Ligation sequencing gDNA - Multiplex Ligation Sequencing Kit V14 XL (SQK-MLK114.96-XL)

Oxford Nanopore Technologies
Document type icon

PromethION: Protocol

Ligation sequencing gDNA - Multiplex Ligation Sequencing Kit V14 XL (SQK-MLK114.96-XL) V MLK_9193_v114_revB_30Sep2024

  • For barcoding of native genomic DNA libraries
  • Requires the Multiplex Ligation Sequencing Kit V14 XL
  • No PCR required
  • Features 96 unique barcodes
  • Enables low-plex sequencing
  • Allows analysis of native DNA
  • Compatible with R10.4.1 flow cells

For Research Use Only

FOR RESEARCH USE ONLY

Descripción general

  • For barcoding of native genomic DNA libraries
  • Requires the Multiplex Ligation Sequencing Kit V14 XL
  • No PCR required
  • Features 96 unique barcodes
  • Enables low-plex sequencing
  • Allows analysis of native DNA
  • Compatible with R10.4.1 flow cells

For Research Use Only

Document version: MLK_9193_v114_revB_30Sep2024

1. Overview of the protocol

Introduction to the manual Multiplex Ligation Sequencing Kit V14 XL protocol

This protocol describes how to carry out native barcoding of genomic DNA using the Multiplex Ligation Sequencing Kit V14 XL (SQK-MLK114.96-XL). This kit is designed to enable low-plex sequencing.

This manual protocol outlines sample preparation with two options for low-plex sequencing:

  • Two samples across one flow cell. Allowing users to sequence up to 96 samples across 48 flow cells, reducing cost per sample.
  • Three samples across two flow cells. Allowing users to sequence up to 96 samples across 64 flow cells, maximising data output.

Using this protocol provides users with an easy workflow for whole genome sequencing (WGS), while enabling scalability options to best suit their sequencing requirements.

To efficiently load multiple PromethION Flow Cells, we recommend using the Loading multiple PromethION Flow Cells protocol as a guideline.

Steps in the sequencing workflow:

Prepare for your experiment You will need to:

  • Extract your DNA, and check its length, quantity and purity. The quality checks performed during the protocol are essential in ensuring experimental success.
  • Ensure you have your sequencing kit, the correct equipment and third-party reagents
  • Download the software for acquiring and analysing your data
  • Check your flow cell to ensure it has enough pores for a good sequencing run

Library preparation

The table below is an overview of the steps required in the library preparation, including timings and optional stopping points.

Library preparation Process Time Stop option
DNA repair and end-prep Repair the fragmented DNA and prepare the DNA ends for barcode attachment 35 minutes 4°C overnight
Native barcode ligation Ligate the native barcodes to the DNA ends 60 minutes 4°C overnight
Adapter ligation and clean-up Attach the sequencing adapters to the barcoded DNA ends 50 minutes 4°C short-term storage or for repeated use, such as re-loading your flow cell
-80°C for single-use, long-term storage.
We strongly recommend sequencing your library as soon as it is adapted.
Priming and loading the flow cell Prime the flow cell and load the prepared library for sequencing 5 minutes

*Please note, timing estimates will vary depending on the number of samples being processed, number of pools generated, number of flow cells loaded and user experience.


MLK11496 workflow image loading options

Sequencing

You will need to:

  • Start a sequencing run using the MinKNOW software, which will collect raw data from the device and convert it into basecalled reads
  • Demultiplex barcoded reads in MinKNOW or the Guppy software
  • (Optional): Start the EPI2ME software and select a workflow for further analysis
IMPORTANTE

We do not recommend mixing barcoded libraries with non-barcoded libraries prior to sequencing.

IMPORTANTE

Optional fragmentation and size selection

By default, the protocol contains no DNA fragmentation step, however in some cases it may be advantageous to fragment your sample. For example, when working with lower amounts of input gDNA (100 ng – 500 ng), fragmentation will increase the number of DNA molecules and therefore increase throughput. Instructions are available in the DNA Fragmentation section of Extraction methods.

Additionally, we offer several options for size-selecting your DNA sample to enrich for long fragments - instructions are available in the Size Selection section of Extraction methods.

IMPORTANTE

Compatibility of this protocol

This protocol should only be used in combination with:

  • Multiplex Ligation Sequencing Kit V14 XL (SQK-MLK114.96-XL)
  • R10.4.1 flow cells (FLO-PRO114M)
  • Sequencing Auxiliary Vials V14 (EXP-AUX003)
  • Native Barcoding Auxiliary Kit V14 (EXP-NBA114)
  • Flow Cell Wash Kit (EXP-WSH004)
  • Flow Cell Wash Kit XL (EXP-WSH004-XL)
  • PromethION 24/48 device - PromethION IT requirements document

2. Equipment and consumables

Material
  • Multiplex Ligation Sequencing Kit V14 XL (SQK-MLK114.96-XL)
  • 1000 ng gDNA per sample
Consumibles
  • Celda de flujo PromethION
  • NEB Blunt/TA Ligase Master Mix (NEB, M0367)
  • NEBNext FFPE Repair Mix (NEB M6630) (mezcla de reparación de ADN)
  • NEBNext Ultra II End Repair/dA-tailing Module (NEB E7546) (Módulo de reparación de extremos/Adición de dA)
  • NEBNext Quick Ligation Module (NEB E6056) (Módulo de ligación rápida)
  • Eppendorf twin.tec® PCR plate 96 LoBind, semi-skirted (Eppendorf™, cat # 0030129504) with heat seals
  • Tubos de PCR de pared fina (0,2 ml)
  • Tubos de 1,5 ml Eppendorf DNA LoBind
  • 2 ml Eppendorf DNA LoBind tubes
  • Agua sin nucleasas (p. ej., ThermoFisher AM9937)
  • Etanol al 80 % recién preparado con agua sin nucleasas
  • Tubos de ensayo Qubit™ (Invitrogen Q32856)
  • Qubit dsDNA HS Assay Kit (Invitrogen Q32851) (kit de ensayo ADNbc alta sensibilidad)
Instrumental
  • Dispositivo PromethION 24/48
  • PromethION Flow Cell Light Shield
  • Mezclador Hula (mezclador giratorio suave)
  • Microfuge
  • Magnetic rack
  • Gradilla magnética
  • Mezclador vórtex
  • Termociclador
  • Multichannel pipette and tips
  • Pipeta y puntas P1000
  • Pipeta y puntas P200
  • Pipeta y puntas P100
  • Pipeta y puntas P20
  • Pipeta y puntas P10
  • Pipeta y puntas P2
  • Cubeta con hielo
  • Temporizador
  • Qubit fluorometer (or equivalent)
Equipo opcional
  • Bioanalizador Agilent (o equivalente)
  • Centrifuga Eppendorf 5424 (o equivalente)

For this protocol, you will need 1000 ng gDNA per sample.

Cantidad de muestra inicial de ADN

Cómo realizar un control de calidad del ADN de la muestra inicial

Es importante que la muestra de ADN cumpla con los requisitos de cantidad y calidad. Usar demasiado ADN, poco o de mala calidad (p. ej., que esté muy fragmentado, que contenga ARN o contaminantes químicos), puede afectar a la preparación de la biblioteca.

Para realizar un control de calidad en la muestra de ADN, consulte el protocolo Input DNA/ RNA QC

Contaminantes químicos

Dependiendo de cómo se extraiga el ADN de la muestra cruda, ciertos contaminantes químicos pueden permanecer en el ADN purificado, lo cual afecta la eficacia de la preparación de la biblioteca y la calidad de la secuenciación. Encontrará más información sobre contaminantes en la página Contaminants de la comunidad Nanopore.

Convenient reagent kits are available on request from NEB for the Multiplex Ligation Sequencing Kit V14 XL.

The NEB Next® Companion Module contains the appropriate reagents and the required volumes for the Multiplex Ligation Sequencing Kit V14 XL. For more information from NEB, please see "Find Products for Nanopore Sequencing".

Reactivos de otros fabricantes

Oxford Nanopore Technologies ha probado y recomienda el uso de todos los reactivos de otros fabricantes citados en este protocolo. No se han evaluado otras alternativas.

Recomendamos preparar estos reactivos siguiendo las instrucciones del fabricante.

Verificar la celda de flujo

Antes de empezar el experimento de secuenciación, recomendamos verificar el número de poros disponibles, presentes en la celda de flujo. La comprobación deberá realizarse en las primeras 12 semanas desde su adquisición, si se trata de celdas de flujo MinION, GridION o PromethION, y en las primeras cuatro semanas tras la compra de celdas de flujo Flongle. Oxford Nanopore Technologies sustituirá cualquier celda de flujo con un número de poros inferior al indicado en la tabla siguiente, siempre y cuando el resultado se notifique dentro de los dos días siguientes a la comprobación y se hayan seguido las instrucciones de almacenamiento. Para verificar la celda de flujo, siga las instrucciones del documento Flow Cell Check.

Celda de flujo Número mínimo de poros activos cubierto por la garantía
Flongle 50
MinION/GridION 800
PromethION 5000
IMPORTANTE

The Native Adapter (NA) used in this kit and protocol is not interchangeable with other sequencing adapters.

Multiplex Ligation Sequencing Kit V14 XL (SQK-MLK114.96-XL) contents

MLK114.96-XL tubes

Name Acronym Cap colour Number of vials Fill volume per vial (µl)
Native Adapter NA Green 1 320
Sequencing Buffer SB Red 4 1,700
Library Beads LIB Pink 4 1,800
Library Solution LIS White cap, pink sticker 4 1,800
EDTA EDTA Clear 1 700
Elution Buffer EB Clear cap, black label 1 10,000
Long Fragment Buffer LFB Clear cap, orange label 1 20,000
Flow Cell Flush FCF Clear cap, light blue label 6 15,500
Flow Cell Tether FCT White cap, purple sticker 2 1,600
AMPure XP Beads AXP Clear cap 1 6,000
Native Barcodes NB01-96 N/A 1 plate 8 µl per well

Note: This product contains AMPure XP Reagent manufactured by Beckman Coulter, Inc. and can be stored at -20°C with the kit without detriment to reagent stability.

The barcodes are orientated in columns in the barcode plate.

2021-09-14 Native Barcoding 96 kit contents v2 columns

To maximise the use of the Multiplex Ligation Sequencing Kit V14 XL, the Native Barcode Auxiliary V14 (EXP-NBA114) and the Sequencing Auxiliary Vials V14 (EXP-AUX003) expansion packs are available.

These expansion packs provide extra library preparation and flow cell priming reagents to allow users to get the most out of their use of the Multiplex Ligation Sequencing Kit V14 XL (SQK-MLK114.96-XL).

Both expansion packs used together will provide enough reagents for 12 reactions. For customers requiring extra EDTA to maximise the use of barcodes, we recommend using 0.25 M EDTA and adding 4 µl.

Native Barcode Auxiliary V14 (EXP-NBA114) contents:

EXP-NBA114 tubes

Name Acronym Cap colour No. of vials Fill volume per vial (µl)
Native Adapter NA Green 2 40
AMPure XP Beads AXP Amber 1 400
Long Fragment Buffer LFB Orange 2 1,800
Short Fragment Buffer SFB Clear 2 1,800

Note: This Product contains AMPure XP Reagent manufactured by Beckman Coulter, Inc. and can be stored at -20°C with the kit without detriment to reagent stability.

Sequencing Auxiliary Vials V14 (EXP-AUX003) contents:

EXP-AUX003 bottles

Name Acronym Cap colour No. of vials Fill volume per vial (μl)
Elution Buffer EB Black 2 500
Sequencing Buffer SB Red 2 700
Library Solution LIS White cap, pink label 2 600
Library Beads LIB Pink 2 600
Flow Cell Flush FCF light blue label 2 8,000
Flow Cell Tether FCT Purple 2 200

Native barcode sequences

Component Forward sequence Reverse sequence
NB01 CACAAAGACACCGACAACTTTCTT AAGAAAGTTGTCGGTGTCTTTGTG
NB02 ACAGACGACTACAAACGGAATCGA TCGATTCCGTTTGTAGTCGTCTGT
NB03 CCTGGTAACTGGGACACAAGACTC GAGTCTTGTGTCCCAGTTACCAGG
NB04 TAGGGAAACACGATAGAATCCGAA TTCGGATTCTATCGTGTTTCCCTA
NB05 AAGGTTACACAAACCCTGGACAAG CTTGTCCAGGGTTTGTGTAACCTT
NB06 GACTACTTTCTGCCTTTGCGAGAA TTCTCGCAAAGGCAGAAAGTAGTC
NB07 AAGGATTCATTCCCACGGTAACAC GTGTTACCGTGGGAATGAATCCTT
NB08 ACGTAACTTGGTTTGTTCCCTGAA TTCAGGGAACAAACCAAGTTACGT
NB09 AACCAAGACTCGCTGTGCCTAGTT AACTAGGCACAGCGAGTCTTGGTT
NB10 GAGAGGACAAAGGTTTCAACGCTT AAGCGTTGAAACCTTTGTCCTCTC
NB11 TCCATTCCCTCCGATAGATGAAAC GTTTCATCTATCGGAGGGAATGGA
NB12 TCCGATTCTGCTTCTTTCTACCTG CAGGTAGAAAGAAGCAGAATCGGA
NB13 AGAACGACTTCCATACTCGTGTGA TCACACGAGTATGGAAGTCGTTCT
NB14 AACGAGTCTCTTGGGACCCATAGA TCTATGGGTCCCAAGAGACTCGTT
NB15 AGGTCTACCTCGCTAACACCACTG CAGTGGTGTTAGCGAGGTAGACCT
NB16 CGTCAACTGACAGTGGTTCGTACT AGTACGAACCACTGTCAGTTGACG
NB17 ACCCTCCAGGAAAGTACCTCTGAT ATCAGAGGTACTTTCCTGGAGGGT
NB18 CCAAACCCAACAACCTAGATAGGC GCCTATCTAGGTTGTTGGGTTTGG
NB19 GTTCCTCGTGCAGTGTCAAGAGAT ATCTCTTGACACTGCACGAGGAAC
NB20 TTGCGTCCTGTTACGAGAACTCAT ATGAGTTCTCGTAACAGGACGCAA
NB21 GAGCCTCTCATTGTCCGTTCTCTA TAGAGAACGGACAATGAGAGGCTC
NB22 ACCACTGCCATGTATCAAAGTACG CGTACTTTGATACATGGCAGTGGT
NB23 CTTACTACCCAGTGAACCTCCTCG CGAGGAGGTTCACTGGGTAGTAAG
NB24 GCATAGTTCTGCATGATGGGTTAG CTAACCCATCATGCAGAACTATGC
NB25 GTAAGTTGGGTATGCAACGCAATG CATTGCGTTGCATACCCAACTTAC
NB26 CATACAGCGACTACGCATTCTCAT ATGAGAATGCGTAGTCGCTGTATG
NB27 CGACGGTTAGATTCACCTCTTACA TGTAAGAGGTGAATCTAACCGTCG
NB28 TGAAACCTAAGAAGGCACCGTATC GATACGGTGCCTTCTTAGGTTTCA
NB29 CTAGACACCTTGGGTTGACAGACC GGTCTGTCAACCCAAGGTGTCTAG
NB30 TCAGTGAGGATCTACTTCGACCCA TGGGTCGAAGTAGATCCTCACTGA
NB31 TGCGTACAGCAATCAGTTACATTG CAATGTAACTGATTGCTGTACGCA
NB32 CCAGTAGAAGTCCGACAACGTCAT ATGACGTTGTCGGACTTCTACTGG
NB33 CAGACTTGGTACGGTTGGGTAACT AGTTACCCAACCGTACCAAGTCTG
NB34 GGACGAAGAACTCAAGTCAAAGGC GCCTTTGACTTGAGTTCTTCGTCC
NB35 CTACTTACGAAGCTGAGGGACTGC GCAGTCCCTCAGCTTCGTAAGTAG
NB36 ATGTCCCAGTTAGAGGAGGAAACA TGTTTCCTCCTCTAACTGGGACAT
NB37 GCTTGCGATTGATGCTTAGTATCA TGATACTAAGCATCAATCGCAAGC
NB38 ACCACAGGAGGACGATACAGAGAA TTCTCTGTATCGTCCTCCTGTGGT
NB39 CCACAGTGTCAACTAGAGCCTCTC GAGAGGCTCTAGTTGACACTGTGG
NB40 TAGTTTGGATGACCAAGGATAGCC GGCTATCCTTGGTCATCCAAACTA
NB41 GGAGTTCGTCCAGAGAAGTACACG CGTGTACTTCTCTGGACGAACTCC
NB42 CTACGTGTAAGGCATACCTGCCAG CTGGCAGGTATGCCTTACACGTAG
NB43 CTTTCGTTGTTGACTCGACGGTAG CTACCGTCGAGTCAACAACGAAAG
NB44 AGTAGAAAGGGTTCCTTCCCACTC GAGTGGGAAGGAACCCTTTCTACT
NB45 GATCCAACAGAGATGCCTTCAGTG CACTGAAGGCATCTCTGTTGGATC
NB46 GCTGTGTTCCACTTCATTCTCCTG CAGGAGAATGAAGTGGAACACAGC
NB47 GTGCAACTTTCCCACAGGTAGTTC GAACTACCTGTGGGAAAGTTGCAC
NB48 CATCTGGAACGTGGTACACCTGTA TACAGGTGTACCACGTTCCAGATG
NB49 ACTGGTGCAGCTTTGAACATCTAG CTAGATGTTCAAAGCTGCACCAGT
NB50 ATGGACTTTGGTAACTTCCTGCGT ACGCAGGAAGTTACCAAAGTCCAT
NB51 GTTGAATGAGCCTACTGGGTCCTC GAGGACCCAGTAGGCTCATTCAAC
NB52 TGAGAGACAAGATTGTTCGTGGAC GTCCACGAACAATCTTGTCTCTCA
NB53 AGATTCAGACCGTCTCATGCAAAG CTTTGCATGAGACGGTCTGAATCT
NB54 CAAGAGCTTTGACTAAGGAGCATG CATGCTCCTTAGTCAAAGCTCTTG
NB55 TGGAAGATGAGACCCTGATCTACG CGTAGATCAGGGTCTCATCTTCCA
NB56 TCACTACTCAACAGGTGGCATGAA TTCATGCCACCTGTTGAGTAGTGA
NB57 GCTAGGTCAATCTCCTTCGGAAGT ACTTCCGAAGGAGATTGACCTAGC
NB58 CAGGTTACTCCTCCGTGAGTCTGA TCAGACTCACGGAGGAGTAACCTG
NB59 TCAATCAAGAAGGGAAAGCAAGGT ACCTTGCTTTCCCTTCTTGATTGA
NB60 CATGTTCAACCAAGGCTTCTATGG CCATAGAAGCCTTGGTTGAACATG
NB61 AGAGGGTACTATGTGCCTCAGCAC GTGCTGAGGCACATAGTACCCTCT
NB62 CACCCACACTTACTTCAGGACGTA TACGTCCTGAAGTAAGTGTGGGTG
NB63 TTCTGAAGTTCCTGGGTCTTGAAC GTTCAAGACCCAGGAACTTCAGAA
NB64 GACAGACACCGTTCATCGACTTTC GAAAGTCGATGAACGGTGTCTGTC
NB65 TTCTCAGTCTTCCTCCAGACAAGG CCTTGTCTGGAGGAAGACTGAGAA
NB66 CCGATCCTTGTGGCTTCTAACTTC GAAGTTAGAAGCCACAAGGATCGG
NB67 GTTTGTCATACTCGTGTGCTCACC GGTGAGCACACGAGTATGACAAAC
NB68 GAATCTAAGCAAACACGAAGGTGG CCACCTTCGTGTTTGCTTAGATTC
NB69 TACAGTCCGAGCCTCATGTGATCT AGATCACATGAGGCTCGGACTGTA
NB70 ACCGAGATCCTACGAATGGAGTGT ACACTCCATTCGTAGGATCTCGGT
NB71 CCTGGGAGCATCAGGTAGTAACAG CTGTTACTACCTGATGCTCCCAGG
NB72 TAGCTGACTGTCTTCCATACCGAC GTCGGTATGGAAGACAGTCAGCTA
NB73 AAGAAACAGGATGACAGAACCCTC GAGGGTTCTGTCATCCTGTTTCTT
NB74 TACAAGCATCCCAACACTTCCACT AGTGGAAGTGTTGGGATGCTTGTA
NB75 GACCATTGTGATGAACCCTGTTGT ACAACAGGGTTCATCACAATGGTC
NB76 ATGCTTGTTACATCAACCCTGGAC GTCCAGGGTTGATGTAACAAGCAT
NB77 CGACCTGTTTCTCAGGGATACAAC GTTGTATCCCTGAGAAACAGGTCG
NB78 AACAACCGAACCTTTGAATCAGAA TTCTGATTCAAAGGTTCGGTTGTT
NB79 TCTCGGAGATAGTTCTCACTGCTG CAGCAGTGAGAACTATCTCCGAGA
NB80 CGGATGAACATAGGATAGCGATTC GAATCGCTATCCTATGTTCATCCG
NB81 CCTCATCTTGTGAAGTTGTTTCGG CCGAAACAACTTCACAAGATGAGG
NB82 ACGGTATGTCGAGTTCCAGGACTA TAGTCCTGGAACTCGACATACCGT
NB83 TGGCTTGATCTAGGTAAGGTCGAA TTCGACCTTACCTAGATCAAGCCA
NB84 GTAGTGGACCTAGAACCTGTGCCA TGGCACAGGTTCTAGGTCCACTAC
NB85 AACGGAGGAGTTAGTTGGATGATC GATCATCCAACTAACTCCTCCGTT
NB86 AGGTGATCCCAACAAGCGTAAGTA TACTTACGCTTGTTGGGATCACCT
NB87 TACATGCTCCTGTTGTTAGGGAGG CCTCCCTAACAACAGGAGCATGTA
NB88 TCTTCTACTACCGATCCGAAGCAG CTGCTTCGGATCGGTAGTAGAAGA
NB89 ACAGCATCAATGTTTGGCTAGTTG CAACTAGCCAAACATTGATGCTGT
NB90 GATGTAGAGGGTACGGTTTGAGGC GCCTCAAACCGTACCCTCTACATC
NB91 GGCTCCATAGGAACTCACGCTACT AGTAGCGTGAGTTCCTATGGAGCC
NB92 TTGTGAGTGGAAAGATACAGGACC GGTCCTGTATCTTTCCACTCACAA
NB93 AGTTTCCATCACTTCAGACTTGGG CCCAAGTCTGAAGTGATGGAAACT
NB94 GATTGTCCTCAAACTGCCACCTAC GTAGGTGGCAGTTTGAGGACAATC
NB95 CCTGTCTGGAAGAAGAATGGACTT AAGTCCATTCTTCTTCCAGACAGG
NB96 CTGAACGGTCATAGAGTCCACCAT ATGGTGGACTCTATGACCGTTCAG

3. DNA repair and end-prep

Material
  • 1000 ng gDNA per sample
  • AMPure XP Beads (AXP) (microesferas magnéticas)
Consumibles
  • NEBNext FFPE DNA Repair Mix (NEB M6630)
  • NEBNext Ultra II End repair/dA-tailing Module (NEB E7546)
  • Agua sin nucleasas (p. ej., ThermoFisher AM9937)
  • Etanol al 80 % recién preparado con agua sin nucleasas
  • Tubos de PCR de pared fina (0,2 ml)
  • Tubos de 1,5 ml Eppendorf DNA LoBind
  • Qubit dsDNA HS Assay Kit (Invitrogen Q32851) (kit de ensayo ADNbc alta sensibilidad)
  • Tubos de ensayo Qubit™ (Invitrogen Q32856)
Instrumental
  • Pipeta y puntas P1000
  • Pipeta y puntas P100
  • Pipeta y puntas P10
  • Thermal cycler
  • Cubeta con hielo
  • Microfuge
  • Hula mixer (gentle rotator mixer)
  • Gradilla magnética
  • Qubit fluorometer (or equivalent)
IMPORTANTE

Optional fragmentation and size selection

By default, the protocol contains no DNA fragmentation step, however in some cases it may be advantageous to fragment your sample. For example, when working with lower amounts of input gDNA (100 ng – 500 ng), fragmentation will increase the number of DNA molecules and therefore increase throughput. Instructions are available in the DNA Fragmentation section of Extraction methods.

Additionally, we offer several options for size-selecting your DNA sample to enrich for long fragments - instructions are available in the Size Selection section of Extraction methods.

Thaw the AMPure XP Beads (AXP) at room temperature and mix by vortexing. Keep the beads at room temperature.

Preparar los reactivos NEBNext FFPE DNA Repair Mix y NEBNext Ultra II End Repair / dA-tailing Module siguiendo las instrucciones del fabricante y poner en hielo.

Para obtener un rendimiento óptimo, NEB recomienda lo siguiente:

  1. Descongelar todos los reactivos en hielo.

  2. Golpear suavemente los tubos de reactivos con el índice o invertirlos, para asegurarse de que estén bien mezclados.
    Nota: No mezclar en vórtex las mezclas FFPE DNA Repair Mix, ni Ultra II End Prep Enzyme Mix.

  3. Centrifugar los tubos antes de abrirlos.

  4. Los tampones Ultra II End Prep Buffer y FFPE DNA Repair Buffer pueden tener un poco de precipitado. Dejar que la mezcla alcance la temperatura ambiente y mezclar pipeteando varias veces para romper el precipitado; para solubilizarlo, agitar el tubo en vórtex durante 30 s.
    Nota: Es importante mezclar bien los tampones mediante vórtex.

  5. El tampón FFPE DNA Repair Buffer puede tener un matiz amarillo; no importa si está así; se puede utilizar.

IMPORTANTE

Do not vortex the NEBNext FFPE DNA Repair Mix or NEBNext Ultra II End Prep Enzyme Mix.

In clean 0.2 ml thin-walled PCR tubes, aliquot 1000 ng per sample.

Make up each sample to 12 µl using nuclease-free water. Mix gently by pipetting and spin down.

Combine the following components per sample:

Between each addition, pipette mix 10 - 20 times.

Reagent Volume
DNA sample 12 µl
NEBNext FFPE DNA Repair Buffer 0.875 µl
Ultra II End-prep reaction buffer 0.875 µl
Ultra II End-prep enzyme mix 0.75 µl
NEBNext FFPE DNA Repair Mix 0.50 µl
Total 15 µl
CONSEJO

When processing increased numbers of samples, we recommend making up a mastermix of the reagents for the total number of samples and adding 3 µl to each individual sample.

Ensure the components are thoroughly mixed by pipetting and spin down briefly.

Incubar en el termociclador, primero a 20 ºC durante 5 minutos y después a 65 ºC durante 5 minutos más.

Transfer each sample to clean 1.5 ml Eppendorf DNA LoBind tube.

Resuspend the AMPure XP beads (AXP) by vortexing.

Add 15 µl of resuspended AMPure XP Beads (AXP) to each end-prep reaction and mix by flicking the tube.

Incubar en el mezclador Hula (o mezclador giratorio suave) durante 5 minutos a temperatura ambiente.

Prepare 500 μl of 80% ethanol in nuclease-free water per sample.

Spin down the samples and pellet the beads on a magnet until the eluate is clear and colourless. Keep the tubes on the magnet and pipette off the supernatant.

Keep the tubes on the magnet and wash the beads with 200 µl of freshly prepared 80% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.

If the pellet was disturbed, wait for beads to pellet again before removing the ethanol.

Repeat the previous step.

Briefly spin down and place the tubes back on the magnet. Pipette off any residual ethanol. Allow to dry for 30 seconds, but do not dry the pellet to the point of cracking.

Remove the tubes from the magnetic rack and resuspend the pellet in 10 µl nuclease-free water. Spin down and incubate for 2 minutes at room temperature.

Pellet the beads on a magnet until the eluate is clear and colourless.

Remove and retain 10 µl of eluate for each sample into clean 1.5 ml Eppendorf DNA LoBind tubes, individually.

Note: If users are having difficulty retaining 10 µl without disturbing the beads, 8.5 µl can be retained instead, allowing 1 µl for quantification and 7.5 µl to be taken forward into the Native Barcode Ligation step.

CHECKPOINT

Quantify 1 µl of each eluted sample using a Qubit fluorometer.

Keeping your samples separate, sandardise them to an equimolar mass.

Make up the volume of each sample to 7.5 µl using nuclease-free water.

FIN DEL PROCESO

Take forward the equimolar samples in 7.5 µl to be barcoded and pooled in the native barcode ligation step. However, at this point it is also possible to store the sample at 4°C overnight.

4. Native barcode ligation

Material
  • Native Barcodes (NB01-NB96)
  • EDTA (EDTA)
  • AMPure XP Beads (AXP) (microesferas magnéticas)
Consumibles
  • Nuclease-free water (e.g. ThermoFisher, cat # AM9937)
  • Etanol al 80 % recién preparado con agua sin nucleasas
  • NEB Blunt/TA Ligase Master Mix (NEB, M0367)
  • 1.5 ml Eppendorf DNA LoBind tubes
  • Qubit dsDNA HS Assay Kit (Invitrogen Q32851) (kit de ensayo ADNbc alta sensibilidad)
  • Tubos de ensayo Qubit™ (Invitrogen Q32856)
Instrumental
  • Gradilla magnética
  • Mezclador vórtex
  • Mezclador Hula (mezclador giratorio suave)
  • Microfuge
  • Termociclador
  • Cubeta con hielo
  • Pipeta y puntas P1000
  • Pipeta y puntas P100
  • Pipeta y puntas P10
Equipo opcional
  • Fluorímetro Qubit (o equivalente para el control de calidad)

Prepare the NEB Blunt/TA Ligase Master Mix according to the manufacturer's instructions, and place on ice:

  1. Thaw the reagents at room temperature.

  2. Spin down the reagent tubes for 5 seconds.

  3. Ensure the reagents are fully mixed by performing 10 full volume pipette mixes.

Thaw the EDTA at room temperature and mix by vortexing. Then spin down and place on ice.

Thaw the native barcodes at room temperature. Use one barcode per sample. Individually mix the barcodes by pipetting, spin down, and place them on ice.

Select a unique barcode for each sample to be run in a group:

  • For two samples on one flow cell, select two unique barcodes, one for each sample.
  • For three samples on two flow cells, select three unique barcodes, one for each sample.

In clean 1.5 ml Eppendorf DNA LoBind tubes, add the reagents in the following order per sample:

Reagent Volume
End-prepped DNA 7.5 µl
Native barcode 2.5 µl
Blunt/TA Ligase Master Mix 10 µl
Total 20 µl

Mezclar pipeteando con suavidad y centrifugar brevemente la reacción para asegurarse de que se mezcla completamente.

Incubate for 20 minutes at room temperature.

Add 4 µl of EDTA to each tube and mix thoroughly by pipetting and spin down briefly.

Note: EDTA is added at this step to stop the reaction.

Pool each group of two or three uniquely barcoded samples in a clean 1.5 ml Eppendorf DNA LoBind tube.

For example:

  • Up to 48 pools of two differentially barcoded samples
  • Up to 32 pools of three differentially barcoded samples

Ensure the beads are at room temperature and resuspend the AMPure XP beads (AXP) by vortexing.

Add AMPure XP Beads (AXP) to the pooled reaction in a 0.4X ratio and mix by pipetting. The volume for AMPure XP Beads (AXP) will vary depending on the number of barcoded samples in the pool:

  • For two barcoded samples add 19 µl of AMPure XP Beads (AXP)
  • For three barcoded samples add 29 µl of AMPure XP Beads (AXP)

Incubate on a Hula mixer (rotator mixer) for 10 minutes at room temperature.

Prepare 1 ml of fresh 80% ethanol in nuclease-free water per barcoded sample pool.

Spin down the sample for 5 seconds and pellet on a magnet for 5 minutes. Keep the tube on the magnetic rack until the eluate is clear and colourless, and pipette off the supernatant.

Keep the tube on the magentic rack and wash the beads with 200 µl of freshly prepared 80% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.

Repetir el paso anterior.

Spin down and place the tube back on the magnetic rack. Pipette off any residual ethanol. Allow the pellet to dry for ~30 seconds, but do not dry the pellet to the point of cracking.

Remove the tube from the magnetic rack and resuspend the pellet in 35 µl nuclease-free water by gently flicking.

Incubate for 10 minutes at 37°C. Every 2 minutes, agitate the sample by gently flicking for 10 seconds to encourage DNA elution.

Spin down the tube for 5 seconds and pellet the beads on a magnetic rack until the eluate is clear and colourless.

Remove and retain 35 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.

CHECKPOINT

Quantify 1 µl of eluted sample using a Qubit fluorometer.

FIN DEL PROCESO

Take forward the barcoded DNA library to the adapter ligation and clean-up step. However, you may store the sample at 4°C overnight.

5. Adapter ligation and clean-up

Material
  • Native Adapter (NA)
  • Long Fragment Buffer (LFB) (tampón para fragmentos largos)
  • Elution Buffer (EB)
  • AMPure XP Beads (AXP) (microesferas magnéticas)
Consumibles
  • NEBNext® Quick Ligation Module (NEB, E6056)
  • Tubos de 1,5 ml Eppendorf DNA LoBind
  • Tubos de ensayo Qubit™ (Invitrogen Q32856)
  • Qubit dsDNA HS Assay Kit (ThermoFisher, Q32851)
Instrumental
  • Microcentrífuga
  • Gradilla magnética
  • Mezclador vórtex
  • Mezclador Hula (mezclador giratorio suave)
  • Termociclador
  • Pipeta y puntas P1000
  • Pipeta y puntas P200
  • Pipeta y puntas P100
  • Pipeta y puntas P20
  • Pipeta y puntas P10
  • Ice bucket with ice
  • Fluorímetro Qubit (o equivalente para el control de calidad)
IMPORTANTE

The Native Adapter (NA) used in this kit and protocol is not interchangeable with other sequencing adapters.

Prepare the NEBNext Quick Ligation Reaction Module according to the manufacturer's instructions, and place on ice:

  1. Thaw the reagents at room temperature.

  2. Spin down the reagent tubes for 5 seconds.

  3. Ensure the reagents are fully mixed by performing 10 full volume pipette mixes. Note: Do NOT vortex the Quick T4 DNA Ligase.

The NEBNext Quick Ligation Reaction Buffer (5x) may have a little precipitate. Allow the mixture to come to room temperature and pipette the buffer up and down several times to break up the precipitate, followed by vortexing the tube for several seconds to ensure the reagent is thoroughly mixed.

IMPORTANTE

Do not vortex the Quick T4 DNA Ligase.

Spin down the Native Adapter (NA) and Quick T4 DNA Ligase, pipette mix and place on ice.

Thaw the Elution Buffer (EB) at room temperature and mix by vortexing. Then spin down and place on ice.

To enrich for DNA fragments of 3 kb or longer, thaw one tube of Long Fragment Buffer (LFB) at room temperature, mix by vortexing, spin down and place on ice.

In a 1.5 ml Eppendorf LoBind tube, mix in the following order:

Between each addition, pipette mix 10 - 20 times.

Reagent Volume
Pooled barcoded sample 30 µl
Native Adapter (NA) 5 µl
NEBNext Quick Ligation Reaction Buffer (5X) 10 µl
Quick T4 DNA Ligase 5 µl
Total 50 µl

Mezclar pipeteando con suavidad y centrifugar brevemente la reacción para asegurarse de que se mezcla completamente.

Incubar la reacción durante 10 minutos a temperatura ambiente.

IMPORTANTE

The next clean-up step uses Long Fragment Buffer (LFB) rather than 80% ethanol to wash the beads. The use of ethanol will be detrimental to the sequencing reaction.

Resuspend the AMPure XP Beads (AXP) by vortexing.

Add 20 µl of resuspended AMPure XP Beads (AXP) to the reaction and mix by pipetting.

Incubate on a Hula mixer (rotator mixer) for 10 minutes at room temperature.

Spin down the sample and pellet on the magnetic rack. Keep the tube on the magnet and pipette off the supernatant.

Wash the beads by adding 125 μl Long Fragment Buffer (LFB). Flick the beads to resuspend, spin down, then return the tube to the magnetic rack and allow the beads to pellet. Remove the supernatant using a pipette and discard.

Repetir el paso anterior.

Centrifugar y colocar el tubo de nuevo en el imán. Retirar con una pipeta cualquier residuo de sobrenadante. Dejar secar el agregado durante 30 s aproximadamente, sin dejar que se agriete.

Remove the tube from the magnetic rack and resuspend pellet in 35 µl Elution Buffer (EB).

Spin down and incubate for 10 minutes at 37°C. Every 2 minutes, agitate the sample by gently flicking for 10 seconds to encourage DNA elution.

Precipitar las microesferas en un imán, durante al menos 1 minuto, hasta que el eluido se vuelva claro e incoloro.

Remove and retain 35 µl of eluate containing the DNA library into a clean 1.5 ml Eppendorf DNA LoBind tube.

Dispose of the pelleted beads

CHECKPOINT

Cuantificar 1 μl de muestra eluida utilizando un fluorímetro Qubit.

Make up each library to 32 µl at 50 fmol, using Elution Buffer (EB).

  • For two samples on one flow cell, make one DNA library from your eluate.
  • For three samples on two flow cells, make two DNA libraries from your eluate.

Note: If there is insufficient DNA to obtain 50 fmol, take forward the full volume of eluate as your DNA library and load onto one flow cell.

IMPORTANTE

Where possible, we recommend loading ~50 fmol of this final prepared library onto the R10.4.1 flow cell for our Multiplex Ligation Sequencing V14 protocol.

FIN DEL PROCESO

La biblioteca preparada se usará para cargar la celda de flujo. Conservar la biblioteca en hielo o a 4 °C hasta el momento de cargar.

CONSEJO

Recomendaciones de guardado de la biblioteca

Se recomienda guardar las bibliotecas en tubos Eppendorf DNA LoBind a 4 ⁰C, durante periodos de tiempo cortos o en caso de uso repetido, por ejemplo, para recargar celdas de flujo entre lavados. Para uso individual y para conservar a largo plazo por periodos de más de 3 meses, se recomienda guardar las bibliotecas a -80 ⁰C en tubos Eppendorf DNA LoBind.

MEDIDA OPCIONAL

If quantities allow, the library may be diluted in Elution Buffer (EB) for splitting across multiple flow cells.

Depending on how many flow cells the library will be split across, more Elution Buffer (EB) than what is supplied in the kit will be required.

6. Priming and loading multiple flow cells on a PromethION

Material
  • Sequencing Buffer (SB)
  • Library Beads (LIB)
  • Library Solution (LIS)
  • Flow Cell Tether (FCT)
  • Flow Cell Flush (FCF)
Consumibles
  • Celda de flujo PromethION
  • 1.5 ml Eppendorf DNA LoBind tubes
  • 2 ml Eppendorf DNA LoBind tubes
Instrumental
  • PromethION 2 Solo device
  • Dispositivo PromethION 24/48
  • P1000 pipette and tips
  • Pipeta y puntas P200
  • Pipeta y puntas P20
IMPORTANTE

This kit is only compatible with R10.4.1 flow cells (FLO-PRO114M).

Uso de Library Solution (LIS)

En la mayoría de experimentos de secuenciación, recomendamos usar Library Beads (LIB) para cargar la biblioteca en la celda de flujo. Nótese, si previamente se ha usado agua para cargar la biblioteca, se deberá usar Library Solution (LIS) en su lugar. Nota: Algunos clientes han notado que las bibliotecas viscosas pueden cargarse con mayor facilidad cuando no se usan Library Beads (LIB).

Thaw the Sequencing Buffer (SB), Library Beads (LIB) or Library Solution (LIS, if using), Flow Cell Tether (FCT) and Flow Cell Flush (FCF) at room temperature, before mixing by vortexing. Then spin down before storing on ice.

IMPORTANTE

Scale up reagent volumes as needed.

Ensure to prepare enough reagents for the total number of flow cells being processed and to take into account extra volume required for pipetting errors.

CONSEJO

Each vial provides enough reagent for the preparation of 12 samples. Thaw the appropriate number of vials of each reagent.

Prepare the flow cell priming mix in a suitable tube for the number of flow cells to flush. Once combined, mix well by briefly vortexing.

Reagents Volume per flow cell
Flow Cell Flush (FCF) 1,170 µl
Flow Cell Tether (FCT) 30 µl
Total volume 1,200 µl
IMPORTANTE

Una vez sacadas de la nevera, esperar 20 minutos antes de insertar las celdas de flujo en el dispositivo y así darles tiempo a que estén a temperatura ambiente. En entornos húmedos se puede formar condensación. Inspeccione las clavijas doradas del conector, situadas en la parte superior e inferior de la celda de flujo, en busca de condensación y si la hubiera, límpiela con una toallita sin pelusa. Procure que la almohadilla térmica (color gris oscuro) esté enganchada en la parte posterior.

For PromethION 2 Solo, load the flow cell(s) as follows:

  1. Place the flow cell flat on the metal plate.

  2. Slide the flow cell into the docking port until the gold pins or green board cannot be seen.

J2068 FC-into-P2-animation V5

For the PromethION 24/48, load the flow cell(s) into the docking ports:

  1. Line up the flow cell with the connector horizontally and vertically before smoothly inserting into position.
  2. Press down firmly onto the flow cell and ensure the latch engages and clicks into place.

Step 1a V3

Step 1B

IMPORTANTE

Insertion of the flow cells at the wrong angle can cause damage to the pins on the PromethION and affect your sequencing results. If you find the pins on a PromethION position are damaged, please contact support@nanoporetech.com for assistance.

Screenshot 2021-04-08 at 12.08.37

If not already completed, perform a flow cell check on all flow cells.

Please refer to the Flow Cell Check protocol for further information.

Slide the inlet port cover clockwise to open.

Prom loading 2

IMPORTANTE

Tenga cuidado a la hora de extraer el tampón de la celda de flujo. No retire más de 20-30 μl y asegúrese de que el tampón cubra la matriz de poros en todo momento. La introducción de burbujas de aire en la matriz puede dañar los poros de manera irreversible.

After opening the inlet port, draw back a small volume to remove any air bubbles:

  1. Set a P1000 pipette tip to 200 µl.
  2. Insert the tip into the inlet port.
  3. Turn the wheel until the dial shows 220-230 µl, or until you see a small volume of buffer entering the pipette tip.

Step 3 v1

Load 500 µl of the priming mix into the flow cell via the inlet port, avoiding the introduction of air bubbles. Wait five minutes. During this time, prepare the library for loading using the next steps in the protocol.

Step 4 v1

Mezclar con la pipeta, minuciosamente, el contenido del vial Library Beads (LIB).

IMPORTANTE

Este vial contiene microesferas en suspensión. Las microesferas precipitan muy rápido; por eso, es fundamental mezclarlas justo antes de usar.

En la mayoría de experimentos de secuenciación, se recomienda usar Library Beads (LIB) . El reactivo Library Solution (LIS) está indicado para bibliotecas de ADN más viscosas.

In a new 1.5 ml Eppendorf DNA LoBind tube, prepare the library for loading as follows:

Reagent Volume per flow cell
Sequencing Buffer (SB) 100 µl
Library Beads (LIB) thoroughly mixed before use, or Library Solution (LIS) 68 µl
DNA library 32 µl
Total 200 µl

Note: Library loading volume has been increased to improve array coverage.

MEDIDA OPCIONAL

The Multiplex Ligation Kit V14 XL is designed for users running multiple flow cells. When handling multiple DNA libraries, the Sequencing Buffer (SB) and Library Beads (LIB) can be combined in a master mix:

  1. Mix the Sequencing Buffer (SB) and Library Beads (LIB) as described above, scaling up the final volume for the appropriate number of samples and adding up to 20% excess of each reagent.
  2. Mix the master mix by pipetting immediately before adding to the DNA samples.
  3. Pipette 168 µl of the master mix into each DNA sample-containing tube.
  4. Mix the samples by pipetting.

Complete the flow cell priming by slowly loading 500 µl of the priming mix into the inlet port.

Step 5 v1

Mezclar la biblioteca pipeteando suavemente, justo antes de cargar.

Load 200 µl of library into the inlet port using a P1000 pipette.

Step 6 v1

Close the valve to seal the inlet port and close the PromethION lid when ready.

Wait a minimum of 10 minutes after loading the flow cells onto the PromethION before initiating any experiments. This will help to increase the sequencing output.

Picture7

IMPORTANTE

Para obtener resultados de secuenciación óptimos, coloque la pantalla protectora sobre la celda de flujo justo después de cargar la biblioteca.

Recomendamos colocar la pantalla protectora en la celda de flujo y dejarla puesta mientras la biblioteca esté cargada, incluyendo los lavados y pasos de recarga. Retirar la pantalla cuando se haya extraído la biblioteca de la celda de flujo.

If the light shield has been removed from the flow cell, install the light shield as follows:

  1. Align the inlet port cut out of the light shield with the inlet port cover on the flow cell. The leading edge of the light shield should sit above the flow cell ID.
  2. Firmly press the light shield around the inlet port cover. The inlet port clip will click into place underneath the inlet port cover.

J2264 - Light shield animation PromethION Flow Cell 8a FAW

J2264 - Light shield animation PromethION Flow Cell 8b FAW

For multiple flow cell washing, use the same experiment name and identifying sample IDs for all runs to enable all flow cells to be paused simultaneously.

Screenshot 2023-02-14 114901

7. Data acquisition and basecalling

Aspectos generales del análisis de datos de nanoporos

Para obtener una descripción completa del análisis de datos de nanoporos, que incluya distintas posibilidades para el análisis de identificación y postidentificicación de bases, consultar el documento Data Analysis.

Cómo empezar a secuenciar

El programa MinKNOW realiza el control del dispositivo de secuenciación, la adquisición de datos y la identificación de bases en tiempo real. Una vez que el usuario ha instalado MinKNOW en su ordenador, hay diferentes maneras de llevar a cabo la secuenciación:

1. Adquisición de datos e identificación de bases en tiempo real con el programa MinKNOW.

Seguir las instrucciones del protocolo de MinKNOW, desde el apartado "Starting a sequencing run" hasta el final del apartado "Completing a MinKNOW run".

2. Adquisición de datos e identificación de bases en tiempo real con el dispositivo GridION.

Seguir las instrucciones del manual de usuario de GridION.

3. Adquisición de datos e identificación de bases en tiempo real con el dispositivo MinION Mk1C.

Seguir las instrucciones del manual de usuario de MinION Mk1C.

4. Adquisición de datos e identificación de bases en tiempo real con el dispositivo PromethION.

Seguir las instrucciones de los manuales de usuario de PromethION o PromethION 2 Solo.

5. Adquisición de datos e identificación de bases posterior mediante MinKNOW.

Seguir las instrucciones del protocolo de MinKNOW, desde el apartado "Starting a sequencing run" hasta el final del apartado "Completing a MinKNOW run". Al configurar los parámetros del experimento, ajustar la pestaña Basecalling (Identificación de bases) en posición de APAGADO. Al terminar el experimento de secuenciación, seguir las instrucciones del apartado "Post-run analysis" del protocolo de MinKNOW.

8. Análisis

Análisis posterior a la identificación de bases

Existen varias opciones para completar el análisis de los datos de identificación de bases:

1. Procesos de trabajo en EPI2ME

Para realizar un análisis de datos exhaustivo, Oxford Nanopore Technologies ofrece una serie de tutoriales y procesos de trabajo de bioinformática, disponibles en EPI2ME Labs, situados en la sección EPI2ME de la comunidad Nanopore. La plataforma proporciona un espacio donde los procesos de trabajo que depositan en GitHub nuestros equipos de Investigación y Aplicaciones, se pueden exponer con textos descriptivos, código bioinformático funcional y datos de ejemplo.

2. Herramientas de análisis

El departamento de Investigación de Oxford Nanopore Technologies ha creado una serie de herramientas de análisis que están disponibles en el repositorio Oxford Nanopore de GitHub. Las herramientas están diseñadas para usuarios avanzados y contienen instrucciones sobre cómo instalar y ejecutar el programa. Estas herramientas están públicamente disponibles y cuentan con un mantenimiento mínimo.

3. Herramientas de análisis desarrolladas por la comunidad

Si en ninguno de los recursos anteriores se proporciona un método de análisis que responda a las necesidades de investigación requeridas, puede consultar la sección Bioinformatics del centro de recursos. Varios miembros de la comunidad Nanopore han desarrollado sus propias herramientas y cartera de productos en desarrollo para analizar los datos de la secuenciación por nanoporos. La mayoría de ellas está disponible en GitHub. Oxford Nanopore Technologies no desarrolla ni mantiene esas herramientas y no garantiza que sean compatibles con la última configuración de química/software.

9. Reutilización y devolución de celdas de flujo

Material
  • Flow Cell Wash Kit (EXP-WSH004) (kit de lavado de celda de flujo)

Si al terminar el experimento desea volver a usar la celda de flujo, siga las instrucciones del protocolo Flow Cell Wash Kit y guarde la celda de flujo lavada a entre 2 °C y 8 ⁰C.

El protocolo Flow Cell Wash Kit está disponible en la comunidad Nanopore.

CONSEJO

Una vez terminado el experimento, recomendamos lavar la celda de flujo cuanto antes. Si no es posible, se puede dejar en el dispositivo y lavar al día siguiente.

Otra posibilidad es seguir el procedimiento de devolución para lavar la celda de flujo y enviarla a Oxford Nanopore.

Aquí puede encontrar las instrucciones para devolver celdas de flujo.

IMPORTANTE

Ante cualquier duda o pregunta acerca del experimento de secuenciación, consulte la guía de resolución de problemas, Troubleshooting Guide, que se encuentra en la versión en línea de este protocolo.

10. Issues during DNA/RNA extraction and library preparation for Kit 14

A continuación hay una lista de los problemas más frecuentes, con algunas posibles causas y soluciones propuestas.

También disponemos de una página de preguntas frecuentes, FAQ, en la sección Support de la comunidad Nanopore.

Si ha probado las soluciones propuestas y continúa teniendo problemas, póngase en contacto con el departamento de asistencia técnica, bien por correo electrónico (support@nanoporetech.com) o a través del Live Chat de la comunidad Nanopore.

Baja calidad de la muestra

Observación Posible causa Comentarios y acciones recomendadas
Baja pureza del ADN (la lectura del Nanodrop para ADN OD 260/280 es <1,8 y OD 260/230 es <2,0-2,2) El método de extracción de ADN no proporciona la pureza necesaria Los efectos de los contaminantes se muestran en la página Contaminants. Pruebe con un método de extracción alternativo que no provoque el arrastre de contaminantes.

Considere realizar un paso adicional de limpieza SPRI.
Baja integridad del ARN (número de integridad del ARN <9,5 RIN o la banda ARNr se muestra como una mancha en el gel). El ARN se degradó durante la extracción Probar un método de extracción de ARN diferente. Encontrará más información sobre RIN en la página RNA Integrity Number. Asimismo, dispone de información adicional en la página DNA/RNA Handling.
El ARN tiene una longitud de fragmento más corta de lo esperado El ARN se degradó durante la extracción Probar un método de extracción de ARN diferente. Encontrará más información sobre RIN en la página RNA Integrity Number. Asimismo, dispone de información adicional en la página DNA/RNA Handling.

Cuando se trabaje con ARN, recomendamos que el espacio de trabajo y el instrumental de laboratorio estén libres de ribonucleasas.

Escasa recuperación de ADN tras la limpieza con microesferas magnéticas AMPure

Observación Posible causa Comentarios y acciones recomendadas
Escasa recuperación Pérdida de ADN debido a una proporción de microesferas magnéticas AMPure por muestra inferior a lo previsto. 1. Las microesferas magnéticas AMPure precipitan con rapidez; antes de añadirlas a la muestra hay que asegurarse de que estén bien resuspendidas.

2. Si la proporción de microesferas por muestra es inferior a 0.4:1, los fragmentos de ADN, sean del tamaño que sean, se perderán durante la limpieza.
Escasa recuperación Los fragmentos de ADN son más cortos de lo esperado Cuanto menor sea la proporción de microesferas magnéticas AMPure por muestra, más rigurosa será la selección de fragmentos largos frente a los cortos. Determinar siempre la longitud de la muestra de ADN en un gel de agarosa u otros métodos de electroforesis en gel, y, a continuación, calcular la cantidad adecuada de microesferas magnéticas que se debe utilizar. SPRI cleanup
Escasa recuperación tras la preparación de extremos El paso de lavado utilizó etanol a <70 % Cuando se utilice etanol a <70 %, el ADN se eluirá de las microesferas magnéticas. Asegúrese de utilizar el porcentaje correcto.

11. Issues during the sequencing run for Kit 14

A continuación hay una lista de los problemas más frecuentes, con algunas posibles causas y soluciones propuestas.

También disponemos de una página de preguntas frecuentes, FAQ, en la sección Support de la comunidad Nanopore.

Si ha probado las soluciones propuestas y continúa teniendo problemas, póngase en contacto con el departamento de asistencia técnica, bien por correo electrónico (support@nanoporetech.com) o a través del Live Chat de la comunidad Nanopore.

Menos poros al inicio de la secuenciación que después de verificar la celda de flujo

Observación Posible causa Comentarios y acciones recomendadas
MinKNOW presentó al inicio de la secuenciación un número de poros inferior al indicado durante la comprobación de la celda de flujo Se introdujo una burbuja de aire en la matriz de nanoporos Tras comprobar el número de poros presente en la celda de flujo, es imprescindible quitar las burbujas que haya cerca del puerto de cebado. Si no se quitan, pueden desplazarse a la matriz de nanoporos y dañar de manera irreversible los nanoporos expuestos al aire. En este vídeo se muestran algunas buenas prácticas para evitar que esto ocurra.
MinKNOW presentó al inicio de la secuenciación un número de poros inferior al indicado durante la comprobación de la celda de flujo La celda de flujo no está colocada correctamente Detener el ciclo de secuenciación, quitar la celda de flujo del dispositivo e insertarla de nuevo. Comprobar que está firmemente asentada en el dispositivo y que ha alcanzado la temperatura deseada. Si procede, probar con una posición diferente del dispositivo (GriION/PromethION).
MinKNOW presentó al inicio de la secuenciación un número de poros inferior al indicado durante la comprobación de la celda de flujo La presencia de contaminantes en la biblioteca ha dañado o bloqueado los poros El número de poros resultante tras la comprobación de la celda de flujo se realiza usando el control de calidad de las moléculas de ADN presentes en el tampón de almacenamiento de la celda de flujo. Al inicio de la secuenciación, se utiliza la misma biblioteca para estimar el número de poros activos. Por este motivo, se estima que puede haber una variabilidad del 10 % en el número de poros detectados. Tener un número de poros considerablemente inferior al inicio de la secuenciación puede deberse a la presencia de contaminantes en la biblioteca que hayan dañado las membranas o bloqueado los poros. Para mejorar la pureza del material de entrada tal vez sea necesario usar métodos de purificación o extracción de ADN/ARN alternativos. Los efectos de los contaminantes están descritos en la página Contaminants. Se recomienda, probar con un método de extracción alternativo que no provoque el arrastre de contaminantes.

Error en el script de MinKNOW

Observación Posible causa Comentarios y acciones recomendadas
MinKNOW muestra el mensaje "Error en el script"
Reiniciar el ordenador y reiniciar MinKNOW. Si el problema continúa, reúna los archivos de registro MinKNOW log files y contacte con el servicio de asistencia técnica. Si no dispone de otro dispositivo de secuenciación, recomendamos que guarde la celda de flujo con la biblioteca cargada a 4 °C y contacte con el servicio de asistencia técnica para recibir recomendaciones de almacenamiento adicionales.

Pore occupancy below 40%

Observation Possible cause Comments and actions
Pore occupancy <40% Not enough library was loaded on the flow cell 50 fmol of good quality library can be loaded on to a PromethION flow cell. Please quantify the library before loading and calculate mols using tools like the Promega Biomath Calculator, choosing "dsDNA: µg to pmol"
Pore occupancy close to 0 The Multiplex Ligation Kit was used, and ethanol was used instead of LFB at the wash step after sequencing adapter ligation Ethanol can denature the motor protein on the sequencing adapters. Make sure the LFB buffer was used after ligation of sequencing adapters.
Pore occupancy close to 0 No tether on the flow cell Tethers are adding during flow cell priming (FCT tube). Make sure FCT was added to FCF before priming.

Longitud de lectura más corta de lo esperado

Observación Posible causa Comentarios y acciones recomendadas
Longitud de lectura más corta de lo esperado Fragmentación no deseada de la muestra de ADN La longitud de lectura refleja la longitud del fragmento de la muestra de ADN. La muestra de ADN se puede fragmentar durante la extracción de la preparación de la biblioteca.

1. Consulte la sección de buenas prácticas de los métodos de extracción en la página Extraction Methods de la comunidad Nanopore.

2. Visualizar la distribución de la longitud de los fragmentos de las muestras de ADN en un gel de agarosa antes de proceder a la preparación de la biblioteca. DNA gel2 En la imagen superior, la muestra 1 contiene alto peso molecular, mientras que la muestra 2 se ha fragmentado.

3. Durante la preparación de la biblioteca, evitar pipetear y agitar en vórtex cuando se mezclen los reactivos. Dar suaves golpes con el dedo o invertir el vial es suficiente.

Gran proporción de poros no disponibles

Observación Posible causa Comentarios y acciones recomendadas
Gran proporción de poros no disponibles (se muestran en azul oscuro en el panel de canales y en el gráfico de actividad de poros)

image2022-3-25 10-43-25 Conforme pasa el tiempo, el gráfico de actividad de poros de arriba muestra una proporción creciente de poros no disponibles.		 Hay contaminantes presentes en la muestra Algunos contaminantes se pueden eliminar de los poros mediante la función de desbloqueo incorporada en MinKNOW. Si funciona, el estado de los poros cambiará a "sequencing pores" (secuenciación de poros). Si la porción poros no disponibles se mantiene elevada o aumenta, pruebe una de las siguientes opciones:

1. Realizar un enjuague de nucleasa con el kit de lavado Flow Cell Wash Kit (EXP-WSH004)
2. Realizar varios ciclos de PCR para intentar diluir cualquier contaminante que pueda estar causando problemas.

Gran proporción de poros inactivos

Observación Posible causa Comentarios y acciones recomendadas
Gran proporción de poros inactivos/no disponibles (se muestran en azul claro en el panel de canales y en el gráfico de actividad de poros. Los poros o membranas están dañados de manera irreversible) Se han introducido burbujas de aire en la celda de flujo Las burbujas de aire introducidas durante el cebado de la celda y la carga de la biblioteca pueden dañar los poros de forma permanente. Para conocer las buenas prácticas de cebado y carga de la celda de flujo, ver el vídeo Priming and loading your flow cell
Gran proporción de poros inactivos/no disponibles Ciertos compuestos copurificados con ADN Compuestos conocidos, incluidos los polisacáridos, se asocian generalmente con el ADN genómico de las plantas.

1. Consulte la página Plant leaf DNA extraction method.
2. Limpiar usando el kit QIAGEN PowerClean Pro.
3. Realizar una amplificación del genoma completo con la muestra original de ADNg utilizando el kit QIAGEN REPLI-g.
Gran proporción de poros inactivos/no disponibles Hay contaminantes presentes en la muestra Los efectos de los contaminantes se muestran en la página Contaminants. Probar con un método de extracción alternativo que no provoque el arrastre de contaminantes.

Fluctuación de la temperatura

Observación Posible causa Comentarios y acciones recomendadas
Fluctuación de la temperatura La celda de flujo ha perdido contacto con el dispositivo Comprobar que una almohadilla térmica cubra la placa metálica de la parte posterior de la celda de flujo. Reinsertar la celda de flujo y presionar para asegurarse de que las clavijas del conector estén bien conectadas al dispositivo. Si el problema continúa, contacte con el servicio de asistencia técnica.

Error al intentar alcanzar la temperatura deseada

Observación Posible causa Comentarios y acciones recomendadas
MinKNOW muestra el mensaje "Error al intentar alcanzar la temperatura deseada" El dispositivo ha sido colocado en un lugar a una temperatura ambiente inferior a la media o en un lugar con escasa ventilación (lo que provoca el sobrecalientamiento de las celdas de flujo). MinKNOW tiene un tiempo predeterminado para que las celdas de flujo alcancen la temperatura fijada. Una vez transcurrido ese tiempo, aparece un mensaje de error, pero el experimento de secuenciación continua. Secuenciar a una temperatura incorrecta puede llevar a una disminución en el rendimiento y a generar un índice de calidad Qscore menor. Corrija la ubicación del dispositivo, procure que esté a temperatura ambiente y tenga buena ventilación; a continuación, reinicie el proceso en MinKNOW. Encontrará más información sobre el control de temperatura del MinION en este enlace.

Last updated: 9/30/2024

Document options

PromethION