB, B6058)
- NEBNext FFPE Repair Mix (NEB M6630)
- NEBNext Ultra II End Repair/dA-tailing Module (NEB E7546)
- NEBNext Quick Ligation Module (NEB E6056)
- Tubos Eppendorf DNA LoBind de 1,5 ml
- Tubos de PCR de pared fina, 0,2 ml
- Tubos Qubit™ Assay (Invitrogen, Q32856)
- Agua sin nucleasas (p.ej. Thermo Scientific, AM9937)
- Etanol al 70 % recién preparado en agua sin nucleasas
- Microesferas Agencourt AMPure XP (Beckman Coulter™, A63881)
- Kit Qubit dsDNA HS (Invitrogen Q32851)
Instrumental
- Hula mixer (mezclador de rotación suave)
- Microcentrífuga
- Gradilla magnética
- Mezclador vórtex
- Termociclador
- Pipeta y puntas P1000
- Pipeta y puntas P200
- Pipeta y puntas P100
- Pipeta y puntas P20
- Pipeta y puntas P10
- Pipeta y puntas P2
- Cubeta con hielo
- Temporizador
- Qubit fluorometer (or equivalent)
Equipo opcional
- Bioanalizador Agilent (o equivalente)
- Centrifugadora Eppendorf 5424 (o equivalente)
For this protocol, you will need 1000 ng gDNA per sample for R9.4.1 flow cells.
Input DNA
How to QC your input DNA
It is important that the input DNA meets the quantity and quality requirements. Using too little or too much DNA, or DNA of poor quality (e.g. highly fragmented or containing RNA or chemical contaminants) can affect your library preparation.
For instructions on how to perform quality control of your DNA sample, please read the Input DNA/RNA QC protocol.
Chemical contaminants
Depending on how the DNA is extracted from the raw sample, certain chemical contaminants may remain in the purified DNA, which can affect library preparation efficiency and sequencing quality. Read more about contaminants on the Contaminants page of the Community.
Convenient reagent kits are available on request from NEB for the Multiplex Ligation Sequencing Kit XL.
This will contain the appropriate NEB reagents and the required volumes for the protocol on the Hamilton NGS STAR 96. For more information from NEB, please see "Find Products for Nanopore Sequencing".
Multiplex Ligation Sequencing Kit XL (SQK-MLK111.96-XL) contents
| Name | Acronym | Cap colour | Number of vials | Fill volume per vial (µl) |
|---|---|---|---|---|
| Adapter Mix II T | AMII T | Green | 1 | 320 |
| Sequencing Buffer II | SBII | Red | 4 | 1,500 |
| Loading Beads II | LBII | Pink | 4 | 1,500 |
| Loading Solution | LS | White cap, pink sticker | 4 | 1,500 |
| EDTA | EDTA | Clear | 1 | 700 |
| Elution Buffer | EB | 15 ml bottle | 1 | 10,000 |
| Long Fragment Buffer | LFB | 30 ml bottle | 1 | 20,000 |
| Flush Buffer XL | FB | 30 ml bottle | 6 | 15,500 |
| Flush Tether | FLT | White cap, purple sticker | 2 | 1,600 |
| Native Barcodes | NB01-96 | N/a | 1 plate | 8 µl per well |
Native barcode sequences
| Component | Forward sequence | Reverse sequence |
|---|---|---|
| NB01 | CACAAAGACACCGACAACTTTCTT | AAGAAAGTTGTCGGTGTCTTTGTG |
| NB02 | ACAGACGACTACAAACGGAATCGA | TCGATTCCGTTTGTAGTCGTCTGT |
| NB03 | CCTGGTAACTGGGACACAAGACTC | GAGTCTTGTGTCCCAGTTACCAGG |
| NB04 | TAGGGAAACACGATAGAATCCGAA | TTCGGATTCTATCGTGTTTCCCTA |
| NB05 | AAGGTTACACAAACCCTGGACAAG | CTTGTCCAGGGTTTGTGTAACCTT |
| NB06 | GACTACTTTCTGCCTTTGCGAGAA | TTCTCGCAAAGGCAGAAAGTAGTC |
| NB07 | AAGGATTCATTCCCACGGTAACAC | GTGTTACCGTGGGAATGAATCCTT |
| NB08 | ACGTAACTTGGTTTGTTCCCTGAA | TTCAGGGAACAAACCAAGTTACGT |
| NB09 | AACCAAGACTCGCTGTGCCTAGTT | AACTAGGCACAGCGAGTCTTGGTT |
| NB10 | GAGAGGACAAAGGTTTCAACGCTT | AAGCGTTGAAACCTTTGTCCTCTC |
| NB11 | TCCATTCCCTCCGATAGATGAAAC | GTTTCATCTATCGGAGGGAATGGA |
| NB12 | TCCGATTCTGCTTCTTTCTACCTG | CAGGTAGAAAGAAGCAGAATCGGA |
| NB13 | AGAACGACTTCCATACTCGTGTGA | TCACACGAGTATGGAAGTCGTTCT |
| NB14 | AACGAGTCTCTTGGGACCCATAGA | TCTATGGGTCCCAAGAGACTCGTT |
| NB15 | AGGTCTACCTCGCTAACACCACTG | CAGTGGTGTTAGCGAGGTAGACCT |
| NB16 | CGTCAACTGACAGTGGTTCGTACT | AGTACGAACCACTGTCAGTTGACG |
| NB17 | ACCCTCCAGGAAAGTACCTCTGAT | ATCAGAGGTACTTTCCTGGAGGGT |
| NB18 | CCAAACCCAACAACCTAGATAGGC | GCCTATCTAGGTTGTTGGGTTTGG |
| NB19 | GTTCCTCGTGCAGTGTCAAGAGAT | ATCTCTTGACACTGCACGAGGAAC |
| NB20 | TTGCGTCCTGTTACGAGAACTCAT | ATGAGTTCTCGTAACAGGACGCAA |
| NB21 | GAGCCTCTCATTGTCCGTTCTCTA | TAGAGAACGGACAATGAGAGGCTC |
| NB22 | ACCACTGCCATGTATCAAAGTACG | CGTACTTTGATACATGGCAGTGGT |
| NB23 | CTTACTACCCAGTGAACCTCCTCG | CGAGGAGGTTCACTGGGTAGTAAG |
| NB24 | GCATAGTTCTGCATGATGGGTTAG | CTAACCCATCATGCAGAACTATGC |
| NB25 | GTAAGTTGGGTATGCAACGCAATG | CATTGCGTTGCATACCCAACTTAC |
| NB26 | CATACAGCGACTACGCATTCTCAT | ATGAGAATGCGTAGTCGCTGTATG |
| NB27 | CGACGGTTAGATTCACCTCTTACA | TGTAAGAGGTGAATCTAACCGTCG |
| NB28 | TGAAACCTAAGAAGGCACCGTATC | GATACGGTGCCTTCTTAGGTTTCA |
| NB29 | CTAGACACCTTGGGTTGACAGACC | GGTCTGTCAACCCAAGGTGTCTAG |
| NB30 | TCAGTGAGGATCTACTTCGACCCA | TGGGTCGAAGTAGATCCTCACTGA |
| NB31 | TGCGTACAGCAATCAGTTACATTG | CAATGTAACTGATTGCTGTACGCA |
| NB32 | CCAGTAGAAGTCCGACAACGTCAT | ATGACGTTGTCGGACTTCTACTGG |
| NB33 | CAGACTTGGTACGGTTGGGTAACT | AGTTACCCAACCGTACCAAGTCTG |
| NB34 | GGACGAAGAACTCAAGTCAAAGGC | GCCTTTGACTTGAGTTCTTCGTCC |
| NB35 | CTACTTACGAAGCTGAGGGACTGC | GCAGTCCCTCAGCTTCGTAAGTAG |
| NB36 | ATGTCCCAGTTAGAGGAGGAAACA | TGTTTCCTCCTCTAACTGGGACAT |
| NB37 | GCTTGCGATTGATGCTTAGTATCA | TGATACTAAGCATCAATCGCAAGC |
| NB38 | ACCACAGGAGGACGATACAGAGAA | TTCTCTGTATCGTCCTCCTGTGGT |
| NB39 | CCACAGTGTCAACTAGAGCCTCTC | GAGAGGCTCTAGTTGACACTGTGG |
| NB40 | TAGTTTGGATGACCAAGGATAGCC | GGCTATCCTTGGTCATCCAAACTA |
| NB41 | GGAGTTCGTCCAGAGAAGTACACG | CGTGTACTTCTCTGGACGAACTCC |
| NB42 | CTACGTGTAAGGCATACCTGCCAG | CTGGCAGGTATGCCTTACACGTAG |
| NB43 | CTTTCGTTGTTGACTCGACGGTAG | CTACCGTCGAGTCAACAACGAAAG |
| NB44 | AGTAGAAAGGGTTCCTTCCCACTC | GAGTGGGAAGGAACCCTTTCTACT |
| NB45 | GATCCAACAGAGATGCCTTCAGTG | CACTGAAGGCATCTCTGTTGGATC |
| NB46 | GCTGTGTTCCACTTCATTCTCCTG | CAGGAGAATGAAGTGGAACACAGC |
| NB47 | GTGCAACTTTCCCACAGGTAGTTC | GAACTACCTGTGGGAAAGTTGCAC |
| NB48 | CATCTGGAACGTGGTACACCTGTA | TACAGGTGTACCACGTTCCAGATG |
| NB49 | ACTGGTGCAGCTTTGAACATCTAG | CTAGATGTTCAAAGCTGCACCAGT |
| NB50 | ATGGACTTTGGTAACTTCCTGCGT | ACGCAGGAAGTTACCAAAGTCCAT |
| NB51 | GTTGAATGAGCCTACTGGGTCCTC | GAGGACCCAGTAGGCTCATTCAAC |
| NB52 | TGAGAGACAAGATTGTTCGTGGAC | GTCCACGAACAATCTTGTCTCTCA |
| NB53 | AGATTCAGACCGTCTCATGCAAAG | CTTTGCATGAGACGGTCTGAATCT |
| NB54 | CAAGAGCTTTGACTAAGGAGCATG | CATGCTCCTTAGTCAAAGCTCTTG |
| NB55 | TGGAAGATGAGACCCTGATCTACG | CGTAGATCAGGGTCTCATCTTCCA |
| NB56 | TCACTACTCAACAGGTGGCATGAA | TTCATGCCACCTGTTGAGTAGTGA |
| NB57 | GCTAGGTCAATCTCCTTCGGAAGT | ACTTCCGAAGGAGATTGACCTAGC |
| NB58 | CAGGTTACTCCTCCGTGAGTCTGA | TCAGACTCACGGAGGAGTAACCTG |
| NB59 | TCAATCAAGAAGGGAAAGCAAGGT | ACCTTGCTTTCCCTTCTTGATTGA |
| NB60 | CATGTTCAACCAAGGCTTCTATGG | CCATAGAAGCCTTGGTTGAACATG |
| NB61 | AGAGGGTACTATGTGCCTCAGCAC | GTGCTGAGGCACATAGTACCCTCT |
| NB62 | CACCCACACTTACTTCAGGACGTA | TACGTCCTGAAGTAAGTGTGGGTG |
| NB63 | TTCTGAAGTTCCTGGGTCTTGAAC | GTTCAAGACCCAGGAACTTCAGAA |
| NB64 | GACAGACACCGTTCATCGACTTTC | GAAAGTCGATGAACGGTGTCTGTC |
| NB65 | TTCTCAGTCTTCCTCCAGACAAGG | CCTTGTCTGGAGGAAGACTGAGAA |
| NB66 | CCGATCCTTGTGGCTTCTAACTTC | GAAGTTAGAAGCCACAAGGATCGG |
| NB67 | GTTTGTCATACTCGTGTGCTCACC | GGTGAGCACACGAGTATGACAAAC |
| NB68 | GAATCTAAGCAAACACGAAGGTGG | CCACCTTCGTGTTTGCTTAGATTC |
| NB69 | TACAGTCCGAGCCTCATGTGATCT | AGATCACATGAGGCTCGGACTGTA |
| NB70 | ACCGAGATCCTACGAATGGAGTGT | ACACTCCATTCGTAGGATCTCGGT |
| NB71 | CCTGGGAGCATCAGGTAGTAACAG | CTGTTACTACCTGATGCTCCCAGG |
| NB72 | TAGCTGACTGTCTTCCATACCGAC | GTCGGTATGGAAGACAGTCAGCTA |
| NB73 | AAGAAACAGGATGACAGAACCCTC | GAGGGTTCTGTCATCCTGTTTCTT |
| NB74 | TACAAGCATCCCAACACTTCCACT | AGTGGAAGTGTTGGGATGCTTGTA |
| NB75 | GACCATTGTGATGAACCCTGTTGT | ACAACAGGGTTCATCACAATGGTC |
| NB76 | ATGCTTGTTACATCAACCCTGGAC | GTCCAGGGTTGATGTAACAAGCAT |
| NB77 | CGACCTGTTTCTCAGGGATACAAC | GTTGTATCCCTGAGAAACAGGTCG |
| NB78 | AACAACCGAACCTTTGAATCAGAA | TTCTGATTCAAAGGTTCGGTTGTT |
| NB79 | TCTCGGAGATAGTTCTCACTGCTG | CAGCAGTGAGAACTATCTCCGAGA |
| NB80 | CGGATGAACATAGGATAGCGATTC | GAATCGCTATCCTATGTTCATCCG |
| NB81 | CCTCATCTTGTGAAGTTGTTTCGG | CCGAAACAACTTCACAAGATGAGG |
| NB82 | ACGGTATGTCGAGTTCCAGGACTA | TAGTCCTGGAACTCGACATACCGT |
| NB83 | TGGCTTGATCTAGGTAAGGTCGAA | TTCGACCTTACCTAGATCAAGCCA |
| NB84 | GTAGTGGACCTAGAACCTGTGCCA | TGGCACAGGTTCTAGGTCCACTAC |
| NB85 | AACGGAGGAGTTAGTTGGATGATC | GATCATCCAACTAACTCCTCCGTT |
| NB86 | AGGTGATCCCAACAAGCGTAAGTA | TACTTACGCTTGTTGGGATCACCT |
| NB87 | TACATGCTCCTGTTGTTAGGGAGG | CCTCCCTAACAACAGGAGCATGTA |
| NB88 | TCTTCTACTACCGATCCGAAGCAG | CTGCTTCGGATCGGTAGTAGAAGA |
| NB89 | ACAGCATCAATGTTTGGCTAGTTG | CAACTAGCCAAACATTGATGCTGT |
| NB90 | GATGTAGAGGGTACGGTTTGAGGC | GCCTCAAACCGTACCCTCTACATC |
| NB91 | GGCTCCATAGGAACTCACGCTACT | AGTAGCGTGAGTTCCTATGGAGCC |
| NB92 | TTGTGAGTGGAAAGATACAGGACC | GGTCCTGTATCTTTCCACTCACAA |
| NB93 | AGTTTCCATCACTTCAGACTTGGG | CCCAAGTCTGAAGTGATGGAAACT |
| NB94 | GATTGTCCTCAAACTGCCACCTAC | GTAGGTGGCAGTTTGAGGACAATC |
| NB95 | CCTGTCTGGAAGAAGAATGGACTT | AAGTCCATTCTTCTTCCAGACAGG |
| NB96 | CTGAACGGTCATAGAGTCCACCAT | ATGGTGGACTCTATGACCGTTCAG |
3. Computer requirements and software
PromethION 24/48 IT requirements
The PromethION device contains all the hardware required to control up to 24 (for the P24 model) or 48 (for the P48 model) sequencing experiments and acquire the data. The device is further enhanced with high performance GPU technology for real-time basecalling. Read more in the PromethION IT requirements document.
PromethION 2 Solo IT requirements
The PromethION 2 (P2) Solo is a device which directly connects into a GridION Mk1 or a stand-alone computer that meets the miminum specifications for real-time data streaming and analysis. Up to two PromethION flow cells can be can be run and each is independently addressable, meaning experiments can be run concurrently or individually. For information on the computer IT requirements, please see the PromethION 2 Solo IT requirements document.
Software for nanopore sequencing
MinKNOW
The MinKNOW software controls the nanopore sequencing device, collects sequencing data and basecalls in real time. You will be using MinKNOW for every sequencing experiment to sequence, basecall and demultiplex if your samples were barcoded.
For instructions on how to run the MinKNOW software, please refer to the MinKNOW protocol.
EPI2ME (optional)
The EPI2ME cloud-based platform performs further analysis of basecalled data, for example alignment to the Lambda genome, barcoding, or taxonomic classification. You will use the EPI2ME platform only if you would like further analysis of your data post-basecalling.
For instructions on how to create an EPI2ME account and install the EPI2ME Desktop Agent, please refer to this link.
Check your flow cell
We highly recommend that you check the number of pores in your flow cell prior to starting a sequencing experiment. This should be done within 12 weeks of purchasing for MinION/GridION/PromethION or within four weeks of purchasing Flongle Flow Cells. Oxford Nanopore Technologies will replace any flow cell with fewer than the number of pores in the table below, when the result is reported within two days of performing the flow cell check, and when the storage recommendations have been followed. To do the flow cell check, please follow the instructions in the Flow Cell Check document.
| Flow cell | Minimum number of active pores covered by warranty |
|---|---|
| Flongle Flow Cell | 50 |
| MinION/GridION Flow Cell | 800 |
| PromethION Flow Cell | 5000 |
4. DNA repair and end-prep
Material
- 1000 ng gDNA per sample
Consumibles
- Mezcla de reparación de ADN NEBNext® FFPE DNA Repair Mix (NEB, M6630)
- Módulo NEBNext® Ultra™ II End Repair/dA-Tailing (NEB, E7546)
- Microesferas Agencourt AMPure XP (Beckman Coulter™, A63881)
- Agua sin nucleasas (p.ej. Thermo Scientific, AM9937)
- Etanol al 70 % recién preparado en agua sin nucleasas
- Tubos de PCR de pared fina, 0,2 ml
- Tubos Eppendorf DNA LoBind de 1,5 ml
- Kit Qubit dsDNA HS (Invitrogen Q32851)
- Tubos Qubit™ Assay (Invitrogen, Q32856)
Instrumental
- Pipeta y puntas P1000
- Pipeta y puntas P100
- Pipeta y puntas P10
- Termociclador
- Cubeta con hielo
- Microcentrífuga
- Hula mixer (mezclador de rotación suave)
- Gradilla magnética
- Qubit fluorometer (or equivalent)
Optional fragmentation and size selection
By default, the protocol contains no DNA fragmentation step, however in some cases it may be advantageous to fragment your sample. For example, when working with lower amounts of input gDNA (100 ng – 500 ng), fragmentation will increase the number of DNA molecules and therefore increase throughput. Instructions are available in the DNA Fragmentation section of Extraction methods.
Additionally, we offer several options for size-selecting your DNA sample to enrich for long fragments - instructions are available in the Size Selection section of Extraction methods.
Prepare the NEBNext FFPE DNA Repair Mix and NEBNext Ultra II End Repair / dA-tailing Module reagents in accordance with manufacturer’s instructions, and place on ice.
For optimal performance, NEB recommend the following:
Thaw all reagents on ice.
Flick and/or invert the reagent tubes to ensure they are well mixed.
Note: Do not vortex the FFPE DNA Repair Mix or Ultra II End Prep Enzyme Mix.Always spin down tubes before opening for the first time each day.
The Ultra II End Prep Buffer and FFPE DNA Repair Buffer may have a little precipitate. Allow the mixture to come to room temperature and pipette the buffer up and down several times to break up the precipitate, followed by vortexing the tube for 30 seconds to solubilise any precipitate.
Note: It is important the buffers are mixed well by vortexing.The FFPE DNA Repair Buffer may have a yellow tinge and is fine to use if yellow.
Do not vortex the NEBNext FFPE DNA Repair Mix or NEBNext Ultra II End Prep Enzyme Mix.
In clean 0.2 ml thin-walled PCR tubes, aliquot 1000 ng per sample.
Make up each sample to 12 µl using nuclease-free water. Mix gently by pipetting and spin down.
Combine the following components per sample:
Between each addition, pipette mix 10 - 20 times.
| Reagent | Volume |
|---|---|
| NEBNext FFPE DNA Repair Buffer | 0.875 µl |
| Ultra II End-prep reaction buffer | 0.875 µl |
| Ultra II End-prep enzyme mix | 0.75 µl |
| NEBNext FFPE DNA Repair Mix | 0.50 µl |
| Total | 3 µl |
We recommend making up a mastermix for the total number of samples and adding 3 µl to each individual sample.
Mix well by pipetting and spin down in a centrifuge.
Using a thermal cycler, incubate at 20°C for 5 minutes and 65°C for 5 minutes.
Transfer each sample to clean 1.5 ml Eppendorf DNA LoBind tube.
Resuspend the Agencourt AMPure XP beads by vortexing.
Add 15 µl of resuspended Agencourt AMPure XP beads to each end-prep reaction and mix by flicking the tube.
Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.
Prepare 500 μl of fresh 70% ethanol in nuclease-free water.
Spin down the samples and pellet the beads on a magnet until the eluate is clear and colourless. Keep the tubes on the magnet and pipette off the supernatant.
Keep the tube on the magnet and wash the beads with 200 µl of freshly prepared 70% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.
Repeat the previous step.
Briefly spin down and place the tubes back on the magnet. Pipette off any residual ethanol. Allow to dry for 30 seconds, but do not dry the pellet to the point of cracking.
Remove the tubes from the magnetic rack and resuspend the pellet in 10 µl nuclease-free water. Spin down and incubate for 2 minutes at room temperature.
Pellet the beads on a magnet until the eluate is clear and colourless.
Remove and retain 10 µl of eluate for each sample into clean 1.5 ml Eppendorf DNA LoBind tubes, individually.
Note: If users are having difficulty retaining 10 µl without disturbing the beads, 8.5 µl can be retained instead, allowing 1 µl for quantification and 7.5 µl to be taken forward into the Native Barcode Ligation step.
Quantify 1 µl of each eluted sample using a Qubit fluorometer.
Take forward an equimolar mass of each sample to be barcoded forward into the native barcode ligation step. However, you may store the samples at 4°C overnight.
5. Native barcode ligation
Material
- Native Barcodes (NB01-NB96)
- EDTA (ácido etilendiaminotetraacético)
Consumibles
- Agua sin nucleasas (p.ej. Thermo Scientific, AM9937)
- Etanol al 70 % recién preparado en agua sin nucleasas
- Mezcla maestra de ligasa NEB Blunt/TA (NEB, M0367)
- Microesferas Agencourt AMPure XP (Beckman Coulter™, A63881)
- Tubos Eppendorf DNA LoBind de 1,5 ml
- Kit Qubit dsDNA HS (Invitrogen Q32851)
- Tubos Qubit™ Assay (Invitrogen, Q32856)
Instrumental
- Gradilla magnética
- Mezclador vórtex
- Hula mixer (mezclador de rotación suave)
- Microcentrífuga
- Termociclador
- Cubeta con hielo
- Pipeta y puntas P1000
- Pipeta y puntas P100
- Pipeta y puntas P10
Equipo opcional
- Fluorímetro Qubit™ (o equivalente)
Prepare third party reagents in accordance with manufacturer's instructions, and place on ice:
Thaw the native barcodes at room temperature. Use one barcode per sample. Individually mix the barcodes by pipetting, spin down, and place them on ice.
Select two unique barcodes for each pair of samples to be run together.
In clean 1.5 ml Eppendorf DNA LoBind tubes, add the reagents in the following order per sample:
| Reagent | Volume |
|---|---|
| End-prepped DNA | 7.5 µl |
| Native barcode | 2.5 µl |
| Blunt/TA Ligase Master Mix | 10 µl |
| Total | 20 µl |
Thoroughly mix the reaction by gently pipetting and briefly spinning down.
Incubate for 20 minutes at room temperature.
Add 2 µl of EDTA to each tube and mix thoroughly by pipetting and spin down briefly.
Pool the barcoded samples in a clean 1.5 ml Eppendorf DNA LoBind tube.
Resuspend the Agencourt AMPure XP beads by vortexing.
Add 16 µl of Agencourt AMPure XP beads to the pooled reaction, and mix by pipetting.
Incubate on a Hula mixer (rotator mixer) for 10 minutes at room temperature.
Prepare 500 µl of fresh 70% ethanol in nuclease-free water.
Spin down the sample and pellet on a magnet for 5 minutes. Keep the tube on the magnetic rack until the eluate is clear and colourless, and pipette off the supernatant.
Keep the tube on the magentic rack and wash the beads with 200 µl of freshly prepared 70% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.
Repeat the previous step.
Spin down and place the tube back on the magnetic rack. Pipette off any residual ethanol. Allow the pellet to dry for ~30 seconds, but do not dry the pellet to the point of cracking.
Remove the tube from the magnetic rack and resuspend the pellet in 35 µl nuclease-free water by gently flicking.
Incubate for 10 minutes at 37°C. Every 2 minutes, agitate the sample by gently flicking for 10 seconds to encourage DNA elution.
Pellet the beads on a magnetic rack until the eluate is clear and colourless.
Remove and retain 35 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.
Quantify 1 µl of eluted sample using a Qubit fluorometer.
Take forward the barcoded DNA library to the adapter ligation and clean-up step. However, you may store the sample at 4°C overnight.
6. Adapter ligation and clean-up
Material
- Long Fragment Buffer (LFB)
- Elution Buffer (EB)
- Adapter Mix II T (AMII T)
Consumibles
- Módulo NEBNext® Quick Ligation (NEB, E6056)
- NEBNext® Quick Ligation Reaction Buffer (NEB, B6058)
- Tubos Eppendorf DNA LoBind de 1,5 ml
- Microesferas Agencourt AMPure XP (Beckman Coulter™, A63881)
- Kit Qubit dsDNA HS (Invitrogen Q32851)
- Tubos Qubit™ Assay (Invitrogen, Q32856)
Instrumental
- Microcentrífuga
- Gradilla magnética
- Mezclador vórtex
- Hula mixer (mezclador de rotación suave)
- Termociclador
- Pipeta y puntas P1000
- Pipeta y puntas P200
- Pipeta y puntas P100
- Pipeta y puntas P20
- Pipeta y puntas P10
- Cubeta con hielo
- Qubit fluorometer (or equivalent)
Thaw the Elution Buffer (EB) and NEBNext Quick Ligation Reaction Buffer (5x) at room temperature, mix by vortexing, spin down and place on ice. Check the contents of each tube are clear of any precipitate.
Spin down the Quick T4 Ligase and the Adapter Mix II T (AMII T), and place on ice.
To enrich for DNA fragments of 3 kb or longer, thaw one tube of Long Fragment Buffer (LFB) at room temperature, mix by vortexing, spin down and place on ice.
In a 1.5 ml Eppendorf LoBind tube, mix in the following order:
| Reagent | Volume |
|---|---|
| Pooled barcoded sample | 30 µl |
| Adapter Mix II T (AMII T) | 5 µl |
| NEBNext Quick Ligation Reaction Buffer (5X) | 10 µl |
| Quick T4 DNA Ligase | 5 µl |
| Total | 50 µl |
Ensure the components are thoroughly mixed by pipetting, and spin down.
Incubate the reaction for 10 minutes at room temperature.
The next clean-up step uses Long Fragment Buffer (LFB) rather than 70% ethanol to wash the beads. The use of ethanol will be detrimental to the sequencing reaction.
Resuspend the Agencourt AMPure XP beads by vortexing.
Add 20 µl of resuspended Agencourt AMPure XP beads to the reaction and mix by pipetting.
Incubate on a Hula mixer (rotator mixer) for 10 minutes at room temperature.
Spin down the sample and pellet on the magnetic rack. Keep the tube on the magnet and pipette off the supernatant.
Wash the beads by adding 125 μl Long Fragment Buffer (LFB). Flick the beads to resuspend, spin down, then return the tube to the magnetic rack and allow the beads to pellet. Remove the supernatant using a pipette and discard.
Repeat the previous step.
Spin down and place the tube back on the magnet. Pipette off any residual supernatant. Allow to dry for ~30 seconds, but do not dry the pellet to the point of cracking.
Remove the tube from the magnetic rack and resuspend the pellet in 30 µl Elution Buffer (EB).
Spin down and incubate for 10 minutes at 37°C. Every 2 minutes, agitate the sample by gently flicking for 10 seconds to encourage DNA elution.
Pellet the beads on a magnet until the eluate is clear and colourless, for at least 1 minute.
Remove and retain 30 µl of eluate containing the DNA library into a clean 1.5 ml Eppendorf DNA LoBind tube.
Dispose of the pelleted beads.
Quantify 1 µl of eluted sample using a Qubit fluorometer.
We recommend loading >10 fmols of this final prepared library onto the flow cell for R9.4.1 flow cells.
The prepared library is used for loading into the flow cell. Store the library on ice or at 4°C until ready to load.
Library storage recommendations
We recommend storing libraries in Eppendorf DNA LoBind tubes at 4°C for short-term storage or repeated use, for example, re-loading flow cells between washes. For single use and long-term storage of more than 3 months, we recommend storing libraries at -80°C in Eppendorf DNA LoBind tubes.
If quantities allow, the libraries may be diluted in Elution Buffer (EB) for splittling across multiple flow cells.
7. Priming and loading multiple flow cells on a PromethION
Material
- Flush Buffer (FB)
- Flush Tether (FLT)
- Loading Beads II (LBII)
- Sequencing Buffer II (SBII)
- Loading Solution (LS)
Consumibles
- Celdas de flujo PromethION
- Tubos Eppendorf DNA LoBind de 1,5 ml
- Tubos Eppendorf DNA LoBind de 2 ml
Instrumental
- Dispositivo PromethION 24/48 o PromethION 2 Solo
- Dispositivo PromethION
- Pantalla protectora celdas de flujo PromethION
- Pipeta y puntas P1000
- Pipeta y puntas P200
- Pipeta y puntas P20
Using the Loading Solution
We recommend using the Loading Beads II (LBII) for loading your library onto the flow cell for most sequencing experiments. However, if you have previously used water to load your library, you must use Loading Solution (LS) instead of water. Note: some customers have noticed that viscous libraries can be loaded more easily when not using Loading Beads II.
Thaw the Sequencing Buffer II (SBII), Loading Beads II (LBII), Flush Tether (FLT) and on tube of Flush Buffer (FB) at room temperature before mixing the reagents by vortexing and spin down at room temperature.
Scale up reagent volumes as needed.
Ensure to prepare enough reagents for the total number of flow cells being processed and to take into account extra volume required for pipetting errors.
Each vial provides enough reagent for the preparation of 12 samples. Thaw the appropriate number of vials of each reagent.
Prepare the flow cell priming mix in a suitable vial for the number of flow cells to flush. Once combined, mix well by briefly vortexing.
| Reagent | Volume per flow cell |
|---|---|
| Flush Tether (FLT) | 30 µl |
| Flush Buffer (FB) | 1,170 µl |
After taking flow cells out of the fridge, wait 20 minutes before inserting the flow cell into the PromethION for the flow cell to come to room temperature. Condensation can form on the flow cell in humid environments. Inspect the gold connector pins on the top and underside of the flow cell for condensation and wipe off with a lint-free wipe if any is observed. Ensure the heat pad (black pad) is present on the underside of the flow cell.
For PromethION 2 Solo, load the flow cell(s) as follows:
Place the flow cell flat on the metal plate.
Slide the flow cell into the docking port until the gold pins or green board cannot be seen.

For the PromethION 24/48, load the flow cell(s) into the docking ports:
- Line up the flow cell with the connector horizontally and vertically before smoothly inserting into position.
- Press down firmly onto the flow cell and ensure the latch engages and clicks into place.


Insertion of the flow cells at the wrong angle can cause damage to the pins on the PromethION and affect your sequencing results. If you find the pins on a PromethION position are damaged, please contact support@nanoporetech.com for assistance.

If not already completed, perform a flow cell check on all flow cells.
Please refer to the Flow Cell Check protocol for further information.
Slide the inlet port cover clockwise to open.

Take care when drawing back buffer from the flow cell. Do not remove more than 20-30 µl, and make sure that the array of pores are covered by buffer at all times. Introducing air bubbles into the array can irreversibly damage pores.
After opening the inlet port, draw back a small volume to remove any air bubbles:
- Set a P1000 pipette tip to 200 µl.
- Insert the tip into the inlet port.
- Turn the wheel until the dial shows 220-230 µl, or until you see a small volume of buffer entering the pipette tip.

Load 500 µl of the priming mix into the flow cell via the inlet port, avoiding the introduction of air bubbles. Wait five minutes. During this time, prepare the library for loading using the next steps in the protocol.

Thoroughly mix the contents of the Loading Beads II (LBII) by pipetting.
The Loading Beads II (LBII) tube contains a suspension of beads. These beads settle very quickly. It is vital that they are mixed immediately before use.
In a new tube, prepare the library for loading as follows:
| Reagent | Volume per flow cell |
|---|---|
| Sequencing Buffer II (SBII) | 75 µl |
| Loading Beads II (LBII) thoroughly mixed before use, or Loading Solution (LS), if using | 51 µl |
| DNA library | 24 µl |
| Total | 150 µl |
The Multiplex Ligation Kit is designed for users running multiple flow cells. When handling multiple DNA libraries, the Sequencing Buffer (SBII) and Loading Beads II (LBII) can be combined in a master mix:
- Mix the Sequencing Buffer II (SBII) and Loading Beads II (LBII) as described above, scaling up the final volume for the appropriate number of samples and adding up to 20% excess of each reagent.
- Mix the master mix by pipetting immediately before adding to the DNA samples
- Pipette 126 µl of the master mix into each DNA sample-containing tube.
- Mix the samples by pipetting.
Complete the flow cell priming by slowly loading 500 µl of the priming mix into the inlet port.

Mix the prepared library gently by pipetting up and down just prior to loading.
Using a P1000, insert the pipette tip into the inlet port and add 150 µl of library.

Close the valve to seal the inlet port.
Install the light shield on your flow cell as soon as library has been loaded for optimal sequencing output.
We recommend leaving the light shield on the flow cell when library is loaded, including during any washing and reloading steps. The shield can be removed when the library has been removed from the flow cell.
If the light shield has been removed from the flow cell, install the light shield as follows:
- Align the inlet port cut out of the light shield with the inlet port cover on the flow cell. The leading edge of the light shield should sit above the flow cell ID.
- Firmly press the light shield around the inlet port cover. The inlet port clip will click into place underneath the inlet port cover.


Close the PromethION lid when ready to start a sequencing run on MinKNOW.
Wait a minimum of 10 minutes after loading the flow cells onto the PromethION before initiating any experiments. This will help to increase the sequencing output.
For multiple flow cell washing, use the same experiment name and identifying sample IDs for all runs to enable all flow cells to be paused simultaneously.

8. Data acquisition and basecalling
Overview of nanopore data analysis
For a full overview of nanopore data analysis, which includes options for basecalling and post-basecalling analysis, please refer to the Data Analysis document.
How to start sequencing
The sequencing device control, data acquisition and real-time basecalling are carried out by the MinKNOW software. Please ensure MinKNOW is installed on your computer or device. There are multiple options for how to carry out sequencing:
1. Data acquisition and basecalling in real-time using MinKNOW on a computer
Follow the instructions in the MinKNOW protocol beginning from the "Starting a sequencing run" section until the end of the "Completing a MinKNOW run" section.
2. Data acquisition and basecalling in real-time using the MinION Mk1B/Mk1D device
Follow the instructions in the MinION Mk1B user manual or the MinION Mk1D user manual.
3. Data acquisition and basecalling in real-time using the MinION Mk1C device
Follow the instructions in the MinION Mk1C user manual.
4. Data acquisition and basecalling in real-time using the GridION device
Follow the instructions in the GridION user manual.
5. Data acquisition and basecalling in real-time using the PromethION device
Follow the instructions in the PromethION user manual or the PromethION 2 Solo user manual.
6. Data acquisition using MinKNOW on a computer and basecalling at a later time using MinKNOW
Follow the instructions in the MinKNOW protocol beginning from the "Starting a sequencing run" section until the end of the "Completing a MinKNOW run" section. When setting your experiment parameters, set the Basecalling tab to OFF. After the sequencing experiment has completed, follow the instructions in the Post-run analysis section of the MinKNOW protocol.
9. Downstream analysis
Post-basecalling analysis
There are several options for further analysing your basecalled data:
1. EPI2ME platform
The EPI2ME platform is a cloud-based data analysis service developed by Metrichor Ltd., a subsidiary of Oxford Nanopore Technologies. The EPI2ME platform offers a range of analysis workflows, e.g. for metagenomic identification, barcoding, alignment, and structural variant calling. The analysis requires no additional equipment or compute power, and provides an easy-to-interpret report with the results. For instructions on how to run an analysis workflow in EPI2ME, please follow the instructions in the EPI2ME protocol, beginning at the "Starting an EPI2ME workflow" step.
2. Bioinformatics tutorials
For more in-depth data analysis, Oxford Nanopore Technologies offers a range of bioinformatics tutorials, which are available in the Bioinformatics resource section of the Community. The tutorials take the user through installing and running pre-built analysis pipelines, which generate a report with the results. The tutorials are aimed at biologists who would like to analyse data without the help of a dedicated bioinformatician, and who are comfortable using the command line.
3. Research analysis tools
Oxford Nanopore Technologies' Research division has created a number of analysis tools, which are available in the Oxford Nanopore GitHub repository. The tools are aimed at advanced users, and contain instructions for how to install and run the software. They are provided as-is, with minimal support.
4. Community-developed analysis tools
If a data analysis method for your research question is not provided in any of the resources above, please refer to the Community-developed data analysis tool library. Numerous members of the Nanopore Community have developed their own tools and pipelines for analysing nanopore sequencing data, most of which are available on GitHub. Please be aware that these tools are not supported by Oxford Nanopore Technologies, and are not guaranteed to be compatible with the latest chemistry/software configuration.
10. Flow cell reuse and returns
Material
- Kit Flow Cell Wash (EXP-WSH004)
After your sequencing experiment is complete, if you would like to reuse the flow cell, please follow the Flow Cell Wash Kit protocol and store the washed flow cell at +2°C to +8°C.
The Flow Cell Wash Kit protocol is available on the Nanopore Community.
We recommend you to wash the flow cell as soon as possible after you stop the run. However, if this is not possible, leave the flow cell on the device and wash it the next day.
Alternatively, follow the returns procedure to send the flow cell back to Oxford Nanopore.
Instructions for returning flow cells can be found here.
If you encounter issues or have questions about your sequencing experiment, please refer to the Troubleshooting Guide that can be found in the online version of this protocol.
11. Issues during DNA/RNA extraction and library preparation
Below is a list of the most commonly encountered issues, with some suggested causes and solutions.
We also have an FAQ section available on the Nanopore Community Support section.
If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.
Low sample quality
| Observation | Possible cause | Comments and actions |
|---|---|---|
| Low DNA purity (Nanodrop reading for DNA OD 260/280 is <1.8 and OD 260/230 is <2.0–2.2) | The DNA extraction method does not provide the required purity | The effects of contaminants are shown in the Contaminants document. Please try an alternative extraction method that does not result in contaminant carryover. Consider performing an additional SPRI clean-up step. |
| Low RNA integrity (RNA integrity number <9.5 RIN, or the rRNA band is shown as a smear on the gel) | The RNA degraded during extraction | Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page. |
| RNA has a shorter than expected fragment length | The RNA degraded during extraction | Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page. We recommend working in an RNase-free environment, and to keep your lab equipment RNase-free when working with RNA. |
Low DNA recovery after AMPure bead clean-up
| Observation | Possible cause | Comments and actions |
|---|---|---|
| Low recovery | DNA loss due to a lower than intended AMPure beads-to-sample ratio | 1. AMPure beads settle quickly, so ensure they are well resuspended before adding them to the sample. 2. When the AMPure beads-to-sample ratio is lower than 0.4:1, DNA fragments of any size will be lost during the clean-up. |
| Low recovery | DNA fragments are shorter than expected | The lower the AMPure beads-to-sample ratio, the more stringent the selection against short fragments. Please always determine the input DNA length on an agarose gel (or other gel electrophoresis methods) and then calculate the appropriate amount of AMPure beads to use. ![]() |
| Low recovery after end-prep | The wash step used ethanol <70% | DNA will be eluted from the beads when using ethanol <70%. Make sure to use the correct percentage. |
12. Issues during the sequencing run
Below is a list of the most commonly encountered issues, with some suggested causes and solutions.
We also have an FAQ section available on the Nanopore Community Support section.
If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.
Fewer pores at the start of sequencing than after Flow Cell Check
| Observation | Possible cause | Comments and actions |
|---|---|---|
| MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check | An air bubble was introduced into the nanopore array | After the Flow Cell Check it is essential to remove any air bubbles near the priming port before priming the flow cell. If not removed, the air bubble can travel to the nanopore array and irreversibly damage the nanopores that have been exposed to air. The best practice to prevent this from happening is demonstrated in this video. |
| MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check | The flow cell is not correctly inserted into the device | Stop the sequencing run, remove the flow cell from the sequencing device and insert it again, checking that the flow cell is firmly seated in the device and that it has reached the target temperature. If applicable, try a different position on the device (GridION/PromethION). |
| MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check | Contaminations in the library damaged or blocked the pores | The pore count during the Flow Cell Check is performed using the QC DNA molecules present in the flow cell storage buffer. At the start of sequencing, the library itself is used to estimate the number of active pores. Because of this, variability of about 10% in the number of pores is expected. A significantly lower pore count reported at the start of sequencing can be due to contaminants in the library that have damaged the membranes or blocked the pores. Alternative DNA/RNA extraction or purification methods may be needed to improve the purity of the input material. The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover. |
MinKNOW script failed
| Observation | Possible cause | Comments and actions |
|---|---|---|
| MinKNOW shows "Script failed" | Restart the computer and then restart MinKNOW. If the issue persists, please collect the MinKNOW log files and contact Technical Support. If you do not have another sequencing device available, we recommend storing the flow cell and the loaded library at 4°C and contact Technical Support for further storage guidance. |
Pore occupancy below 40%
| Observation | Possible cause | Comments and actions |
|---|---|---|
| Pore occupancy <40% | Not enough library was loaded on the flow cell | Ensure you load the recommended amount of good quality library in the relevant library prep protocol onto your flow cell. Please quantify the library before loading and calculate mols using tools like the Promega Biomath Calculator, choosing "dsDNA: µg to pmol" |
| Pore occupancy close to 0 | The Ligation Sequencing Kit was used, and sequencing adapters did not ligate to the DNA | Make sure to use the NEBNext Quick Ligation Module (E6056) and Oxford Nanopore Technologies Ligation Buffer (LNB, provided in the sequencing kit) at the sequencing adapter ligation step, and use the correct amount of each reagent. A Lambda control library can be prepared to test the integrity of the third-party reagents. |
| Pore occupancy close to 0 | The Ligation Sequencing Kit was used, and ethanol was used instead of LFB or SFB at the wash step after sequencing adapter ligation | Ethanol can denature the motor protein on the sequencing adapters. Make sure the LFB or SFB buffer was used after ligation of sequencing adapters. |
| Pore occupancy close to 0 | No tether on the flow cell | Tethers are adding during flow cell priming (FLT/FCT tube). Make sure FLT/FCT was added to FB/FCF before priming. |
Shorter than expected read length
| Observation | Possible cause | Comments and actions |
|---|---|---|
| Shorter than expected read length | Unwanted fragmentation of DNA sample | Read length reflects input DNA fragment length. Input DNA can be fragmented during extraction and library prep. 1. Please review the Extraction Methods in the Nanopore Community for best practice for extraction. 2. Visualise the input DNA fragment length distribution on an agarose gel before proceeding to the library prep. In the image above, Sample 1 is of high molecular weight, whereas Sample 2 has been fragmented.3. During library prep, avoid pipetting and vortexing when mixing reagents. Flicking or inverting the tube is sufficient. |
Large proportion of unavailable pores
| Observation | Possible cause | Comments and actions |
|---|---|---|
Large proportion of unavailable pores (shown as blue in the channels panel and pore activity plot) The pore activity plot above shows an increasing proportion of "unavailable" pores over time. | Contaminants are present in the sample | Some contaminants can be cleared from the pores by the unblocking function built into MinKNOW. If this is successful, the pore status will change to "sequencing pore". If the portion of unavailable pores stays large or increases: 1. A nuclease flush using the Flow Cell Wash Kit (EXP-WSH004) can be performed, or 2. Run several cycles of PCR to try and dilute any contaminants that may be causing problems. |
Large proportion of inactive pores
| Observation | Possible cause | Comments and actions |
|---|---|---|
| Large proportion of inactive/unavailable pores (shown as light blue in the channels panel and pore activity plot. Pores or membranes are irreversibly damaged) | Air bubbles have been introduced into the flow cell | Air bubbles introduced through flow cell priming and library loading can irreversibly damage the pores. Watch the Priming and loading your flow cell video for best practice |
| Large proportion of inactive/unavailable pores | Certain compounds co-purified with DNA | Known compounds, include polysaccharides, typically associate with plant genomic DNA. 1. Please refer to the Plant leaf DNA extraction method. 2. Clean-up using the QIAGEN PowerClean Pro kit. 3. Perform a whole genome amplification with the original gDNA sample using the QIAGEN REPLI-g kit. |
| Large proportion of inactive/unavailable pores | Contaminants are present in the sample | The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover. |
Reduction in sequencing speed and q-score later into the run
| Observation | Possible cause | Comments and actions |
|---|---|---|
| Reduction in sequencing speed and q-score later into the run | For Kit 9 chemistry (e.g. SQK-LSK109), fast fuel consumption is typically seen when the flow cell is overloaded with library (please see the appropriate protocol for your DNA library to see the recommendation). | Add more fuel to the flow cell by following the instructions in the MinKNOW protocol. In future experiments, load lower amounts of library to the flow cell. |
Temperature fluctuation
| Observation | Possible cause | Comments and actions |
|---|---|---|
| Temperature fluctuation | The flow cell has lost contact with the device | Check that there is a heat pad covering the metal plate on the back of the flow cell. Re-insert the flow cell and press it down to make sure the connector pins are firmly in contact with the device. If the problem persists, please contact Technical Services. |
Failed to reach target temperature
| Observation | Possible cause | Comments and actions |
|---|---|---|
| MinKNOW shows "Failed to reach target temperature" | The instrument was placed in a location that is colder than normal room temperature, or a location with poor ventilation (which leads to the flow cells overheating) | MinKNOW has a default timeframe for the flow cell to reach the target temperature. Once the timeframe is exceeded, an error message will appear and the sequencing experiment will continue. However, sequencing at an incorrect temperature may lead to a decrease in throughput and lower q-scores. Please adjust the location of the sequencing device to ensure that it is placed at room temperature with good ventilation, then re-start the process in MinKNOW. Please refer to this link for more information on MinION temperature control. |
Guppy – no input .fast5 was found or basecalled
| Observation | Possible cause | Comments and actions |
|---|---|---|
| No input .fast5 was found or basecalled | input_path did not point to the .fast5 file location | The --input_path has to be followed by the full file path to the .fast5 files to be basecalled, and the location has to be accessible either locally or remotely through SSH. |
| No input .fast5 was found or basecalled | The .fast5 files were in a subfolder at the input_path location | To allow Guppy to look into subfolders, add the --recursive flag to the command |
Guppy – no Pass or Fail folders were generated after basecalling
| Observation | Possible cause | Comments and actions |
|---|---|---|
| No Pass or Fail folders were generated after basecalling | The --qscore_filtering flag was not included in the command | The --qscore_filtering flag enables filtering of reads into Pass and Fail folders inside the output folder, based on their strand q-score. When performing live basecalling in MinKNOW, a q-score of 7 (corresponding to a basecall accuracy of ~80%) is used to separate reads into Pass and Fail folders. |
Guppy – unusually slow processing on a GPU computer
| Observation | Possible cause | Comments and actions |
|---|---|---|
| Unusually slow processing on a GPU computer | The --device flag wasn't included in the command | The --device flag specifies a GPU device to use for accelerate basecalling. If not included in the command, GPU will not be used. GPUs are counted from zero. An example is --device cuda:0 cuda:1, when 2 GPUs are specified to use by the Guppy command. |

In the image above, Sample 1 is of high molecular weight, whereas Sample 2 has been fragmented.
The pore activity plot above shows an increasing proportion of "unavailable" pores over time.