Ligation sequencing gDNA - Multiplex Ligation Sequencing Kit XL (SQK-MLK111.96-XL)

Oxford Nanopore Technologies
Document type icon

PromethION: Protocol

Ligation sequencing gDNA - Multiplex Ligation Sequencing Kit XL (SQK-MLK111.96-XL) V MLK_9144_v111_revI_01Dec2021

Barcoding of native genomic DNA libraries

  • Requires the Multiplex Ligation Sequencing Kit XL
  • No PCR required
  • Features 96 unique barcodes
  • Enables low-plex sequencing
  • Allows analysis of native DNA

For Research Use Only

This is a Legacy product This kit is soon to be discontinued and we recommend all customers to upgrade to the latest chemistry for their relevant kit which is available on the Store. If customers require further support for any ongoing critical experiments using a Legacy product, please contact Customer Support via email: support@nanoporetech.com.

FOR RESEARCH USE ONLY

Descripción general

Barcoding of native genomic DNA libraries

  • Requires the Multiplex Ligation Sequencing Kit XL
  • No PCR required
  • Features 96 unique barcodes
  • Enables low-plex sequencing
  • Allows analysis of native DNA

For Research Use Only

This is a Legacy product This kit is soon to be discontinued and we recommend all customers to upgrade to the latest chemistry for their relevant kit which is available on the Store. If customers require further support for any ongoing critical experiments using a Legacy product, please contact Customer Support via email: support@nanoporetech.com.

Document version: MLK_9144_v111_revI_01Dec2021

1. Overview of the protocol

IMPORTANTE

This is a Legacy product

This kit is soon to be discontinued and we recommend all customers to upgrade to the latest chemistry for their relevant kit which is available on the Store. If customers require further support for any ongoing critical experiments using a Legacy product, please contact Customer Support via email: support@nanoporetech.com. For further information on please see the product update page.

Multiplex Ligation Sequencing Kit XL features

This kit is recommended for users who:

  • Want to optimise their sequencing experiment for output
  • Wish to low-plex samples for Whole Genome Sequencing (WGS)
  • Need a PCR-free method of multiplexing to preserve additional information, such as base modifications
  • Require control over read length
  • Would like to utilise upstream processes, such as size selection or whole genome amplification

Introduction to the manual Multiplex Ligation Sequencing Kit XL protocol

This protocol describes how to carry out native barcoding of genomic DNA using the Multiplex Ligation Sequencing Kit XL (SQK-MLK111.96-XL). This kit is designed to enable low-plex sequencing and this manual protocol outlines how to sequence two samples across one flow cell. This enables users to sequence 96 samples across 48 flow cells to provide an easier workflow for whole genome sequencing (WGS).

To efficiently load multiple PromethION Flow Cells, we recommend using the Loading multiple PromethION Flow Cells protocol as a guideline.

Steps in the sequencing workflow: Prepare for your experiment You will need to:

  • Extract your DNA, and check its length, quantity and purity. The quality checks performed during the protocol are essential in ensuring experimental success.
  • Ensure you have your sequencing kit, the correct equipment and third-party reagents
  • Download the software for acquiring and analysing your data
  • Check your flow cell to ensure it has enough pores for a good sequencing run

Prepare your library

You will need to:

  • Repair the DNA, and prepare the DNA ends for adapter attachment
  • Ligate Native barcodes supplied in the kit to the DNA ends
  • Ligate sequencing adapters supplied in the kit to the DNA ends
  • Prime the flow cell, and load your DNA library into the flow cell

Native barcoding workflow1

Sequencing

You will need to:

  • Start a sequencing run using the MinKNOW software, which will collect raw data from the device and convert it into basecalled reads
  • Demultiplex barcoded reads in MinKNOW or the Guppy software
  • Start the EPI2ME software and select a workflow for further analysis (this step is optional)
IMPORTANTE

We do not recommend mixing barcoded libraries with non-barcoded libraries prior to sequencing.

IMPORTANTE

Optional fragmentation and size selection

By default, the protocol contains no DNA fragmentation step, however in some cases it may be advantageous to fragment your sample. For example, when working with lower amounts of input gDNA (100 ng – 500 ng), fragmentation will increase the number of DNA molecules and therefore increase throughput. Instructions are available in the DNA Fragmentation section of Extraction methods.

Additionally, we offer several options for size-selecting your DNA sample to enrich for long fragments - instructions are available in the Size Selection section of Extraction methods.

IMPORTANTE

Compatibility of this protocol

This protocol should only be used in combination with:

  • Multiplex Ligation Sequencing Kit XL (SQK-MLK111.96-XL)
  • R9.4.1 flow cells (FLO-PRO002)
  • Flow Cell Wash Kit (EXP-WSH004)

2. Equipment and consumables

Material
  • Multiplex Ligation Sequencing Kit XL (SQK-MLK111.96-XL)
  • 1000 ng gDNA per sample
Consumibles
  • NEB Blunt/TA Ligase Master Mix (NEB, M0367)
  • NEBNext® Quick Ligation Reaction Buffer (NEB, B6058)
  • NEBNext FFPE Repair Mix (NEB M6630) (mezcla de reparación de ADN)
  • NEBNext Ultra II End Repair/dA-tailing Module (NEB E7546) (Módulo de reparación de extremos/Adición de dA)
  • NEBNext Quick Ligation Module (NEB E6056) (Módulo de ligación rápida)
  • Tubos de 1,5 ml Eppendorf DNA LoBind
  • Tubos de PCR de pared fina (0,2 ml)
  • Tubos de ensayo Qubit™ (Invitrogen Q32856)
  • Agua sin nucleasas (p. ej., ThermoFisher AM9937)
  • Freshly prepared 70% ethanol in nuclease-free water
  • Agencourt AMPure XP beads (Beckman Coulter™ cat # A63881)
  • Kit de ensayo Qubit dsDNA HS (Invitrogen Q32851)
Instrumental
  • Mezclador Hula (mezclador giratorio suave)
  • Microfuge
  • Gradilla magnética
  • Mezclador vórtex
  • Termociclador
  • Pipeta y puntas P1000
  • Pipeta y puntas P200
  • Pipeta y puntas P100
  • Pipeta y puntas P20
  • Pipeta y puntas P10
  • Pipeta y puntas P2
  • Cubeta con hielo
  • Temporizador
  • Qubit fluorometer (or equivalent)
Equipo opcional
  • Bioanalizador Agilent (o equivalente)
  • Centrifuga Eppendorf 5424 (o equivalente)

For this protocol, you will need 1000 ng gDNA per sample for R9.4.1 flow cells.

Cantidad de muestra inicial de ADN

Cómo realizar un control de calidad del ADN de la muestra inicial

Es importante que la muestra de ADN cumpla con los requisitos de cantidad y calidad. Usar demasiado ADN, poco o de mala calidad (p. ej., que esté muy fragmentado, que contenga ARN o contaminantes químicos), puede afectar a la preparación de la biblioteca.

Para realizar un control de calidad en la muestra de ADN, consulte el protocolo Input DNA/ RNA QC

Contaminantes químicos

Dependiendo de cómo se extraiga el ADN de la muestra cruda, ciertos contaminantes químicos pueden permanecer en el ADN purificado, lo cual afecta la eficacia de la preparación de la biblioteca y la calidad de la secuenciación. Encontrará más información sobre contaminantes en la página Contaminants de la comunidad Nanopore.

Convenient reagent kits are available on request from NEB for the Multiplex Ligation Sequencing Kit XL.

This will contain the appropriate NEB reagents and the required volumes for the protocol on the Hamilton NGS STAR 96. For more information from NEB, please see "Find Products for Nanopore Sequencing".

Multiplex Ligation Sequencing Kit XL (SQK-MLK111.96-XL) contents

sqk-mlk111.96-xl 1

Name Acronym Cap colour Number of vials Fill volume per vial (µl)
Adapter Mix II T AMII T Green 1 320
Sequencing Buffer II SBII Red 4 1,500
Loading Beads II LBII Pink 4 1,500
Loading Solution LS White cap, pink sticker 4 1,500
EDTA EDTA Clear 1 700
Elution Buffer EB 15 ml bottle 1 10,000
Long Fragment Buffer LFB 30 ml bottle 1 20,000
Flush Buffer XL FB 30 ml bottle 6 15,500
Flush Tether FLT White cap, purple sticker 2 1,600
Native Barcodes NB01-96 N/a 1 plate 8 µl per well

Native barcode sequences

Component Forward sequence Reverse sequence
NB01 CACAAAGACACCGACAACTTTCTT AAGAAAGTTGTCGGTGTCTTTGTG
NB02 ACAGACGACTACAAACGGAATCGA TCGATTCCGTTTGTAGTCGTCTGT
NB03 CCTGGTAACTGGGACACAAGACTC GAGTCTTGTGTCCCAGTTACCAGG
NB04 TAGGGAAACACGATAGAATCCGAA TTCGGATTCTATCGTGTTTCCCTA
NB05 AAGGTTACACAAACCCTGGACAAG CTTGTCCAGGGTTTGTGTAACCTT
NB06 GACTACTTTCTGCCTTTGCGAGAA TTCTCGCAAAGGCAGAAAGTAGTC
NB07 AAGGATTCATTCCCACGGTAACAC GTGTTACCGTGGGAATGAATCCTT
NB08 ACGTAACTTGGTTTGTTCCCTGAA TTCAGGGAACAAACCAAGTTACGT
NB09 AACCAAGACTCGCTGTGCCTAGTT AACTAGGCACAGCGAGTCTTGGTT
NB10 GAGAGGACAAAGGTTTCAACGCTT AAGCGTTGAAACCTTTGTCCTCTC
NB11 TCCATTCCCTCCGATAGATGAAAC GTTTCATCTATCGGAGGGAATGGA
NB12 TCCGATTCTGCTTCTTTCTACCTG CAGGTAGAAAGAAGCAGAATCGGA
NB13 AGAACGACTTCCATACTCGTGTGA TCACACGAGTATGGAAGTCGTTCT
NB14 AACGAGTCTCTTGGGACCCATAGA TCTATGGGTCCCAAGAGACTCGTT
NB15 AGGTCTACCTCGCTAACACCACTG CAGTGGTGTTAGCGAGGTAGACCT
NB16 CGTCAACTGACAGTGGTTCGTACT AGTACGAACCACTGTCAGTTGACG
NB17 ACCCTCCAGGAAAGTACCTCTGAT ATCAGAGGTACTTTCCTGGAGGGT
NB18 CCAAACCCAACAACCTAGATAGGC GCCTATCTAGGTTGTTGGGTTTGG
NB19 GTTCCTCGTGCAGTGTCAAGAGAT ATCTCTTGACACTGCACGAGGAAC
NB20 TTGCGTCCTGTTACGAGAACTCAT ATGAGTTCTCGTAACAGGACGCAA
NB21 GAGCCTCTCATTGTCCGTTCTCTA TAGAGAACGGACAATGAGAGGCTC
NB22 ACCACTGCCATGTATCAAAGTACG CGTACTTTGATACATGGCAGTGGT
NB23 CTTACTACCCAGTGAACCTCCTCG CGAGGAGGTTCACTGGGTAGTAAG
NB24 GCATAGTTCTGCATGATGGGTTAG CTAACCCATCATGCAGAACTATGC
NB25 GTAAGTTGGGTATGCAACGCAATG CATTGCGTTGCATACCCAACTTAC
NB26 CATACAGCGACTACGCATTCTCAT ATGAGAATGCGTAGTCGCTGTATG
NB27 CGACGGTTAGATTCACCTCTTACA TGTAAGAGGTGAATCTAACCGTCG
NB28 TGAAACCTAAGAAGGCACCGTATC GATACGGTGCCTTCTTAGGTTTCA
NB29 CTAGACACCTTGGGTTGACAGACC GGTCTGTCAACCCAAGGTGTCTAG
NB30 TCAGTGAGGATCTACTTCGACCCA TGGGTCGAAGTAGATCCTCACTGA
NB31 TGCGTACAGCAATCAGTTACATTG CAATGTAACTGATTGCTGTACGCA
NB32 CCAGTAGAAGTCCGACAACGTCAT ATGACGTTGTCGGACTTCTACTGG
NB33 CAGACTTGGTACGGTTGGGTAACT AGTTACCCAACCGTACCAAGTCTG
NB34 GGACGAAGAACTCAAGTCAAAGGC GCCTTTGACTTGAGTTCTTCGTCC
NB35 CTACTTACGAAGCTGAGGGACTGC GCAGTCCCTCAGCTTCGTAAGTAG
NB36 ATGTCCCAGTTAGAGGAGGAAACA TGTTTCCTCCTCTAACTGGGACAT
NB37 GCTTGCGATTGATGCTTAGTATCA TGATACTAAGCATCAATCGCAAGC
NB38 ACCACAGGAGGACGATACAGAGAA TTCTCTGTATCGTCCTCCTGTGGT
NB39 CCACAGTGTCAACTAGAGCCTCTC GAGAGGCTCTAGTTGACACTGTGG
NB40 TAGTTTGGATGACCAAGGATAGCC GGCTATCCTTGGTCATCCAAACTA
NB41 GGAGTTCGTCCAGAGAAGTACACG CGTGTACTTCTCTGGACGAACTCC
NB42 CTACGTGTAAGGCATACCTGCCAG CTGGCAGGTATGCCTTACACGTAG
NB43 CTTTCGTTGTTGACTCGACGGTAG CTACCGTCGAGTCAACAACGAAAG
NB44 AGTAGAAAGGGTTCCTTCCCACTC GAGTGGGAAGGAACCCTTTCTACT
NB45 GATCCAACAGAGATGCCTTCAGTG CACTGAAGGCATCTCTGTTGGATC
NB46 GCTGTGTTCCACTTCATTCTCCTG CAGGAGAATGAAGTGGAACACAGC
NB47 GTGCAACTTTCCCACAGGTAGTTC GAACTACCTGTGGGAAAGTTGCAC
NB48 CATCTGGAACGTGGTACACCTGTA TACAGGTGTACCACGTTCCAGATG
NB49 ACTGGTGCAGCTTTGAACATCTAG CTAGATGTTCAAAGCTGCACCAGT
NB50 ATGGACTTTGGTAACTTCCTGCGT ACGCAGGAAGTTACCAAAGTCCAT
NB51 GTTGAATGAGCCTACTGGGTCCTC GAGGACCCAGTAGGCTCATTCAAC
NB52 TGAGAGACAAGATTGTTCGTGGAC GTCCACGAACAATCTTGTCTCTCA
NB53 AGATTCAGACCGTCTCATGCAAAG CTTTGCATGAGACGGTCTGAATCT
NB54 CAAGAGCTTTGACTAAGGAGCATG CATGCTCCTTAGTCAAAGCTCTTG
NB55 TGGAAGATGAGACCCTGATCTACG CGTAGATCAGGGTCTCATCTTCCA
NB56 TCACTACTCAACAGGTGGCATGAA TTCATGCCACCTGTTGAGTAGTGA
NB57 GCTAGGTCAATCTCCTTCGGAAGT ACTTCCGAAGGAGATTGACCTAGC
NB58 CAGGTTACTCCTCCGTGAGTCTGA TCAGACTCACGGAGGAGTAACCTG
NB59 TCAATCAAGAAGGGAAAGCAAGGT ACCTTGCTTTCCCTTCTTGATTGA
NB60 CATGTTCAACCAAGGCTTCTATGG CCATAGAAGCCTTGGTTGAACATG
NB61 AGAGGGTACTATGTGCCTCAGCAC GTGCTGAGGCACATAGTACCCTCT
NB62 CACCCACACTTACTTCAGGACGTA TACGTCCTGAAGTAAGTGTGGGTG
NB63 TTCTGAAGTTCCTGGGTCTTGAAC GTTCAAGACCCAGGAACTTCAGAA
NB64 GACAGACACCGTTCATCGACTTTC GAAAGTCGATGAACGGTGTCTGTC
NB65 TTCTCAGTCTTCCTCCAGACAAGG CCTTGTCTGGAGGAAGACTGAGAA
NB66 CCGATCCTTGTGGCTTCTAACTTC GAAGTTAGAAGCCACAAGGATCGG
NB67 GTTTGTCATACTCGTGTGCTCACC GGTGAGCACACGAGTATGACAAAC
NB68 GAATCTAAGCAAACACGAAGGTGG CCACCTTCGTGTTTGCTTAGATTC
NB69 TACAGTCCGAGCCTCATGTGATCT AGATCACATGAGGCTCGGACTGTA
NB70 ACCGAGATCCTACGAATGGAGTGT ACACTCCATTCGTAGGATCTCGGT
NB71 CCTGGGAGCATCAGGTAGTAACAG CTGTTACTACCTGATGCTCCCAGG
NB72 TAGCTGACTGTCTTCCATACCGAC GTCGGTATGGAAGACAGTCAGCTA
NB73 AAGAAACAGGATGACAGAACCCTC GAGGGTTCTGTCATCCTGTTTCTT
NB74 TACAAGCATCCCAACACTTCCACT AGTGGAAGTGTTGGGATGCTTGTA
NB75 GACCATTGTGATGAACCCTGTTGT ACAACAGGGTTCATCACAATGGTC
NB76 ATGCTTGTTACATCAACCCTGGAC GTCCAGGGTTGATGTAACAAGCAT
NB77 CGACCTGTTTCTCAGGGATACAAC GTTGTATCCCTGAGAAACAGGTCG
NB78 AACAACCGAACCTTTGAATCAGAA TTCTGATTCAAAGGTTCGGTTGTT
NB79 TCTCGGAGATAGTTCTCACTGCTG CAGCAGTGAGAACTATCTCCGAGA
NB80 CGGATGAACATAGGATAGCGATTC GAATCGCTATCCTATGTTCATCCG
NB81 CCTCATCTTGTGAAGTTGTTTCGG CCGAAACAACTTCACAAGATGAGG
NB82 ACGGTATGTCGAGTTCCAGGACTA TAGTCCTGGAACTCGACATACCGT
NB83 TGGCTTGATCTAGGTAAGGTCGAA TTCGACCTTACCTAGATCAAGCCA
NB84 GTAGTGGACCTAGAACCTGTGCCA TGGCACAGGTTCTAGGTCCACTAC
NB85 AACGGAGGAGTTAGTTGGATGATC GATCATCCAACTAACTCCTCCGTT
NB86 AGGTGATCCCAACAAGCGTAAGTA TACTTACGCTTGTTGGGATCACCT
NB87 TACATGCTCCTGTTGTTAGGGAGG CCTCCCTAACAACAGGAGCATGTA
NB88 TCTTCTACTACCGATCCGAAGCAG CTGCTTCGGATCGGTAGTAGAAGA
NB89 ACAGCATCAATGTTTGGCTAGTTG CAACTAGCCAAACATTGATGCTGT
NB90 GATGTAGAGGGTACGGTTTGAGGC GCCTCAAACCGTACCCTCTACATC
NB91 GGCTCCATAGGAACTCACGCTACT AGTAGCGTGAGTTCCTATGGAGCC
NB92 TTGTGAGTGGAAAGATACAGGACC GGTCCTGTATCTTTCCACTCACAA
NB93 AGTTTCCATCACTTCAGACTTGGG CCCAAGTCTGAAGTGATGGAAACT
NB94 GATTGTCCTCAAACTGCCACCTAC GTAGGTGGCAGTTTGAGGACAATC
NB95 CCTGTCTGGAAGAAGAATGGACTT AAGTCCATTCTTCTTCCAGACAGG
NB96 CTGAACGGTCATAGAGTCCACCAT ATGGTGGACTCTATGACCGTTCAG

3. Computer requirements and software

PromethION 24/48 IT requirements

The PromethION device contains all the hardware required to control up to 24 (for the P24 model) or 48 (for the P48 model) sequencing experiments and acquire the data. The device is further enhanced with high performance GPU technology for real-time basecalling. Read more in the PromethION IT requirements document.

PromethION 2 Solo IT requirements

The PromethION 2 (P2) Solo is a device which directly connects into a GridION Mk1 or a stand-alone computer that meets the miminum specifications for real-time data streaming and analysis. Up to two PromethION flow cells can be can be run and each is independently addressable, meaning experiments can be run concurrently or individually. For information on the computer IT requirements, please see the PromethION 2 Solo IT requirements document.

Software for nanopore sequencing

MinKNOW

The MinKNOW software controls the nanopore sequencing device, collects sequencing data and basecalls in real time. You will be using MinKNOW for every sequencing experiment to sequence, basecall and demultiplex if your samples were barcoded.

For instructions on how to run the MinKNOW software, please refer to the MinKNOW protocol.

EPI2ME (optional)

The EPI2ME cloud-based platform performs further analysis of basecalled data, for example alignment to the Lambda genome, barcoding, or taxonomic classification. You will use the EPI2ME platform only if you would like further analysis of your data post-basecalling.

For instructions on how to create an EPI2ME account and install the EPI2ME Desktop Agent, please refer to this link.

Verificar la celda de flujo

Antes de empezar el experimento de secuenciación, recomendamos verificar el número de poros disponibles, presentes en la celda de flujo. La comprobación deberá realizarse en las primeras 12 semanas desde su adquisición, si se trata de celdas de flujo MinION, GridION o PromethION, y en las primeras cuatro semanas tras la compra de celdas de flujo Flongle. Oxford Nanopore Technologies sustituirá cualquier celda de flujo con un número de poros inferior al indicado en la tabla siguiente, siempre y cuando el resultado se notifique dentro de los dos días siguientes a la comprobación y se hayan seguido las instrucciones de almacenamiento. Para verificar la celda de flujo, siga las instrucciones del documento Flow Cell Check.

Celda de flujo Número mínimo de poros activos cubierto por la garantía
Flongle 50
MinION/GridION 800
PromethION 5000

4. DNA repair and end-prep

Material
  • 1000 ng gDNA per sample
Consumibles
  • NEBNext FFPE DNA Repair Mix (NEB M6630)
  • NEBNext Ultra II End repair/dA-tailing Module (NEB E7546)
  • Agencourt AMPure XP beads (Beckman Coulter™ cat # A63881)
  • Agua sin nucleasas (p. ej., ThermoFisher AM9937)
  • Freshly prepared 70% ethanol in nuclease-free water
  • Tubos de PCR de pared fina (0,2 ml)
  • Tubos de 1,5 ml Eppendorf DNA LoBind
  • Kit de ensayo Qubit dsDNA HS (Invitrogen Q32851)
  • Tubos de ensayo Qubit™ (Invitrogen Q32856)
Instrumental
  • Pipeta y puntas P1000
  • Pipeta y puntas P100
  • Pipeta y puntas P10
  • Thermal cycler
  • Cubeta con hielo
  • Microfuge
  • Hula mixer (gentle rotator mixer)
  • Gradilla magnética
  • Qubit fluorometer (or equivalent)
IMPORTANTE

Optional fragmentation and size selection

By default, the protocol contains no DNA fragmentation step, however in some cases it may be advantageous to fragment your sample. For example, when working with lower amounts of input gDNA (100 ng – 500 ng), fragmentation will increase the number of DNA molecules and therefore increase throughput. Instructions are available in the DNA Fragmentation section of Extraction methods.

Additionally, we offer several options for size-selecting your DNA sample to enrich for long fragments - instructions are available in the Size Selection section of Extraction methods.

Preparar los reactivos NEBNext FFPE DNA Repair Mix y NEBNext Ultra II End Repair / dA-tailing Module siguiendo las instrucciones del fabricante y poner en hielo.

Para obtener un rendimiento óptimo, NEB recomienda lo siguiente:

  1. Descongelar todos los reactivos en hielo.

  2. Golpear suavemente los tubos de reactivos con el índice o invertirlos, para asegurarse de que estén bien mezclados.
    Nota: No mezclar en vórtex las mezclas FFPE DNA Repair Mix, ni Ultra II End Prep Enzyme Mix.

  3. Centrifugar los tubos antes de abrirlos.

  4. Los tampones Ultra II End Prep Buffer y FFPE DNA Repair Buffer pueden tener un poco de precipitado. Dejar que la mezcla alcance la temperatura ambiente y mezclar pipeteando varias veces para romper el precipitado; para solubilizarlo, agitar el tubo en vórtex durante 30 s.
    Nota: Es importante mezclar bien los tampones mediante vórtex.

  5. El tampón FFPE DNA Repair Buffer puede tener un matiz amarillo; no importa si está así; se puede utilizar.

IMPORTANTE

Do not vortex the NEBNext FFPE DNA Repair Mix or NEBNext Ultra II End Prep Enzyme Mix.

In clean 0.2 ml thin-walled PCR tubes, aliquot 1000 ng per sample.

Make up each sample to 12 µl using nuclease-free water. Mix gently by pipetting and spin down.

Combine the following components per sample:

Between each addition, pipette mix 10 - 20 times.

Reagent Volume
NEBNext FFPE DNA Repair Buffer 0.875 µl
Ultra II End-prep reaction buffer 0.875 µl
Ultra II End-prep enzyme mix 0.75 µl
NEBNext FFPE DNA Repair Mix 0.50 µl
Total 3 µl
CONSEJO

We recommend making up a mastermix for the total number of samples and adding 3 µl to each individual sample.

Mix well by pipetting and spin down in a centrifuge.

Incubar en el termociclador, primero a 20 ºC durante 5 minutos y después a 65 ºC durante 5 minutos más.

Transfer each sample to clean 1.5 ml Eppendorf DNA LoBind tube.

Resuspend the Agencourt AMPure XP beads by vortexing.

Add 15 µl of resuspended Agencourt AMPure XP beads to each end-prep reaction and mix by flicking the tube.

Incubar en el mezclador Hula (o mezclador giratorio suave) durante 5 minutos a temperatura ambiente.

Prepare 500 μl of fresh 70% ethanol in nuclease-free water.

Spin down the samples and pellet the beads on a magnet until the eluate is clear and colourless. Keep the tubes on the magnet and pipette off the supernatant.

Keep the tube on the magnet and wash the beads with 200 µl of freshly prepared 70% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.

Repeat the previous step.

Briefly spin down and place the tubes back on the magnet. Pipette off any residual ethanol. Allow to dry for 30 seconds, but do not dry the pellet to the point of cracking.

Remove the tubes from the magnetic rack and resuspend the pellet in 10 µl nuclease-free water. Spin down and incubate for 2 minutes at room temperature.

Pellet the beads on a magnet until the eluate is clear and colourless.

Remove and retain 10 µl of eluate for each sample into clean 1.5 ml Eppendorf DNA LoBind tubes, individually.

Note: If users are having difficulty retaining 10 µl without disturbing the beads, 8.5 µl can be retained instead, allowing 1 µl for quantification and 7.5 µl to be taken forward into the Native Barcode Ligation step.

CHECKPOINT

Quantify 1 µl of each eluted sample using a Qubit fluorometer.

FIN DEL PROCESO

Take forward an equimolar mass of each sample to be barcoded forward into the native barcode ligation step. However, you may store the samples at 4°C overnight.

5. Native barcode ligation

Material
  • Native Barcodes (NB01-NB96)
  • EDTA (ácido etilendiaminotetraacético)
Consumibles
  • Agua sin nucleasas (p. ej., ThermoFisher AM9937)
  • Etanol al 70 % recién preparado en agua sin nucleasas
  • NEB Blunt/TA Ligase Master Mix (NEB, M0367)
  • Agencourt AMPure XP Beads (Beckman Coulter™, A63881)
  • 1.5 ml Eppendorf DNA LoBind tubes
  • Kit de ensayo Qubit dsDNA HS (Invitrogen Q32851)
  • Tubos de ensayo Qubit™ (Invitrogen Q32856)
Instrumental
  • Gradilla magnética
  • Mezclador vórtex
  • Mezclador Hula (mezclador giratorio suave)
  • Microfuge
  • Termociclador
  • Cubeta con hielo
  • Pipeta y puntas P1000
  • Pipeta y puntas P100
  • Pipeta y puntas P10
Equipo opcional
  • Fluorímetro Qubit (o equivalente para el control de calidad)

Prepare third party reagents in accordance with manufacturer's instructions, and place on ice:

Thaw the native barcodes at room temperature. Use one barcode per sample. Individually mix the barcodes by pipetting, spin down, and place them on ice.

Select two unique barcodes for each pair of samples to be run together.

In clean 1.5 ml Eppendorf DNA LoBind tubes, add the reagents in the following order per sample:

Reagent Volume
End-prepped DNA 7.5 µl
Native barcode 2.5 µl
Blunt/TA Ligase Master Mix 10 µl
Total 20 µl

Mezclar pipeteando con suavidad y centrifugar brevemente la reacción para asegurarse de que se mezcla completamente.

Incubate for 20 minutes at room temperature.

Add 2 µl of EDTA to each tube and mix thoroughly by pipetting and spin down briefly.

Pool the barcoded samples in a clean 1.5 ml Eppendorf DNA LoBind tube.

Resuspend the Agencourt AMPure XP beads by vortexing.

Add 16 µl of Agencourt AMPure XP beads to the pooled reaction, and mix by pipetting.

Incubate on a Hula mixer (rotator mixer) for 10 minutes at room temperature.

Prepare 500 µl of fresh 70% ethanol in nuclease-free water.

Spin down the sample and pellet on a magnet for 5 minutes. Keep the tube on the magnetic rack until the eluate is clear and colourless, and pipette off the supernatant.

Keep the tube on the magentic rack and wash the beads with 200 µl of freshly prepared 70% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.

Repetir el paso anterior.

Spin down and place the tube back on the magnetic rack. Pipette off any residual ethanol. Allow the pellet to dry for ~30 seconds, but do not dry the pellet to the point of cracking.

Remove the tube from the magnetic rack and resuspend the pellet in 35 µl nuclease-free water by gently flicking.

Incubate for 10 minutes at 37°C. Every 2 minutes, agitate the sample by gently flicking for 10 seconds to encourage DNA elution.

Pellet the beads on a magnetic rack until the eluate is clear and colourless.

Remove and retain 35 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.

CHECKPOINT

Quantify 1 µl of eluted sample using a Qubit fluorometer.

FIN DEL PROCESO

Take forward the barcoded DNA library to the adapter ligation and clean-up step. However, you may store the sample at 4°C overnight.

6. Adapter ligation and clean-up

Material
  • Long Fragment Buffer (LFB) (tampón para fragmentos largos)
  • Elution Buffer (EB)
  • Adapter Mix II T (AMII T)
Consumibles
  • NEBNext® Quick Ligation Module (NEB, E6056)
  • NEBNext® Quick Ligation Reaction Buffer (NEB, B6058)
  • Tubos de 1,5 ml Eppendorf DNA LoBind
  • Agencourt AMPure XP Beads (Beckman Coulter™, A63881)
  • Kit de ensayo Qubit dsDNA HS (Invitrogen Q32851)
  • Tubos de ensayo Qubit™ (Invitrogen Q32856)
Instrumental
  • Microcentrífuga
  • Gradilla magnética
  • Mezclador vórtex
  • Mezclador Hula (mezclador giratorio suave)
  • Termociclador
  • Pipeta y puntas P1000
  • Pipeta y puntas P200
  • Pipeta y puntas P100
  • Pipeta y puntas P20
  • Pipeta y puntas P10
  • Ice bucket with ice
  • Qubit fluorometer (or equivalent)

Thaw the Elution Buffer (EB) and NEBNext Quick Ligation Reaction Buffer (5x) at room temperature, mix by vortexing, spin down and place on ice. Check the contents of each tube are clear of any precipitate.

Spin down the Quick T4 Ligase and the Adapter Mix II T (AMII T), and place on ice.

To enrich for DNA fragments of 3 kb or longer, thaw one tube of Long Fragment Buffer (LFB) at room temperature, mix by vortexing, spin down and place on ice.

In a 1.5 ml Eppendorf LoBind tube, mix in the following order:

Reagent Volume
Pooled barcoded sample 30 µl
Adapter Mix II T (AMII T) 5 µl
NEBNext Quick Ligation Reaction Buffer (5X) 10 µl
Quick T4 DNA Ligase 5 µl
Total 50 µl

Ensure the components are thoroughly mixed by pipetting, and spin down.

Incubate the reaction for 10 minutes at room temperature.

IMPORTANTE

The next clean-up step uses Long Fragment Buffer (LFB) rather than 70% ethanol to wash the beads. The use of ethanol will be detrimental to the sequencing reaction.

Resuspend the Agencourt AMPure XP beads by vortexing.

Add 20 µl of resuspended Agencourt AMPure XP beads to the reaction and mix by pipetting.

Incubate on a Hula mixer (rotator mixer) for 10 minutes at room temperature.

Spin down the sample and pellet on the magnetic rack. Keep the tube on the magnet and pipette off the supernatant.

Wash the beads by adding 125 μl Long Fragment Buffer (LFB). Flick the beads to resuspend, spin down, then return the tube to the magnetic rack and allow the beads to pellet. Remove the supernatant using a pipette and discard.

Repetir el paso anterior.

Centrifugar y colocar el tubo de nuevo en el imán. Retirar con una pipeta cualquier residuo de sobrenadante. Dejar secar el agregado durante 30 s aproximadamente, sin dejar que se agriete.

Remove the tube from the magnetic rack and resuspend the pellet in 30 µl Elution Buffer (EB).

Spin down and incubate for 10 minutes at 37°C. Every 2 minutes, agitate the sample by gently flicking for 10 seconds to encourage DNA elution.

Precipitar las microesferas en un imán, durante al menos 1 minuto, hasta que el eluido se vuelva claro e incoloro.

Remove and retain 30 µl of eluate containing the DNA library into a clean 1.5 ml Eppendorf DNA LoBind tube.

Dispose of the pelleted beads.

MEDIDA OPCIONAL

Quantify 1 µl of eluted sample using a Qubit fluorometer.

IMPORTANTE

We recommend loading >10 fmols of this final prepared library onto the flow cell for R9.4.1 flow cells.

FIN DEL PROCESO

La biblioteca preparada se usará para cargar la celda de flujo. Conservar la biblioteca en hielo o a 4 °C hasta el momento de cargar.

CONSEJO

Recomendaciones de guardado de la biblioteca

Se recomienda guardar las bibliotecas en tubos Eppendorf DNA LoBind a 4 ⁰C, durante periodos de tiempo cortos o en caso de uso repetido, por ejemplo, para recargar celdas de flujo entre lavados. Para uso individual y para conservar a largo plazo por periodos de más de 3 meses, se recomienda guardar las bibliotecas a -80 ⁰C en tubos Eppendorf DNA LoBind.

MEDIDA OPCIONAL

If quantities allow, the libraries may be diluted in Elution Buffer (EB) for splittling across multiple flow cells.

7. Priming and loading multiple flow cells on a PromethION

Material
  • Flush Buffer (FB)
  • Flush Tether (FLT)
  • Loading Beads II (LBII)
  • Sequencing Buffer II (SBII)
  • Loading Solution (LS)
Consumibles
  • Celda de flujo PromethION
  • 1.5 ml Eppendorf DNA LoBind tubes
  • 2 ml Eppendorf DNA LoBind tubes
Instrumental
  • PromethION 2 Solo device
  • Dispositivo PromethION 24/48
  • PromethION Flow Cell Light Shield
  • P1000 pipette and tips
  • Pipeta y puntas P200
  • Pipeta y puntas P20

Using the Loading Solution

We recommend using the Loading Beads II (LBII) for loading your library onto the flow cell for most sequencing experiments. However, if you have previously used water to load your library, you must use Loading Solution (LS) instead of water. Note: some customers have noticed that viscous libraries can be loaded more easily when not using Loading Beads II.

Thaw the Sequencing Buffer II (SBII), Loading Beads II (LBII), Flush Tether (FLT) and on tube of Flush Buffer (FB) at room temperature before mixing the reagents by vortexing and spin down at room temperature.

IMPORTANTE

Scale up reagent volumes as needed.

Ensure to prepare enough reagents for the total number of flow cells being processed and to take into account extra volume required for pipetting errors.

CONSEJO

Each vial provides enough reagent for the preparation of 12 samples. Thaw the appropriate number of vials of each reagent.

Prepare the flow cell priming mix in a suitable vial for the number of flow cells to flush. Once combined, mix well by briefly vortexing.

Reagent Volume per flow cell
Flush Tether (FLT) 30 µl
Flush Buffer (FB) 1,170 µl
IMPORTANTE

Una vez sacadas de la nevera, esperar 20 minutos antes de insertar las celdas de flujo en el dispositivo y así darles tiempo a que estén a temperatura ambiente. En entornos húmedos se puede formar condensación. Inspeccione las clavijas doradas del conector, situadas en la parte superior e inferior de la celda de flujo, en busca de condensación y si la hubiera, límpiela con una toallita sin pelusa. Procure que la almohadilla térmica (color gris oscuro) esté enganchada en la parte posterior.

For PromethION 2 Solo, load the flow cell(s) as follows:

  1. Place the flow cell flat on the metal plate.

  2. Slide the flow cell into the docking port until the gold pins or green board cannot be seen.

J2068 FC-into-P2-animation V5

For the PromethION 24/48, load the flow cell(s) into the docking ports:

  1. Line up the flow cell with the connector horizontally and vertically before smoothly inserting into position.
  2. Press down firmly onto the flow cell and ensure the latch engages and clicks into place.

Step 1a V3

Step 1B

IMPORTANTE

Insertion of the flow cells at the wrong angle can cause damage to the pins on the PromethION and affect your sequencing results. If you find the pins on a PromethION position are damaged, please contact support@nanoporetech.com for assistance.

Screenshot 2021-04-08 at 12.08.37

If not already completed, perform a flow cell check on all flow cells.

Please refer to the Flow Cell Check protocol for further information.

Slide the inlet port cover clockwise to open.

Prom loading 2

IMPORTANTE

Tenga cuidado a la hora de extraer el tampón de la celda de flujo. No retire más de 20-30 μl y asegúrese de que el tampón cubra la matriz de poros en todo momento. La introducción de burbujas de aire en la matriz puede dañar los poros de manera irreversible.

After opening the inlet port, draw back a small volume to remove any air bubbles:

  1. Set a P1000 pipette tip to 200 µl.
  2. Insert the tip into the inlet port.
  3. Turn the wheel until the dial shows 220-230 µl, or until you see a small volume of buffer entering the pipette tip.

Step 3 v1

Load 500 µl of the priming mix into the flow cell via the inlet port, avoiding the introduction of air bubbles. Wait five minutes. During this time, prepare the library for loading using the next steps in the protocol.

Step 4 v1

Thoroughly mix the contents of the Loading Beads II (LBII) by pipetting.

IMPORTANTE

The Loading Beads II (LBII) tube contains a suspension of beads. These beads settle very quickly. It is vital that they are mixed immediately before use.

In a new tube, prepare the library for loading as follows:

Reagent Volume per flow cell
Sequencing Buffer II (SBII) 75 µl
Loading Beads II (LBII) thoroughly mixed before use, or Loading Solution (LS), if using 51 µl
DNA library 24 µl
Total 150 µl
MEDIDA OPCIONAL

The Multiplex Ligation Kit is designed for users running multiple flow cells. When handling multiple DNA libraries, the Sequencing Buffer (SBII) and Loading Beads II (LBII) can be combined in a master mix:

  1. Mix the Sequencing Buffer II (SBII) and Loading Beads II (LBII) as described above, scaling up the final volume for the appropriate number of samples and adding up to 20% excess of each reagent.
  2. Mix the master mix by pipetting immediately before adding to the DNA samples
  3. Pipette 126 µl of the master mix into each DNA sample-containing tube.
  4. Mix the samples by pipetting.

Complete the flow cell priming by slowly loading 500 µl of the priming mix into the inlet port.

Step 5 v1

Mezclar la biblioteca pipeteando suavemente, justo antes de cargar.

Using a P1000, insert the pipette tip into the inlet port and add 150 µl of library.

Step 6 v2

Close the valve to seal the inlet port.

Step 7 V2

IMPORTANTE

Para obtener resultados de secuenciación óptimos, coloque la pantalla protectora sobre la celda de flujo justo después de cargar la biblioteca.

Recomendamos colocar la pantalla protectora en la celda de flujo y dejarla puesta mientras la biblioteca esté cargada, incluyendo los lavados y pasos de recarga. Retirar la pantalla cuando se haya extraído la biblioteca de la celda de flujo.

If the light shield has been removed from the flow cell, install the light shield as follows:

  1. Align the inlet port cut out of the light shield with the inlet port cover on the flow cell. The leading edge of the light shield should sit above the flow cell ID.
  2. Firmly press the light shield around the inlet port cover. The inlet port clip will click into place underneath the inlet port cover.

J2264 - Light shield animation PromethION Flow Cell 8a FAW

J2264 - Light shield animation PromethION Flow Cell 8b FAW

FIN DEL PROCESO

Close the PromethION lid when ready to start a sequencing run on MinKNOW.

Wait a minimum of 10 minutes after loading the flow cells onto the PromethION before initiating any experiments. This will help to increase the sequencing output.

For multiple flow cell washing, use the same experiment name and identifying sample IDs for all runs to enable all flow cells to be paused simultaneously.

Screenshot 2023-02-14 114901

8. Data acquisition and basecalling

Aspectos generales del análisis de datos de nanoporos

Para obtener una descripción completa del análisis de datos de nanoporos, que incluya distintas posibilidades para el análisis de identificación y postidentificicación de bases, consultar el documento Data Analysis.

Cómo empezar a secuenciar

El programa MinKNOW realiza el control del dispositivo de secuenciación, la adquisición de datos y la identificación de bases en tiempo real. Una vez que el usuario ha instalado MinKNOW en su ordenador, hay diferentes maneras de llevar a cabo la secuenciación:

1. Adquisición de datos e identificación de bases en tiempo real con el programa MinKNOW.

Seguir las instrucciones del protocolo de MinKNOW, desde el apartado "Starting a sequencing run" hasta el final del apartado "Completing a MinKNOW run".

2. Adquisición de datos e identificación de bases en tiempo real con el dispositivo GridION.

Seguir las instrucciones del manual de usuario de GridION.

3. Adquisición de datos e identificación de bases en tiempo real con el dispositivo MinION Mk1C.

Seguir las instrucciones del manual de usuario de MinION Mk1C.

4. Adquisición de datos e identificación de bases en tiempo real con el dispositivo PromethION.

Seguir las instrucciones de los manuales de usuario de PromethION o PromethION 2 Solo.

5. Adquisición de datos e identificación de bases posterior mediante MinKNOW.

Seguir las instrucciones del protocolo de MinKNOW, desde el apartado "Starting a sequencing run" hasta el final del apartado "Completing a MinKNOW run". Al configurar los parámetros del experimento, ajustar la pestaña Basecalling (Identificación de bases) en posición de APAGADO. Al terminar el experimento de secuenciación, seguir las instrucciones del apartado "Post-run analysis" del protocolo de MinKNOW.

9. Downstream analysis

Post-basecalling analysis

There are several options for further analysing your basecalled data:

1. EPI2ME platform

The EPI2ME platform is a cloud-based data analysis service developed by Metrichor Ltd., a subsidiary of Oxford Nanopore Technologies. The EPI2ME platform offers a range of analysis workflows, e.g. for metagenomic identification, barcoding, alignment, and structural variant calling. The analysis requires no additional equipment or compute power, and provides an easy-to-interpret report with the results. For instructions on how to run an analysis workflow in EPI2ME, please follow the instructions in the EPI2ME protocol, beginning at the "Starting an EPI2ME workflow" step.

2. Bioinformatics tutorials

For more in-depth data analysis, Oxford Nanopore Technologies offers a range of bioinformatics tutorials, which are available in the Bioinformatics resource section of the Community. The tutorials take the user through installing and running pre-built analysis pipelines, which generate a report with the results. The tutorials are aimed at biologists who would like to analyse data without the help of a dedicated bioinformatician, and who are comfortable using the command line.

3. Research analysis tools

Oxford Nanopore Technologies' Research division has created a number of analysis tools, which are available in the Oxford Nanopore GitHub repository. The tools are aimed at advanced users, and contain instructions for how to install and run the software. They are provided as-is, with minimal support.

4. Community-developed analysis tools

If a data analysis method for your research question is not provided in any of the resources above, please refer to the Community-developed data analysis tool library. Numerous members of the Nanopore Community have developed their own tools and pipelines for analysing nanopore sequencing data, most of which are available on GitHub. Please be aware that these tools are not supported by Oxford Nanopore Technologies, and are not guaranteed to be compatible with the latest chemistry/software configuration.

10. Reutilización y devolución de celdas de flujo

Material
  • Flow Cell Wash Kit (EXP-WSH004) (kit de lavado de celda de flujo)

Si al terminar el experimento desea volver a usar la celda de flujo, siga las instrucciones del protocolo Flow Cell Wash Kit y guarde la celda de flujo lavada a entre 2 °C y 8 ⁰C.

El protocolo Flow Cell Wash Kit está disponible en la comunidad Nanopore.

CONSEJO

Una vez terminado el experimento, recomendamos lavar la celda de flujo cuanto antes. Si no es posible, se puede dejar en el dispositivo y lavar al día siguiente.

Otra posibilidad es seguir el procedimiento de devolución para lavar la celda de flujo y enviarla a Oxford Nanopore.

Aquí puede encontrar las instrucciones para devolver celdas de flujo.

IMPORTANTE

Ante cualquier duda o pregunta acerca del experimento de secuenciación, consulte la guía de resolución de problemas, Troubleshooting Guide, que se encuentra en la versión en línea de este protocolo.

11. Problemas durante la extracción de ADN/ARN y la preparación de bibliotecas

A continuación hay una lista de los problemas más frecuentes, con algunas posibles causas y soluciones propuestas.

También disponemos de una página de preguntas frecuentes, FAQ, en la sección Support de la comunidad Nanopore.

Si ha probado las soluciones propuestas y continúa teniendo problemas, póngase en contacto con el departamento de asistencia técnica, bien por correo electrónico (support@nanoporetech.com) o a través del Live Chat de la comunidad Nanopore.

Baja calidad de la muestra

Observación Posible causa Comentarios y acciones recomendadas
Baja pureza del ADN (la lectura del Nanodrop para ADN OD 260/280 es <1,8 y OD 260/230 es <2,0-2,2) El método de extracción de ADN no proporciona la pureza necesaria Los efectos de los contaminantes se muestran en la página Contaminants. Pruebe con un método de extracción alternativo que no provoque el arrastre de contaminantes.

Considere realizar un paso adicional de limpieza SPRI.
Baja integridad del ARN (número de integridad del ARN <9,5 RIN o la banda ARNr se muestra como una mancha en el gel). El ARN se degradó durante la extracción Probar un método de extracción de ARN diferente. Encontrará más información sobre RIN en la página RNA Integrity Number. Asimismo, dispone de información adicional en la página DNA/RNA Handling.
El ARN tiene una longitud de fragmento más corta de lo esperado El ARN se degradó durante la extracción Probar un método de extracción de ARN diferente. Encontrará más información sobre RIN en la página RNA Integrity Number. Asimismo, dispone de información adicional en la página DNA/RNA Handling.

Cuando se trabaje con ARN, recomendamos que el espacio de trabajo y el instrumental de laboratorio estén libres de ribonucleasas.

Escasa recuperación de ADN tras la limpieza con microesferas magnéticas AMPure

Observación Posible causa Comentarios y acciones recomendadas
Escasa recuperación Pérdida de ADN debido a una proporción de microesferas magnéticas AMPure por muestra inferior a lo previsto. 1. Las microesferas magnéticas AMPure precipitan con rapidez; antes de añadirlas a la muestra hay que asegurarse de que estén bien resuspendidas.

2. Si la proporción de microesferas por muestra es inferior a 0.4:1, los fragmentos de ADN, sean del tamaño que sean, se perderán durante la limpieza.
Escasa recuperación Los fragmentos de ADN son más cortos de lo esperado Cuanto menor sea la proporción de microesferas magnéticas AMPure por muestra, más rigurosa será la selección de fragmentos largos frente a los cortos. Determinar siempre la longitud de la muestra de ADN en un gel de agarosa u otros métodos de electroforesis en gel, y, a continuación, calcular la cantidad adecuada de microesferas magnéticas que se debe utilizar. SPRI cleanup
Escasa recuperación tras la preparación de extremos El paso de lavado utilizó etanol a <70 % Cuando se utilice etanol a <70 %, el ADN se eluirá de las microesferas magnéticas. Asegúrese de utilizar el porcentaje correcto.

12. Issues during the sequencing run

A continuación hay una lista de los problemas más frecuentes, con algunas posibles causas y soluciones propuestas.

También disponemos de una página de preguntas frecuentes, FAQ, en la sección Support de la comunidad Nanopore.

Si ha probado las soluciones propuestas y continúa teniendo problemas, póngase en contacto con el departamento de asistencia técnica, bien por correo electrónico (support@nanoporetech.com) o a través del Live Chat de la comunidad Nanopore.

Menos poros al inicio de la secuenciación que después de verificar la celda de flujo

Observación Posible causa Comentarios y acciones recomendadas
MinKNOW presentó al inicio de la secuenciación un número de poros inferior al indicado durante la comprobación de la celda de flujo Se introdujo una burbuja de aire en la matriz de nanoporos Tras comprobar el número de poros presente en la celda de flujo, es imprescindible quitar las burbujas que haya cerca del puerto de cebado. Si no se quitan, pueden desplazarse a la matriz de nanoporos y dañar de manera irreversible los nanoporos expuestos al aire. En este vídeo se muestran algunas buenas prácticas para evitar que esto ocurra.
MinKNOW presentó al inicio de la secuenciación un número de poros inferior al indicado durante la comprobación de la celda de flujo La celda de flujo no está colocada correctamente Detener el ciclo de secuenciación, quitar la celda de flujo del dispositivo e insertarla de nuevo. Comprobar que está firmemente asentada en el dispositivo y que ha alcanzado la temperatura deseada. Si procede, probar con una posición diferente del dispositivo (GriION/PromethION).
MinKNOW presentó al inicio de la secuenciación un número de poros inferior al indicado durante la comprobación de la celda de flujo La presencia de contaminantes en la biblioteca ha dañado o bloqueado los poros El número de poros resultante tras la comprobación de la celda de flujo se realiza usando el control de calidad de las moléculas de ADN presentes en el tampón de almacenamiento de la celda de flujo. Al inicio de la secuenciación, se utiliza la misma biblioteca para estimar el número de poros activos. Por este motivo, se estima que puede haber una variabilidad del 10 % en el número de poros detectados. Tener un número de poros considerablemente inferior al inicio de la secuenciación puede deberse a la presencia de contaminantes en la biblioteca que hayan dañado las membranas o bloqueado los poros. Para mejorar la pureza del material de entrada tal vez sea necesario usar métodos de purificación o extracción de ADN/ARN alternativos. Los efectos de los contaminantes están descritos en la página Contaminants. Se recomienda, probar con un método de extracción alternativo que no provoque el arrastre de contaminantes.

Error en el script de MinKNOW

Observación Posible causa Comentarios y acciones recomendadas
MinKNOW muestra el mensaje "Error en el script"
Reiniciar el ordenador y reiniciar MinKNOW. Si el problema continúa, reúna los archivos de registro MinKNOW log files y contacte con el servicio de asistencia técnica. Si no dispone de otro dispositivo de secuenciación, recomendamos que guarde la celda de flujo con la biblioteca cargada a 4 °C y contacte con el servicio de asistencia técnica para recibir recomendaciones de almacenamiento adicionales.

Pore occupancy below 40%

Observation Possible cause Comments and actions
Pore occupancy <40% Not enough library was loaded on the flow cell Ensure you load the recommended amount of good quality library in the relevant library prep protocol onto your flow cell. Please quantify the library before loading and calculate mols using tools like the Promega Biomath Calculator, choosing "dsDNA: µg to pmol"
Pore occupancy close to 0 The Ligation Sequencing Kit was used, and sequencing adapters did not ligate to the DNA Make sure to use the NEBNext Quick Ligation Module (E6056) and Oxford Nanopore Technologies Ligation Buffer (LNB, provided in the sequencing kit) at the sequencing adapter ligation step, and use the correct amount of each reagent. A Lambda control library can be prepared to test the integrity of the third-party reagents.
Pore occupancy close to 0 The Ligation Sequencing Kit was used, and ethanol was used instead of LFB or SFB at the wash step after sequencing adapter ligation Ethanol can denature the motor protein on the sequencing adapters. Make sure the LFB or SFB buffer was used after ligation of sequencing adapters.
Pore occupancy close to 0 No tether on the flow cell Tethers are adding during flow cell priming (FLT/FCT tube). Make sure FLT/FCT was added to FB/FCF before priming.

Longitud de lectura más corta de lo esperado

Observación Posible causa Comentarios y acciones recomendadas
Longitud de lectura más corta de lo esperado Fragmentación no deseada de la muestra de ADN La longitud de lectura refleja la longitud del fragmento de la muestra de ADN. La muestra de ADN se puede fragmentar durante la extracción de la preparación de la biblioteca.

1. Consulte la sección de buenas prácticas de los métodos de extracción en la página Extraction Methods de la comunidad Nanopore.

2. Visualizar la distribución de la longitud de los fragmentos de las muestras de ADN en un gel de agarosa antes de proceder a la preparación de la biblioteca. DNA gel2 En la imagen superior, la muestra 1 contiene alto peso molecular, mientras que la muestra 2 se ha fragmentado.

3. Durante la preparación de la biblioteca, evitar pipetear y agitar en vórtex cuando se mezclen los reactivos. Dar suaves golpes con el dedo o invertir el vial es suficiente.

Gran proporción de poros no disponibles

Observación Posible causa Comentarios y acciones recomendadas
Gran proporción de poros no disponibles (se muestran en azul oscuro en el panel de canales y en el gráfico de actividad de poros)

image2022-3-25 10-43-25 Conforme pasa el tiempo, el gráfico de actividad de poros de arriba muestra una proporción creciente de poros no disponibles.		 Hay contaminantes presentes en la muestra Algunos contaminantes se pueden eliminar de los poros mediante la función de desbloqueo incorporada en MinKNOW. Si funciona, el estado de los poros cambiará a "sequencing pores" (secuenciación de poros). Si la porción poros no disponibles se mantiene elevada o aumenta, pruebe una de las siguientes opciones:

1. Realizar un enjuague de nucleasa con el kit de lavado Flow Cell Wash Kit (EXP-WSH004)
2. Realizar varios ciclos de PCR para intentar diluir cualquier contaminante que pueda estar causando problemas.

Gran proporción de poros inactivos

Observación Posible causa Comentarios y acciones recomendadas
Gran proporción de poros inactivos/no disponibles (se muestran en azul claro en el panel de canales y en el gráfico de actividad de poros. Los poros o membranas están dañados de manera irreversible) Se han introducido burbujas de aire en la celda de flujo Las burbujas de aire introducidas durante el cebado de la celda y la carga de la biblioteca pueden dañar los poros de forma permanente. Para conocer las buenas prácticas de cebado y carga de la celda de flujo, ver el vídeo Priming and loading your flow cell
Gran proporción de poros inactivos/no disponibles Ciertos compuestos copurificados con ADN Compuestos conocidos, incluidos los polisacáridos, se asocian generalmente con el ADN genómico de las plantas.

1. Consulte la página Plant leaf DNA extraction method.
2. Limpiar usando el kit QIAGEN PowerClean Pro.
3. Realizar una amplificación del genoma completo con la muestra original de ADNg utilizando el kit QIAGEN REPLI-g.
Gran proporción de poros inactivos/no disponibles Hay contaminantes presentes en la muestra Los efectos de los contaminantes se muestran en la página Contaminants. Probar con un método de extracción alternativo que no provoque el arrastre de contaminantes.

Reducción de la velocidad de secuenciación y del índice de calidad Qscore en una fase avanzada de la secuenciación

Observación Posible causa Comentarios y acciones recomendadas
Reducción de la velocidad de secuenciación y el índice de calidad Qscore en una fase avanzada de la secuenciación En la química del kit 9 (p. ej., SQK-LSK109), cuando la celda de flujo está sobrecargada con la biblioteca se observa un consumo rápido de combustible (consulte el protocolo correspondiente a su biblioteca de ADN para ver las recomendaciones) Añadir más combustible a la celda de flujo, siguiendo las instrucciones en el protocolo de MinKNOW. En futuros experimentos, cargar cantidades menores de biblioteca en la celda de flujo.

Fluctuación de la temperatura

Observación Posible causa Comentarios y acciones recomendadas
Fluctuación de la temperatura La celda de flujo ha perdido contacto con el dispositivo Comprobar que una almohadilla térmica cubra la placa metálica de la parte posterior de la celda de flujo. Reinsertar la celda de flujo y presionar para asegurarse de que las clavijas del conector estén bien conectadas al dispositivo. Si el problema continúa, contacte con el servicio de asistencia técnica.

Error al intentar alcanzar la temperatura deseada

Observación Posible causa Comentarios y acciones recomendadas
MinKNOW muestra el mensaje "Error al intentar alcanzar la temperatura deseada" El dispositivo ha sido colocado en un lugar a una temperatura ambiente inferior a la media o en un lugar con escasa ventilación (lo que provoca el sobrecalientamiento de las celdas de flujo). MinKNOW tiene un tiempo predeterminado para que las celdas de flujo alcancen la temperatura fijada. Una vez transcurrido ese tiempo, aparece un mensaje de error, pero el experimento de secuenciación continua. Secuenciar a una temperatura incorrecta puede llevar a una disminución en el rendimiento y a generar un índice de calidad Qscore menor. Corrija la ubicación del dispositivo, procure que esté a temperatura ambiente y tenga buena ventilación; a continuación, reinicie el proceso en MinKNOW. Encontrará más información sobre el control de temperatura del MinION en este enlace.

Guppy – no input .fast5 was found or basecalled

Observation Possible cause Comments and actions
No input .fast5 was found or basecalled input_path did not point to the .fast5 file location The --input_path has to be followed by the full file path to the .fast5 files to be basecalled, and the location has to be accessible either locally or remotely through SSH.
No input .fast5 was found or basecalled The .fast5 files were in a subfolder at the input_path location To allow Guppy to look into subfolders, add the --recursive flag to the command

Guppy – no Pass or Fail folders were generated after basecalling

Observation Possible cause Comments and actions
No Pass or Fail folders were generated after basecalling The --qscore_filtering flag was not included in the command The --qscore_filtering flag enables filtering of reads into Pass and Fail folders inside the output folder, based on their strand q-score. When performing live basecalling in MinKNOW, a q-score of 7 (corresponding to a basecall accuracy of ~80%) is used to separate reads into Pass and Fail folders.

Guppy – unusually slow processing on a GPU computer

Observation Possible cause Comments and actions
Unusually slow processing on a GPU computer The --device flag wasn't included in the command The --device flag specifies a GPU device to use for accelerate basecalling. If not included in the command, GPU will not be used. GPUs are counted from zero. An example is --device cuda:0 cuda:1, when 2 GPUs are specified to use by the Guppy command.

Last updated: 12/6/2023

Document options

PromethION