Ligation sequencing DNA V14 - dual barcoding (SQK-NBD114.24 with EXP-PBC096)


Descripción general

  • For barcoding genomic or amplicon DNA for nanopore sequencing.
  • Offering highest accuracy
  • Multiplexing up to 2,304 samples
  • Requires PCR steps
  • Compatible with R10.4.1 flow cells

For Research Use Only

Document version: DBC_9184_v114_revL_12Dec2024

1. Overview of the protocol

Dual Barcoding V14 features:

This protocol requires the use of two kits to generate the dual barcoded libraries:

  • PCR Barcoding Expansion 1-96 (EXP-PBC096): up to 96 unique barcodes are available. These PCR barcodes are used as the primary "inner" barcodes.
  • Native Barcoding Kit 24 V14 (SQK-NBD114.24): up to 24 unique barcodes are available. These native barcodes are used as the secondary "outer" barcodes.

These kits are used in successive order and recommended for users who:
  • Want to multiplex up to 2,304 samples, depending on the barcodes they are using from each expansion.
  • Would like to achieve raw read sequencing modal accuracy of Q20+ (99%) or above.
  • Require control over read length.
  • Would like to utilise upstream processes such as size selection or whole genome amplification.

Introduction to the V14 dual barcoding protocol

This protocol allows massively parallel sequencing of up to 2,304 samples (gDNA or amplicons) on a single flow cell. It uses both the PCR Barcoding Expansion 1-96 (EXP-PBC096) and the Native Barcoding Kit 24 V14 (SQK-NBD114.24).

Samples are initially PCR barcoded with the PCR Barcoding Expansion 1-96 (EXP-PBC096), allowing up to 96 samples to be pooled together. There can be up to 24 pools of 96 samples. Each pool of 96 samples will then undergo secondary barcoding through the ligation of one of 24 native barcodes using the Native Barcoding Kit 24 V14 (SQK-NBD114.24). After secondary barcoding, all pools are combined into a single library for sequencing.

Note: For amplicon inputs, first-round PCR product with the following tailed primers are required. 5’ TTTCTGTTGGTGCTGATATTGC-[ project-specific forward primer sequence ] 3’ 5’ ACTTGCCTGTCGCTCTATCTTC-[ project-specific reverse primer sequence ] 3’

Steps in the sequencing workflow:

Prepare for your experiment

You will need to:

  • Extract your DNA, and check its length, quantity and purity. The quality checks performed during the protocol are essential in ensuring experimental success.
  • Ensure you have your sequencing kit, the correct equipment and third-party reagents
  • Download the software for acquiring and analysing your data
  • Check your flow cell to ensure it has enough pores for a good sequencing run

Library preparation

You will need to:

  • Prepare the DNA ends for adapter attachment
  • Attach barcoding adapters supplied in the 96 PCR Barcoding kit to the DNA ends
  • Amplify each barcoded sample by PCR, then pool the 96 samples together (up to 24 pools of 96 samples can be generated)
  • Prepare the DNA ends of your pooled samples for native barcode attachment
  • Ligate native barcodes to the DNA ends for each pool of 96 samples
  • Pool up to 24 native barcoded libraries together
  • Attach sequencing adapters supplied in the kit to the DNA ends of your combined dual barcoded libraries
  • Prime the flow cell, and load your dual barcoded DNA library into the flow cell Dual barcoding workflow V14 SD edit realigned LH

Sequencing and analysis

You will need to:

  • In the current MinKNOW software version, we recommend setting up live basecalling during the sequencing run without live barcoding. Demultiplexing of the dual barcoded reads will be carried out post-run:
    • Start a sequencing run in the MinKNOW software using SQK-LSK114, which will collect raw data from the device and basecall the reads.
    • Demultiplex your run post-sequencing unsing the MinKNOW software.
  • Start the EPI2ME software and select the barcoding workflow for further analysis (this step is optional).
IMPORTANTE

We do not recommend mixing barcoded libraries with non-barcoded libraries prior to sequencing.

IMPORTANTE

Compatibility of this protocol

This protocol should only be used in combination with:

2. Equipment and consumables

Material
  • 100 ng of each sheared DNA sample to be barcoded in 45 µl
  • OR 100 ng first-round PCR product (with tailed primers) per sample
  • PCR Barcoding Expansion 1-96 (EXP-PBC096)
  • Native Barcoding Kit 24 V14 (SQK-NBD114.24)

Consumibles
  • Celda de flujo MinION/GridION
  • NEBNext Ultra II End Repair/dA-tailing Module (NEB E7546) (Módulo de reparación de extremos/Adición de dA)
  • NEBNext® Quick Ligation Module (NEB, E6056)
  • LongAmp Hot Start Taq 2X Master Mix (NEB, M0533)
  • NEB Blunt/TA Ligase Master Mix (NEB, M0367)
  • Tubos de 1,5 ml Eppendorf DNA LoBind
  • 0.2 ml thin-walled PCR tubes or 0.2 ml 96-well PCR plate
  • Etanol al 80 % recién preparado con agua sin nucleasas
  • Agencourt AMPure XP beads (Beckman Coulter, A63881)
  • Agua sin nucleasas (p. ej., ThermoFisher AM9937)
  • Tubos de ensayo Qubit™ (Invitrogen Q32856)
  • Qubit dsDNA HS Assay Kit (Invitrogen Q32851) (kit de ensayo ADNbc alta sensibilidad)
  • (Opcional) Seroalbúmina bovina (BSA) (50 mg/ml) (p. ej., Invitrogen™ UltraPure™ BSA 50 mg/ml, AM2616)

Instrumental
  • Dispositivo MinION o GridION
  • Pantalla protectora celdas de flujo MinION/GridION
  • Mezclador Hula (mezclador giratorio suave)
  • Microcentrífuga
  • Microplate centrifuge, e.g. Fisherbrand™ Mini Plate Spinner Centrifuge (Fisher Scientific, 11766427)
  • Mezclador vórtex
  • Termociclador
  • Gradilla magnética
  • Multichannel pipette and tips
  • Pipeta y puntas P1000
  • Pipeta y puntas P200
  • Pipeta y puntas P100
  • Pipeta y puntas P20
  • Pipeta y puntas P10
  • Pipeta y puntas P2
  • Cubeta con hielo
  • Temporizador
  • Fluorímetro Qubit (o equivalente para el control de calidad)
Equipo opcional
  • Bioanalizador Agilent (o equivalente)
  • Centrifuga Eppendorf 5424 (o equivalente)

100 ng of gDNA is required per sample.

If using amplicons, 100 ng of first-round PCR product (with tailed primers) is required per sample.

IMPORTANTE

Fragmentation and size selection

For successful amplification, it is critical that the DNA fragment distribution of templates used in the PCR are <8 Kbp. If the input DNA is not < Kbp, use follow steps outline in Shearing genomic DNA using the Covaris g-TUBE™ to shear the sample to each a fragment distribution <8 Kbp.

Additionally, we offer several options for size-selecting your DNA sample to enrich for long fragments. Instructions are available in the Size Selection section of Extraction methods.

Cantidad de muestra inicial de ADN

Cómo realizar un control de calidad del ADN de la muestra inicial

Es importante que la muestra de ADN cumpla con los requisitos de cantidad y calidad. Usar demasiado ADN, poco o de mala calidad (p. ej., que esté muy fragmentado, que contenga ARN o contaminantes químicos), puede afectar a la preparación de la biblioteca.

Para realizar un control de calidad en la muestra de ADN, consulte el protocolo Input DNA/ RNA QC

Contaminantes químicos

Dependiendo de cómo se extraiga el ADN de la muestra cruda, ciertos contaminantes químicos pueden permanecer en el ADN purificado, lo cual afecta la eficacia de la preparación de la biblioteca y la calidad de la secuenciación. Encontrará más información sobre contaminantes en la página Contaminants de la comunidad Nanopore.

Reactivos de otros fabricantes

Oxford Nanopore Technologies ha probado y recomienda el uso de todos los reactivos de otros fabricantes citados en este protocolo. No se han evaluado otras alternativas.

Recomendamos preparar estos reactivos siguiendo las instrucciones del fabricante.

Verificar la celda de flujo

Antes de empezar el experimento de secuenciación, recomendamos verificar el número de poros disponibles, presentes en la celda de flujo. La comprobación deberá realizarse en las primeras 12 semanas desde su adquisición, si se trata de celdas de flujo MinION, GridION o PromethION, y en las primeras cuatro semanas tras la compra de celdas de flujo Flongle. Oxford Nanopore Technologies sustituirá cualquier celda de flujo con un número de poros inferior al indicado en la tabla siguiente, siempre y cuando el resultado se notifique dentro de los dos días siguientes a la comprobación y se hayan seguido las instrucciones de almacenamiento. Para verificar la celda de flujo, siga las instrucciones del documento Flow Cell Check.

Celda de flujo Número mínimo de poros activos cubierto por la garantía
Flongle 50
MinION/GridION 800
PromethION 5000
IMPORTANTE

AMPure XP Beads

Within the Native Barcoding Kit 24 V14 (SQK-NBD114.24), AMPure XP Beads (AXP) are supplied at the volume needed to complete the native barcoding sections of the protocol: the second "End-prep", "Native barcode ligation" and "Adapter ligation and clean-up".

However, extra AMPure XP Beads are required for the PCR barcoding steps of the protocol: the first "End-prep", "Ligation of Barcode Adapter" and "Barcoding PCR".

Please note, other purification methods are available.

PCR Barcoding Expansion Pack 1-96 (EXP-PBC096)

2655 10999
Name Acronym Cap colour No. of vials/plates Fill volume per well (µl)
PCR Barcode Primer Mix plate BC01-96 White 1 plate 24
Barcode Adapter plate BCA Blue 1 plate 240

Layout of barcodes in the 96 tube plate

The wells of the 96 tube plate correspond to the barcodes in the following way. All barcodes are supplied at 10 µM concentration and to be used at a final concentration of 0.2 µM.

Barcode 96 plate

Capping and decapping the 96 well format

IMPORTANTE

The Native Adapter (NA) used in this kit and protocol is not interchangeable with other sequencing adapters.

Native Barcoding Kit 24 V14 (SQK-NBD114.24) contents

Note: We are in the process of reformatting the barcodes provided in this kit into a plate format. This will reduce plastic waste and will facilitate automated applications.

Plate format

SQK-NBD114.24 plate format

Name Acronym Cap colour No. of vials Fill volume per vial (µl)
DNA Control Sample DCS Yellow 2 35
Native Adapter NA Green 1 40
Sequencing Buffer SB Red 1 700
Library Beads LIB Pink 1 600
Library Solution LIS White cap, pink label 1 600
Elution Buffer EB Black 2 500
AMPure XP Beads AXP Clear cap, light teal label 1 6,000
Long Fragment Buffer LFB Orange 1 1,800
Short Fragment Buffer SFB Clear 1 1,800
EDTA EDTA Blue 1 700
Flow Cell Flush FCF Clear cap, light blue label 1 8,000
Flow Cell Tether FCT Purple 1 200
Native Barcode plate NB01-24 - 2 plates, 3 sets of barcodes per plate 5 µl per well

Note: This Product Contains AMPure XP Reagent Manufactured by Beckman Coulter, Inc. and can be stored at -20°C with the kit without detriment to reagent stability.

Note: The DNA Control Sample (DCS) is a 3.6 kb standard amplicon mapping the 3' end of the Lambda genome.


Vial format

SQK-NBD114.24 bottle format

Name Acronym Cap colour No. of vials Fill volume per vial (µl)
Native Barcodes NB01-24 Clear 24 (one per barcode) 20
DNA Control Sample DCS Yellow 2 35
Native Adapter NA Green 1 40
Sequencing Buffer SB Red 1 700
Library Beads LIB Pink 1 600
Library Solution LIS White cap, pink label 1 600
Elution Buffer EB Black 2 500
AMPure XP Beads AXP Clear cap, light teal label 1 6,000
Long Fragment Buffer LFB Orange 1 1,800
Short Fragment Buffer SFB Clear 1 1,800
EDTA EDTA Blue 1 700
Flow Cell Flush FCF Clear cap, light blue label 1 8,000
Flow Cell Tether FCT Purple 1 200

Note: This Product Contains AMPure XP Reagent Manufactured by Beckman Coulter, Inc. and can be stored at -20°C with the kit without detriment to reagent stability.

Note: The DNA Control Sample (DCS) is a 3.6 kb standard amplicon mapping the 3' end of the Lambda genome.

To maximise the use of the Native Barcoding Kits, the Native Barcode Auxiliary V14 (EXP-NBA114) and the Sequencing Auxiliary Vials V14 (EXP-AUX003) expansion packs are available.

These expansions provide extra library preparation and flow cell priming reagents to allow users to utilise any unused barcodes for those running in smaller subsets.

Both expansion packs used together will provide enough reagents for 12 reactions. For customers requiring extra EDTA to maximise the use of barcodes, we recommend using 0.25 M EDTA and adding 4 µl for library preps using the SQK-NBD114.24 kit.

Native Barcode Auxiliary V14 (EXP-NBA114) contents:

EXP-NBA114 tubes

Note: This Product contains AMPure XP Reagent manufactured by Beckman Coulter, Inc. and can be stored at -20°C with the kit without detriment to reagent stability.

Sequencing Auxiliary Vials V14 (EXP-AUX003) contents:

EXP-AUX003 bottles

96 barcode sequences

Component Sequence
BC01 / RB01 AAGAAAGTTGTCGGTGTCTTTGTG
BC02 / RB02 TCGATTCCGTTTGTAGTCGTCTGT
BC03 / RB03 GAGTCTTGTGTCCCAGTTACCAGG
BC04 / RB04 TTCGGATTCTATCGTGTTTCCCTA
BC05 / RB05 CTTGTCCAGGGTTTGTGTAACCTT
BC06 / RB06 TTCTCGCAAAGGCAGAAAGTAGTC
BC07 / RB07 GTGTTACCGTGGGAATGAATCCTT
BC08 / RB08 TTCAGGGAACAAACCAAGTTACGT
BC09 / RB09 AACTAGGCACAGCGAGTCTTGGTT
BC10 / RB10 AAGCGTTGAAACCTTTGTCCTCTC
BC11 / RB11 GTTTCATCTATCGGAGGGAATGGA
BC12 / RB12 CAGGTAGAAAGAAGCAGAATCGGA
BC13 / 16S13 / RB13 AGAACGACTTCCATACTCGTGTGA
BC14 / 16S14 / RB14 AACGAGTCTCTTGGGACCCATAGA
BC15 / 16S15 / RB15 AGGTCTACCTCGCTAACACCACTG
BC16 / 16S16 / RB16 CGTCAACTGACAGTGGTTCGTACT
BC17 / 16S17 / RB17 ACCCTCCAGGAAAGTACCTCTGAT
BC18 / 16S18 / RB18 CCAAACCCAACAACCTAGATAGGC
BC19 / 16S19 / RB19 GTTCCTCGTGCAGTGTCAAGAGAT
BC20 / 16S20 / RB20 TTGCGTCCTGTTACGAGAACTCAT
BC21 / 16S21 / RB21 GAGCCTCTCATTGTCCGTTCTCTA
BC22 / 16S22 / RB22 ACCACTGCCATGTATCAAAGTACG
BC23 / 16S23 / RB23 CTTACTACCCAGTGAACCTCCTCG
BC24 / 16S24 / RB24 GCATAGTTCTGCATGATGGGTTAG
BC25 / RB25 GTAAGTTGGGTATGCAACGCAATG
BC26 / RB26 CATACAGCGACTACGCATTCTCAT
BC27 / RB27 CGACGGTTAGATTCACCTCTTACA
BC28 / RB28 TGAAACCTAAGAAGGCACCGTATC
BC29 / RB29 CTAGACACCTTGGGTTGACAGACC
BC30 / RB30 TCAGTGAGGATCTACTTCGACCCA
BC31 / RB31 TGCGTACAGCAATCAGTTACATTG
BC32 / RB32 CCAGTAGAAGTCCGACAACGTCAT
BC33 / RB33 CAGACTTGGTACGGTTGGGTAACT
BC34 / RB34 GGACGAAGAACTCAAGTCAAAGGC
BC35 / RB35 CTACTTACGAAGCTGAGGGACTGC
BC36 / RB36 ATGTCCCAGTTAGAGGAGGAAACA
BC37 / RB37 GCTTGCGATTGATGCTTAGTATCA
BC38 / RB38 ACCACAGGAGGACGATACAGAGAA
BC39 / RB39 CCACAGTGTCAACTAGAGCCTCTC
BC40 / RB40 TAGTTTGGATGACCAAGGATAGCC
BC41 / RB41 GGAGTTCGTCCAGAGAAGTACACG
BC42 / RB42 CTACGTGTAAGGCATACCTGCCAG
BC43 / RB43 CTTTCGTTGTTGACTCGACGGTAG
BC44 / RB44 AGTAGAAAGGGTTCCTTCCCACTC
BC45 / RB45 GATCCAACAGAGATGCCTTCAGTG
BC46 / RB46 GCTGTGTTCCACTTCATTCTCCTG
BC47 / RB47 GTGCAACTTTCCCACAGGTAGTTC
BC48 / RB48 CATCTGGAACGTGGTACACCTGTA
BC49 / RB49 ACTGGTGCAGCTTTGAACATCTAG
BC50 / RB50 ATGGACTTTGGTAACTTCCTGCGT
BC51 / RB51 GTTGAATGAGCCTACTGGGTCCTC
BC52 / RB52 TGAGAGACAAGATTGTTCGTGGAC
BC53 / RB53 AGATTCAGACCGTCTCATGCAAAG
BC54 / RB54 CAAGAGCTTTGACTAAGGAGCATG
BC55 / RB55 TGGAAGATGAGACCCTGATCTACG
BC56 / RB56 TCACTACTCAACAGGTGGCATGAA
BC57 / RB57 GCTAGGTCAATCTCCTTCGGAAGT
BC58 / RB58 CAGGTTACTCCTCCGTGAGTCTGA
BC59 / RB59 TCAATCAAGAAGGGAAAGCAAGGT
BC60 / RB60 CATGTTCAACCAAGGCTTCTATGG
BC61 / RB61 AGAGGGTACTATGTGCCTCAGCAC
BC62 / RB62 CACCCACACTTACTTCAGGACGTA
BC63 / RB63 TTCTGAAGTTCCTGGGTCTTGAAC
BC64 / RB64 GACAGACACCGTTCATCGACTTTC
BC65 / RB65 TTCTCAGTCTTCCTCCAGACAAGG
BC66 / RB66 CCGATCCTTGTGGCTTCTAACTTC
BC67 / RB67 GTTTGTCATACTCGTGTGCTCACC
BC68 / RB68 GAATCTAAGCAAACACGAAGGTGG
BC69 / RB69 TACAGTCCGAGCCTCATGTGATCT
BC70 / RB70 ACCGAGATCCTACGAATGGAGTGT
BC71 / RB71 CCTGGGAGCATCAGGTAGTAACAG
BC72 / RB72 TAGCTGACTGTCTTCCATACCGAC
BC73 / RB73 AAGAAACAGGATGACAGAACCCTC
BC74 / RB74 TACAAGCATCCCAACACTTCCACT
BC75 / RB75 GACCATTGTGATGAACCCTGTTGT
BC76 / RB76 ATGCTTGTTACATCAACCCTGGAC
BC77 / RB77 CGACCTGTTTCTCAGGGATACAAC
BC78 / RB78 AACAACCGAACCTTTGAATCAGAA
BC79 / RB79 TCTCGGAGATAGTTCTCACTGCTG
BC80 / RB80 CGGATGAACATAGGATAGCGATTC
BC81 / RB81 CCTCATCTTGTGAAGTTGTTTCGG
BC82 / RB82 ACGGTATGTCGAGTTCCAGGACTA
BC83 / RB83 TGGCTTGATCTAGGTAAGGTCGAA
BC84 / RB84 GTAGTGGACCTAGAACCTGTGCCA
BC85 / RB85 AACGGAGGAGTTAGTTGGATGATC
BC86 / RB86 AGGTGATCCCAACAAGCGTAAGTA
BC87 / RB87 TACATGCTCCTGTTGTTAGGGAGG
BC88 / RB88 TCTTCTACTACCGATCCGAAGCAG
BC89 / RB89 ACAGCATCAATGTTTGGCTAGTTG
BC90 / RB90 GATGTAGAGGGTACGGTTTGAGGC
BC91 / RB91 GGCTCCATAGGAACTCACGCTACT
BC92 / RB92 TTGTGAGTGGAAAGATACAGGACC
BC93 / RB93 AGTTTCCATCACTTCAGACTTGGG
BC94 / RB94 GATTGTCCTCAAACTGCCACCTAC
BC95 / RB95 CCTGTCTGGAAGAAGAATGGACTT
BC96 / RB96 CTGAACGGTCATAGAGTCCACCAT

Native barcode sequences

Component Forward sequence Reverse sequence
NB01 CACAAAGACACCGACAACTTTCTT AAGAAAGTTGTCGGTGTCTTTGTG
NB02 ACAGACGACTACAAACGGAATCGA TCGATTCCGTTTGTAGTCGTCTGT
NB03 CCTGGTAACTGGGACACAAGACTC GAGTCTTGTGTCCCAGTTACCAGG
NB04 TAGGGAAACACGATAGAATCCGAA TTCGGATTCTATCGTGTTTCCCTA
NB05 AAGGTTACACAAACCCTGGACAAG CTTGTCCAGGGTTTGTGTAACCTT
NB06 GACTACTTTCTGCCTTTGCGAGAA TTCTCGCAAAGGCAGAAAGTAGTC
NB07 AAGGATTCATTCCCACGGTAACAC GTGTTACCGTGGGAATGAATCCTT
NB08 ACGTAACTTGGTTTGTTCCCTGAA TTCAGGGAACAAACCAAGTTACGT
NB09 AACCAAGACTCGCTGTGCCTAGTT AACTAGGCACAGCGAGTCTTGGTT
NB10 GAGAGGACAAAGGTTTCAACGCTT AAGCGTTGAAACCTTTGTCCTCTC
NB11 TCCATTCCCTCCGATAGATGAAAC GTTTCATCTATCGGAGGGAATGGA
NB12 TCCGATTCTGCTTCTTTCTACCTG CAGGTAGAAAGAAGCAGAATCGGA
NB13 AGAACGACTTCCATACTCGTGTGA TCACACGAGTATGGAAGTCGTTCT
NB14 AACGAGTCTCTTGGGACCCATAGA TCTATGGGTCCCAAGAGACTCGTT
NB15 AGGTCTACCTCGCTAACACCACTG CAGTGGTGTTAGCGAGGTAGACCT
NB16 CGTCAACTGACAGTGGTTCGTACT AGTACGAACCACTGTCAGTTGACG
NB17 ACCCTCCAGGAAAGTACCTCTGAT ATCAGAGGTACTTTCCTGGAGGGT
NB18 CCAAACCCAACAACCTAGATAGGC GCCTATCTAGGTTGTTGGGTTTGG
NB19 GTTCCTCGTGCAGTGTCAAGAGAT ATCTCTTGACACTGCACGAGGAAC
NB20 TTGCGTCCTGTTACGAGAACTCAT ATGAGTTCTCGTAACAGGACGCAA
NB21 GAGCCTCTCATTGTCCGTTCTCTA TAGAGAACGGACAATGAGAGGCTC
NB22 ACCACTGCCATGTATCAAAGTACG CGTACTTTGATACATGGCAGTGGT
NB23 CTTACTACCCAGTGAACCTCCTCG CGAGGAGGTTCACTGGGTAGTAAG
NB24 GCATAGTTCTGCATGATGGGTTAG CTAACCCATCATGCAGAACTATGC

3. End-prep

Material
  • 100 ng of each sheared DNA sample to be barcoded in 45 µl

Consumibles
  • NEBNext® Ultra II End Prep Enzyme Mix from NEBNext® Ultra II End Repair Module (NEB, E7546)
  • NEBNext® Ultra II End Prep Reaction Buffer from NEBNext® Ultra II End Repair Module (NEB, E7546)
  • Etanol al 80 % recién preparado con agua sin nucleasas
  • Agua sin nucleasas (p. ej., ThermoFisher AM9937)
  • Agencourt AMPure XP beads (Beckman Coulter, A63881)
  • 0.2 ml thin-walled PCR tubes or 0.2 ml 96-well PCR plate
  • Tubos de ensayo Qubit™ (Invitrogen Q32856)
  • Qubit dsDNA HS Assay Kit (Invitrogen Q32851) (kit de ensayo ADNbc alta sensibilidad)

Instrumental
  • Pipeta y puntas P1000
  • Pipeta y puntas P100
  • Pipeta y puntas P10
  • Termociclador
  • Cubeta con hielo
  • Microfuge
  • Magnetic rack
  • Vortex mixer
Equipo opcional
  • Fluorímetro Qubit (o equivalente para el control de calidad)
CHECKPOINT

Verificar la celda de flujo

Antes de empezar a preparar la biblioteca, recomendamos se verifique la celda de flujo para comprobar que tiene poros suficientes para realizar un buen experimento.

Las instrucciones de comprobación de la celda de flujo están disponibles en el protocolo de MinKNOW.

Prepare the NEBNext Ultra II End Repair / dA-tailing Module reagents in accordance with manufacturer's instructions, and place on ice:

For optimal performance, NEB recommend the following:

  1. Thaw all reagents on ice.

  2. Ensure the reagents are well mixed.
    Note: Do not vortex the Ultra II End Prep Enzyme Mix.

  3. Always spin down tubes before opening for the first time each day.

  4. The NEBNext Ultra II End Prep Reaction Buffer may contain a white precipitate. If this occurs, allow the mixture(s) to come to room temperature and pipette the buffer several times to break up the precipitate, followed by a quick vortex to mix.

Prepare the DNA in nuclease-free water.

  1. Transfer 100 ng DNA of each sample into a fresh 0.2 ml PCR tube or plate
  2. Adjust the volume to 45 μl with nuclease-free water
  3. Mix thoroughly by flicking the tube to avoid unwanted shearing
  4. Spin down briefly in a microfuge

Set up the end-repair reaction as follows for each library:

Reagent Volume per sample
100 ng DNA 45 µl
Ultra II End-prep reaction buffer 7 µl
Ultra II End-prep enzyme mix 3 µl
Nuclease-free water 5 µl
Total 60 µl

Mix by pipetting and briefly spin down.

Using a thermal cycler, incubate for 5 minutes at 20 °C and 5 minutes at 65 °C.

Resuspend the AMPure XP beads by vortexing.

Add 60 µl of resuspended AMPure XP beads to the end-prep reaction and mix by pipetting.

Incubate at room temperature for 5 minutes.

Prepare sufficient fresh 80% ethanol in nuclease-free water for all of your samples. Allow enough for 400 µl per sample, with some excess.

Spin down the samples and pellet on a magnet until supernatant is clear and colourless. Keep the samples on the magnet, and pipette off the supernatant.

Keep the samples on the magnet and wash the beads with 200 µl of freshly prepared 80% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.

Repetir el paso anterior.

Spin down and place the samples back on the magnetic rack. Pipette off any residual ethanol. Allow the pellet to dry for ~30 seconds, but do not dry the pellet to the point of cracking.

Remove the samples from the magnet and resuspend each pellet in 16 µl nuclease-free water. Incubate for 2 minutes at room temperature.

Precipitar las microesferas en un imán, durante al menos 1 minuto, hasta que el eluido se vuelva claro e incoloro.

Remove eluate once it is clear and colourless. Transfer each eluted sample to a new tube or plate well.

Quantify 1 µl of end-prepped DNA using a Qubit fluorometer.

FIN DEL PROCESO

Take forward the end-prepped DNA into the next step. However, at this point it is also possible to store the sample at 4°C overnight.

4. Ligation of Barcode Adapter

Material
  • Barcode Adapter (BCA)

Consumibles
  • NEB Blunt/TA Ligase Master Mix (NEB, cat # M0367)
  • Agencourt AMPure XP beads (Beckman Coulter, A63881)
  • Agua sin nucleasas (p. ej., ThermoFisher AM9937)
  • Etanol al 80 % recién preparado con agua sin nucleasas
  • 0.2 ml thin-walled PCR tubes or 0.2 ml 96-well PCR plate
  • Tubos de ensayo Qubit™ (Invitrogen Q32856)
  • Qubit dsDNA HS Assay Kit (Invitrogen Q32851) (kit de ensayo ADNbc alta sensibilidad)

Instrumental
  • Microfuge
  • Mezclador Hula (mezclador giratorio suave)
  • Mezclador vórtex
  • Cubeta con hielo
  • Multichannel pipette and tips
  • Gradilla magnética
  • P1000 pipette and tips
  • P100 pipette and tips
  • Pipeta y puntas P10
  • Fluorímetro Qubit (o equivalente para el control de calidad)

Prepare the NEB Blunt/TA Ligase Master Mix according to the manufacturer's instructions, and place on ice:

  1. Thaw the reagents at room temperature.

  2. Spin down the reagent tubes for 5 seconds.

  3. Ensure the reagents are fully mixed by performing 10 full volume pipette mixes.

Spin down the Barcode Adapter (BCA), pipette mix and place on ice.

Add the reagents in the order given below, into fresh 0.2 ml PCR tubes or 96-well plate:

Reagent Volume
End-prepped DNA 15 µl
Barcode Adapter 10 µl
Blunt/TA Ligase Master Mix 25 µl
Total 50 µl

Mix by pipetting and briefly spin down.

Incubate the samples for 10 minutes at room temperature.

Resuspend the AMPure XP beads by vortexing.

Add 20 µl of resuspended AMPure XP beads to each sample for a 0.4X clean and mix by pipetting up and down ten times.

Incubar en el hula mixer (o mezclador rotatorio) durante 5 minutos a temperatura ambiente.

Prepare sufficient fresh 80% ethanol in nuclease-free water for all of your samples. Allow enough for 400 µl per sample, with some excess.

Place on a magnetic rack, allow beads to pellet and pipette off supernatant.

Keep the samples on the magnet and wash the beads with 200 µl of freshly prepared 80% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.

Repetir el paso anterior.

Place the samples back on the magnet. Pipette off any residual 80% ethanol. Allow to dry for ~30 seconds, but do not dry the pellet to the point of cracking.

Remove the samples from the magnet and resuspend pellet in 25 µl nuclease-free water. Incubate for 2 minutes at room temperature.

Precipitar las microesferas en un imán, durante al menos 1 minuto, hasta que el eluido se vuelva claro e incoloro.

Remove and retain the eluate once it is clear and colourless. Transfer each eluted sample to a fresh 0.2 ml PCR tube or plate.

  • Dispose of the pelleted beads.

Quantify 1 µl of the adapter ligated DNA using a Qubit fluorometer.

FIN DEL PROCESO

Take forward the adapter ligated samples into the Barcoding PCR step. However, at this point it is also possible to store the sample at 4°C overnight.

5. Barcoding PCR

Material
  • PCR Barcodes (BC01-96, at 10 µM)

Consumibles
  • LongAmp Hot Start Taq 2X Master Mix (NEB, M0533)
  • Nuclease-free water (e.g. ThermoFisher, AM9937)
  • Tubos de 1,5 ml Eppendorf DNA LoBind
  • Eppendorf twin.tec® PCR plate 96 LoBind, semi-skirted (Eppendorf™, cat # 0030129504) with heat seals
  • OR 0.2 ml thin-walled PCR tubes
  • Agencourt AMPure XP Beads (Beckman Coulter™, A63881)
  • Etanol al 80 % recién preparado con agua sin nucleasas
  • Tubos de ensayo Qubit™ (Invitrogen Q32856)
  • Qubit dsDNA HS Assay Kit (Invitrogen Q32851) (kit de ensayo ADNbc alta sensibilidad)

Instrumental
  • Termociclador
  • Gradilla magnética
  • Microfuge
  • Pipeta y puntas P1000
  • P100 pipette and tips
  • Pipeta y puntas P10
  • Fluorímetro Qubit (o equivalente para el control de calidad)

Please note, this protocol is written for a template input of 100–200 fmol with PCR Barcodes (BC01-96) used at a final concentration of 0.2 µM. However, the input mass and the number of PCR cycles may be adjusted as appropriate depending on the requirements of the experiment.

Thaw the PCR Barcodes (BC01-96) required for your number of samples at room temperature. Individually mix the barcodes by pipetting, spin down, and place on ice.

IMPORTANTE

If using amplicon samples, ensure the samples have undergone a round of PCR with tailed primers before commencing with the protocol.

Prepare the samples in nuclease-free water:

  1. Transfer 100-200 fmol of each sample to a clear 0.2 ml PCR tube or plate
  • For 1–12 samples: Adjust the volume to 48 μl with nuclease-free water
  • For 13–96 samples: Adjust the volume to 24 μl with nuclease-free water
  1. Mix thoroughly by flicking the tube or plate to avoid unwanted shearing
  2. Spin down briefly in a microfuge

Select a unique barcode for each sample to be processed in the PCR barcoded pool.

Note: Only use one barcode per sample.

Set up a barcoding PCR reaction as follows for each library in fresh 0.2 ml PCR tubes or a 0.2 ml 96-well PCR plate.

Between each addition, pipette mix 10-20 times.

Reagent Volume per sample for using 1–12 barcodes Volume per sample for using 13 barcodes or more
PCR Barcode (one of BC1-BC96, at 10 µM) 2 µl 1 µl
Adapter-ligated DNA 48 µl 24 µl
LongAmp Taq 2x master mix 50 µl 25 µl
Total volume 100 µl 50 µl

Mix by pipetting and briefly spin down.

Amplify using the following cycling conditions:

Cycle step Temperature Time No. of cycles
Initial denaturation 94 °C 3 mins 1
Denaturation 94 °C 15 secs 15-18 (a)
Annealing 56 °C 15 secs 15-18 (a)
Extension 65 °C 6 mins (b) 15-18 (a)
Final extension 65 °C 10 mins 1
Hold 4 °C

a. Adjust accordingly if input quantities are altered.

b. Adjust accordingly for different lengths of amplicons and the type of polymerase that is being used (LongAmp Taq amplifies at a rate of 50 seconds per kb). Here 6 min is used for ~8 Kbp templates.

Resuspend the AMPure XP beads by vortexing.

Add 0.4X volume of resuspended AMPure XP Beads to each reaction and mix by flicking the tube.

Reagent Volume for 100 µl samples Volume for 50 µl samples
AMPure XP Beads 40 µl 20 µl

Incubate at room temperature for 5 minutes.

Prepare sufficient fresh 80% ethanol in nuclease-free water for all of your samples. Allow enough for 400 µl per sample, with some excess.

Place samples on a magnetic rack, allow beads to pellet and pipette off supernatant.

Keep the samples on the magnet and wash the beads with 200 µl of freshly prepared 80% ethanol without disturbing the pellets. Remove the ethanol using a pipette and discard.

Repeat the previous step.

Spin down and place the samples back on the magnet. Pipette off any residual ethanol. Allow to dry for ~30 seconds, but do not dry the pellets to the point of cracking.

Remove the samples from the magnetic rack and resuspend each pellet in 10 µl nuclease-free water. Incubate for 2 minutes at room temperature.

Pellet the beads on a magnetic rack until the eluate is clear and colourless.

Remove and retain 10 µl of each eluate into clean 0.2 ml PCR tubes or a clean PCR plate.

  • Dispose of the pelleted beads

Quantify the PCR barcoded samples using a Qubit fluorometer and pool all barcoded samples in the desired ratios into a 1.5 ml DNA LoBind Eppendorf tube for each PCR barcoded sample pool.

IMPORTANTE

Each PCR barcoded sample pool should contain 1–96 unique barcodes.

You will have up to 24 separate pools of 96 samples going into the end-prep and native barcode ligation section of the protocol.

Note: Do not mix different PCR barcoded sample pools prior to secondary "outer" barcoding.

Prepare each pooled PCR barcoded sample pool to 200 fmol (130 ng for 1 kb amplicons) in separate tubes and make the volume up to 12.5 µl nuclease-free water.

If the volume of a pool exceeds the 12.5 µl required for the end-prep reaction, consider a 2.5X AMPure XP Bead purification of the pool to concentrate your sample.

FIN DEL PROCESO

The pooled barcoded libraries are now ready to be end-prepped and undergo secondary barcoding. However, at this point it is also possible to store the libraries at 4°C overnight.

6. End-prep

Material
  • Up to 24 pools of PCR barcoded sample pools (with up to 96 samples in each pool), each in 12.5 µl
  • AMPure XP Beads (AXP) (microesferas magnéticas)

Consumibles
  • NEBNext® Ultra II End Prep Enzyme Mix from NEBNext® Ultra II End Repair Module (NEB, E7546)
  • NEBNext® Ultra II End Prep Reaction Buffer from NEBNext® Ultra II End Repair Module (NEB, E7546)
  • Etanol al 80 % recién preparado con agua sin nucleasas
  • Tubos de 1,5 ml Eppendorf DNA LoBind
  • Eppendorf twin.tec® PCR plate 96 LoBind, semi-skirted (Eppendorf™, cat # 0030129504) with heat seals
  • OR 0.2 ml thin-walled PCR tubes
  • Agua sin nucleasas (p. ej., ThermoFisher AM9937)
  • Tubos de ensayo Qubit™ (Invitrogen Q32856)
  • Qubit dsDNA HS Assay Kit (Invitrogen Q32851) (kit de ensayo ADNbc alta sensibilidad)

Instrumental
  • Pipeta y puntas P1000
  • Pipeta y puntas P200
  • Pipeta y puntas P100
  • Pipeta y puntas P20
  • Pipeta y puntas P10
  • P2 pipette and tips
  • Multichannel pipette and tips
  • Thermal cycler
  • Microplate centrifuge, e.g. Fisherbrand™ Mini Plate Spinner Centrifuge (Fisher Scientific, 11766427)
  • Microfuge
  • Cubeta con hielo
  • Magnetic rack
  • Mezclador vórtex
  • Hula mixer (rotator mixer)
  • Qubit fluorometer (or equivalent)

Thaw the AMPure XP Beads (AXP) at room temperature and mix by vortexing. Keep the beads at room temperature until use.

Prepare the NEBNext Ultra II End Repair / dA-tailing Module reagents in accordance with manufacturer's instructions, and place on ice:

For optimal performance, NEB recommend the following:

  1. Thaw all reagents on ice.

  2. Ensure the reagents are well mixed.
    Note: Do not vortex the Ultra II End Prep Enzyme Mix.

  3. Always spin down tubes before opening for the first time each day.

  4. The NEBNext Ultra II End Prep Reaction Buffer may contain a white precipitate. If this occurs, allow the mixture(s) to come to room temperature and pipette the buffer several times to break up the precipitate, followed by a quick vortex to mix.

In clean 0.2 ml thin-walled PCR tubes (or a clean 96-well plate), prepare 200 fmol (130 ng for 1 kb amplicons) of each PCR barcoded sample pool.

Make up each PCR barcoded sample pool to 12.5 µl using nuclease-free water. Mix gently by pipetting and spin down.

Combine the following components per tube/well:

Between each addition, pipette mix 10 - 20 times.

Reagent Volume
PCR barcoded sample pool 12.5 µl
Ultra II End-prep Reaction Buffer 1.75 µl
Ultra II End-prep Enzyme Mix 0.75 µl
Total 15 µl
CONSEJO

We recommend making up a mastermix of the end-prep and DNA repair reagents for the total number of PCR barcoded sample pools and adding 2.5 µl to each well.

Ensure the components are thoroughly mixed by pipetting and spin down in a centrifuge.

Incubar en el termociclador, primero a 20 ºC durante 5 minutos y después a 65 ºC durante 5 minutos más.

Transfer each PCR barcoded sample pool into a clean 1.5 ml Eppendorf DNA LoBind tube.

Resuspend the AMPure XP beads (AXP) by vortexing.

Add 15 µl of resuspended AMPure XP Beads (AXP) to each end-prep reaction and mix by flicking the tube.

Incubar en el hula mixer (o mezclador rotatorio) durante 5 minutos a temperatura ambiente.

Prepare sufficient fresh 80% ethanol in nuclease-free water for all of your samples. Allow enough for 400 µl per PCR barcoded sample pool, with some excess.

Spin down the samples and pellet the beads on a magnet until the eluate is clear and colourless. Keep the tubes on the magnet and pipette off the supernatant.

Keep the tubes on the magnet and wash the beads with 200 µl of freshly prepared 80% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.

If the pellet was disturbed, wait for beads to pellet again before removing the ethanol.

Repetir el paso anterior.

Briefly spin down and place the tubes back on the magnet for the beads to pellet. Pipette off any residual ethanol. Allow to dry for 30 seconds, but do not dry the pellets to the point of cracking.

Remove the tubes from the magnetic rack and resuspend the pellet in 10 µl nuclease-free water. Spin down and incubate for 2 minutes at room temperature.

Precipitar las microesferas en un imán, durante al menos 1 minuto, hasta que el eluido se vuelva claro e incoloro.

Remove and retain 10 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.

  • Dispose of the pelleted beads
CHECKPOINT

Quantify 1 µl of each eluted end-prepped PCR barcoded sample pool using a Qubit fluorometer.

IMPORTANTE

You will have up to 24 separate end-prepped PCR barcoded sample pools to take forward into secondary barcoding via native barcode ligation.

Note: Do not mix the PCR barcoded sample pools prior to secondary "outer" barcoding.

FIN DEL PROCESO

Take forward an equimolar mass of each of the end-prepped PCR barcoded sample pools to undergo secondary barcoding in the native barcode ligation step. However, at this point it is also possible to store the PCR barcoded sample pools at 4°C overnight.

7. Native barcode ligation

Material
  • Native Barcodes (NB01-24)
  • AMPure XP Beads (AXP) (microesferas magnéticas)
  • EDTA (EDTA)

Consumibles
  • NEB Blunt/TA Ligase Master Mix (NEB, M0367)
  • Etanol al 80 % recién preparado con agua sin nucleasas
  • Agua sin nucleasas (p. ej., ThermoFisher AM9937)
  • 1.5 ml Eppendorf DNA LoBind tubes
  • Eppendorf twin.tec® PCR plate 96 LoBind, semi-skirted (Eppendorf™, cat # 0030129504) with heat seals
  • OR 0.2 ml thin-walled PCR tubes
  • Tubos de ensayo Qubit™ (Invitrogen Q32856)
  • Qubit dsDNA HS Assay Kit (ThermoFisher, Q32851)

Instrumental
  • Gradilla magnética
  • Mezclador vórtex
  • Mezclador Hula (mezclador giratorio suave)
  • Microfuge
  • Termociclador
  • Cubeta con hielo
  • Multichannel pipette and tips
  • Pipeta y puntas P1000
  • P200 pipette and tips
  • Pipeta y puntas P100
  • Pipeta y puntas P20
  • Pipeta y puntas P10
  • P2 pipette and tips
  • Fluorímetro Qubit (o equivalente para el control de calidad)

Prepare the NEB Blunt/TA Ligase Master Mix according to the manufacturer's instructions, and place on ice:

  1. Thaw the reagents at room temperature.

  2. Spin down the reagent tubes for 5 seconds.

  3. Ensure the reagents are fully mixed by performing 10 full volume pipette mixes.

Thaw the EDTA at room temperature and mix by vortexing. Then spin down and place on ice.

Thaw the Native Barcodes (NB01-24) at room temperature. Briefly spin down, individually mix the barcodes required for your number of PCR barcoded sample pools by pipetting, and place them on ice.

Select a unique barcode for each PCR barcoded sample pool to be run together on the same flow cell. Up to 24 PCR barcoded sample pools can be barcoded and combined in one experiment.

Note: Only use one barcode per PCR barcoded sample pool.

In clean 0.2 ml PCR-tubes or a 96-well plate, add the reagents in the following order per well:

Between each addition, pipette mix 10 - 20 times.

Reagent Volume
End-prepped DNA (PCR barcoded sample pools) 7.5 µl
Native Barcode (NB01-24) 2.5 µl
Blunt/TA Ligase Master Mix 10 µl
Total 20 µl

Mezclar pipeteando con suavidad y centrifugar brevemente la reacción para asegurarse de que se mezcla completamente.

Incubate for 20 minutes at room temperature.

Add the following volume of EDTA to each well and mix thoroughly by pipetting and spin down briefly.

Note: Ensure you follow the instructions for the cap colour of your EDTA tube.

EDTA cap colour Volume per well
For clear cap EDTA 2 µl
For blue cap EDTA 4 µl
CONSEJO

EDTA is added at this step to stop the reaction.

Pool all the native barcoded sample pools in a 1.5 ml Eppendorf DNA LoBind tube.

Note: Ensure you follow the instructions for the cap colour of your EDTA tube.

Volume per PCR barcoded sample pool For 6 sample pools For 12 sample pools For 24 sample pools
Total volume for preps using clear cap EDTA 22 µl 132 µl 264 µl 528 µl
Total volume for preps using blue cap EDTA 24 µl 144 µl 288 µl 576 µl
CONSEJO

We recommend checking the base of your tubes/plate are all the same volume before pooling and after to ensure all the liquid has been taken forward.

Resuspend the AMPure XP Beads (AXP) by vortexing.

Add 0.4X AMPure XP Beads (AXP) to the pooled reaction, and mix by pipetting.

Note: Ensure you follow the instructions for the cap colour of your EDTA tube.

Volume per sample For 6 samples For 12 samples For 24 samples
Volume of AXP for preps using clear cap EDTA 9 µl 53 µl 106 µl 211 µl
Volume of AXP for preps using blue cap EDTA 10 µl 58 µl 115 µl 230 µl

Incubate on a Hula mixer (rotator mixer) for 10 minutes at room temperature.

Prepare 2 ml of fresh 80% ethanol in nuclease-free water.

Spin down the sample and pellet on a magnet for 5 minutes. Keep the tube on the magnetic rack until the eluate is clear and colourless, and pipette off the supernatant.

Keep the tube on the magnetic rack and wash the beads with 700 µl of freshly prepared 80% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.

If the pellet was disturbed, wait for beads to pellet again before removing the ethanol.

Repetir el paso anterior.

Spin down and place the tube back on the magnetic rack. Pipette off any residual ethanol. Allow the pellet to dry for ~30 seconds, but do not dry the pellet to the point of cracking.

Remove the tube from the magnetic rack and resuspend the pellet in 35 µl nuclease-free water by gently flicking.

Incubate for 10 minutes at 37°C. Every 2 minutes, agitate the sample by gently flicking for 10 seconds to encourage DNA elution.

Pellet the beads on a magnetic rack until the eluate is clear and colourless.

Remove and retain 35 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.

CHECKPOINT

Cuantificar 1 μl de muestra eluida utilizando un fluorímetro Qubit.

FIN DEL PROCESO

Take forward the dual barcoded DNA library to the adapter ligation and clean-up step. However, at this point it is also possible to store the library at 4°C overnight.

8. Adapter ligation and clean-up

Material
  • Long Fragment Buffer (LFB) (tampón para fragmentos largos)
  • Short Fragment Buffer (SFB) (tampón para fragmentos cortos)
  • Elution Buffer (EB)
  • Native Adapter (NA)
  • AMPure XP Beads (AXP) (microesferas magnéticas)

Consumibles
  • NEBNext® Quick Ligation Module (NEB, E6056)
  • Tubos de 1,5 ml Eppendorf DNA LoBind
  • Tubos de ensayo Qubit™ (Invitrogen Q32856)
  • Qubit dsDNA HS Assay Kit (ThermoFisher, Q32851)

Instrumental
  • Microcentrífuga
  • Gradilla magnética
  • Mezclador vórtex
  • Mezclador Hula (mezclador giratorio suave)
  • Termociclador
  • Pipeta y puntas P1000
  • Pipeta y puntas P200
  • Pipeta y puntas P100
  • Pipeta y puntas P20
  • Pipeta y puntas P10
  • Ice bucket with ice
  • Fluorímetro Qubit (o equivalente para el control de calidad)
IMPORTANTE

The Native Adapter (NA) used in this kit and protocol is not interchangeable with other sequencing adapters.

Prepare the NEBNext Quick Ligation Reaction Module according to the manufacturer's instructions, and place on ice:

  1. Thaw the reagents at room temperature.

  2. Spin down the reagent tubes for 5 seconds.

  3. Ensure the reagents are fully mixed by performing 10 full volume pipette mixes. Note: Do NOT vortex the Quick T4 DNA Ligase.

The NEBNext Quick Ligation Reaction Buffer (5x) may have a little precipitate. Allow the mixture to come to room temperature and pipette the buffer up and down several times to break up the precipitate, followed by vortexing the tube for several seconds to ensure the reagent is thoroughly mixed.

IMPORTANTE

Do not vortex the Quick T4 DNA Ligase.

Spin down the Native Adapter (NA) and Quick T4 DNA Ligase, pipette mix and place on ice.

Thaw the Elution Buffer (EB) at room temperature and mix by vortexing. Then spin down and place on ice.

IMPORTANTE

La fase de lavados tras la ligación de los adaptadores está diseñada para enriquecer los fragmentos de ADN de >3 kb o para purificar todos los fragmentos por igual, según el tampón que se utilice -Long Fragment Buffer (LFB) o Short Fragment Buffer (SFB).

  • Para enriquecer fragmentos de ADN de 3 kb o mayores, utilizar el tampón para fragmentos largos, Long Fragment Buffer (LFB).

  • Para conservar fragmentos de ADN de todos los tamaños, utilizar el tampón para fragmentos cortos, Short Fragment Buffer (SFB).

Descongelar el vial Long Fragment Buffer (LFB) o Short Fragment Buffer (SFB) a temperatura ambiente, agitar en vórtex, centrifugar y colocar en hielo.

In a 1.5 ml Eppendorf LoBind tube, mix in the following order:

Between each addition, pipette mix 10 - 20 times.

Reagent Volume
Pooled barcoded libraries 30 µl
Native Adapter (NA) 5 µl
NEBNext Quick Ligation Reaction Buffer (5X) 10 µl
Quick T4 DNA Ligase 5 µl
Total 50 µl

Mezclar pipeteando con suavidad y centrifugar brevemente la reacción para asegurarse de que se mezcla completamente.

Incubate the reaction for 20 minutes at room temperature.

IMPORTANTE

The next clean-up step uses Long Fragment Buffer (LFB) or Short Fragment Buffer (SFB) rather than 80% ethanol to wash the beads. The use of ethanol will be detrimental to the sequencing reaction.

Resuspend the AMPure XP Beads (AXP) by vortexing.

Add 20 µl of resuspended AMPure XP Beads (AXP) to the reaction and mix by pipetting.

Incubate on a Hula mixer (rotator mixer) for 10 minutes at room temperature.

Spin down the sample and pellet on the magnetic rack. Keep the tube on the magnet and pipette off the supernatant.

Wash the beads by adding either 125 μl Long Fragment Buffer (LFB) or Short Fragment Buffer (SFB). Flick the beads to resuspend, spin down, then return the tube to the magnetic rack and allow the beads to pellet. Remove the supernatant using a pipette and discard.

Repetir el paso anterior.

Spin down and place the tube back on the magnet. Pipette off any residual supernatant.

Remove the tube from the magnetic rack and resuspend pellet in 15 µl Elution Buffer (EB).

Spin down and incubate for 10 minutes at 37°C. Every 2 minutes, agitate the sample by gently flicking for 10 seconds to encourage DNA elution.

Precipitar las microesferas en un imán, durante al menos 1 minuto, hasta que el eluido se vuelva claro e incoloro.

Extraer 15 μl del eluido que contiene la biblioteca de ADN y conservar en un tubo de 1,5 ml Eppendorf DNA LoBind.

Deshechar las microesferas precipitadas.

CHECKPOINT

Cuantificar 1 μl de muestra eluida utilizando un fluorímetro Qubit.

Según el tamaño de los fragmentos de la biblioteca de ADN, prepare la biblioteca final en 12 µl de Elution Buffer (EB).

Longitud de fragmentos Cantidad a cargar en la celda de flujo
Muy cortos (<1 kb) 100 fmol
Cortos (1-10 kb) 35–50 fmol
Largos (>10 kb) 300 ng

Nota: Si el producto obtenido en la biblioteca está por debajo de la cantidad de muestra inicial recomendada, cargue la biblioteca entera.

Si es necesario, recomendamos utilizar una calculadora de masa a mol, como la calculadora de NEB.

FIN DEL PROCESO

The prepared library is used for loading onto the flow cell. Store the library on ice or at 4°C until ready to load.

CONSEJO

Recomendaciones de guardado de la biblioteca

Se recomienda guardar las bibliotecas en tubos Eppendorf DNA LoBind a 4 ⁰C, durante periodos de tiempo cortos o en caso de uso repetido, por ejemplo, para recargar celdas de flujo entre lavados. Para uso individual y para conservar a largo plazo por periodos de más de 3 meses, se recomienda guardar las bibliotecas a -80 ⁰C en tubos Eppendorf DNA LoBind.

MEDIDA OPCIONAL

If quantities allow, the library may be diluted in Elution Buffer (EB) for splitting across multiple flow cells.

Depending on how many flow cells the library will be split across, more Elution Buffer (EB) than what is supplied in the kit will be required.

9. Priming and loading the SpotON flow cell

Material
  • Flow Cell Flush (FCF)
  • Flow Cell Tether (FCT) (anclaje de celda de flujo)
  • Library Solution (LIS)
  • Library Beads (LIB) (microesferas de carga de la biblioteca)
  • Sequencing Buffer (SB)

Consumibles
  • Tubos de 1,5 ml Eppendorf DNA LoBind
  • Celda de flujo MinION/GridION
  • Agua sin nucleasas (p. ej., ThermoFisher AM9937)
  • (Opcional) Seroalbúmina bovina (BSA) (50 mg/ml) (p. ej., Invitrogen™ UltraPure™ BSA 50 mg/ml, AM2616)

Instrumental
  • Dispositivo MinION o GridION
  • Pantalla protectora celdas de flujo MinION/GridION
  • Pipeta y puntas P1000
  • Pipeta y puntas P100
  • Pipeta y puntas P20
  • Pipeta y puntas P10
IMPORTANTE

Nótese, este kit es compatible solo con las celdas de flujo R10.4.1 (FLO-MIN114).

CONSEJO

Cebado y carga de la celda de flujo

Se recomienda a los nuevos usuarios que miren el vídeo Priming and loading your flow cell antes de realizar su primer experimento.

Uso de Library Solution (LIS)

En la mayoría de experimentos de secuenciación, recomendamos usar Library Beads (LIB) para cargar la biblioteca en la celda de flujo. Nótese, si previamente se ha usado agua para cargar la biblioteca, se deberá usar Library Solution (LIS) en su lugar. Nota: Algunos clientes han notado que las bibliotecas viscosas pueden cargarse con mayor facilidad cuando no se usan Library Beads (LIB).

Descongelar los viales Sequencing Buffer (SB), Library Beads (LIB) o Library Solution (LIS), -si se requiere-, y un tubo de Flow Cell Flush (FCF) a temperatura ambiente. Agitar en vórtex, centrifugar y colocar en hielo.

IMPORTANTE

Para obtener un rendimiento de secuenciación óptimo y mejorar el rendimiento de las celdas de flujo MinION R10.4.1 (FLO-MIN114), recomendamos añadir seroalbúmina bovina (BSA), en una concentración total de 0,2 mg/ml, a la mezcla de cebado de la celda de flujo.

Nota: No se aconseja utilizar ningún otro tipo de albúmina (p. ej., seroalbúmina humana recombinante).

Para preparar la mezcla de cebado con seroalbúmina bovina, mezclar Flow Cell Flush (FCF) y Flow Cell Tether (FCT) como se indica a continuación. Mezclar con la pipeta a temperatura ambiente.

Nota: Hemos cambiando el formato de algunos de los viales de nuestros kits, de tubos monouso a botellas de mayor cantidad.

Formato en tubos monouso En el tubo de Flow Cell Flush (FCF), añadir directamente 5 µl de seroalbúmina bovina (BSA), a una concentración de 50 mg/ml y 30 µl de Flow Cell Tether (FCT).

Formato en botella: En un tubo proporcionado a la cantidad de celdas de flujo que se vayan a utilizar, mezclar los siguientes reactivos:

Reactivo Volumen por celda de flujo
Flow Cell Flush (FCF) 1 170 µl
Bovine Serum Albumin (BSA) a una concentración de 50 mg/ml 5 µl
Flow Cell Tether (FCT) 30 µl
Volumen total 1 205 µl

Abrir la tapa del dispositivo MinION o GridION y deslizar la celda de flujo debajo del clip. Presionar la celda de flujo con firmeza para asegurar un contacto eléctrico y térmico adecuados.

Flow Cell Loading Diagrams Step 1a

Paso 1b- Diagramas carga de la celda de flujo ES

MEDIDA OPCIONAL

Antes de cargar la biblioteca, verifique la celda de flujo para determinar el número de poros disponible.

Si se ha verificado con anterioridad la cantidad de poros presentes en la celda de flujo, este paso se puede omitir.

Dispone de más información en las instrucciones de comprobación de la celda de flujo, del protocolo de MinKNOW.

Abrir el puerto de cebado de la celda de flujo, deslizando la tapa en el sentido de las agujas del reloj.

Flow Cell Loading Diagrams Step 2

IMPORTANTE

Tenga cuidado a la hora de extraer el tampón de la celda de flujo. No retire más de 20-30 μl y asegúrese de que el tampón cubra la matriz de poros en todo momento. La introducción de burbujas de aire en la matriz puede dañar los poros de manera irreversible.

Tras abrir el puerto de cebado, verificar si hay una burbuja de aire bajo la tapa. Retirar una pequeña cantidad de tampón para quitar las burbujas:

  1. Ajustar una pipeta P1000 a 200 μl.
  2. Introducir la punta de la pipeta en el puerto de cebado.
  3. Girar la rueda hasta que el indicador de volumen marque 220-230 μl o hasta que se pueda ver una pequeña cantidad de tampón entrar en la punta de la pipeta.

Nota: Comprobar que haya un flujo continuo de tampón circulando desde el puerto de cebado a través de la matriz de poros.

Flow Cell Loading Diagrams Step 03 V5

Cargar 800 μl de solución en el puerto de cebado, evitando introducir burbujas de aire. Esperar 5 minutos. Durante este tiempo, preparar la biblioteca para cargar siguiendo los pasos a continuación.

Flow Cell Loading Diagrams Step 04 V5 SPANISH

Mezclar con la pipeta, minuciosamente, el contenido del vial Library Beads (LIB).

IMPORTANTE

Este vial contiene microesferas en suspensión. Las microesferas precipitan muy rápido; por eso, es fundamental mezclarlas justo antes de usar.

En la mayoría de experimentos de secuenciación, se recomienda usar Library Beads (LIB) . El reactivo Library Solution (LIS) está indicado para bibliotecas de ADN más viscosas.

En un tubo nuevo de 1,5 ml Eppendorf DNA LoBind, preparar la biblioteca de la siguiente manera:

Reactivo Volumen por celda de flujo
Sequencing Buffer (SB) 37,5 µl
Library Beads (LIB) mezcladas justo antes de usar, o Library Solution (LIS), si se requiere 25,5 µl
Biblioteca de ADN 12 µl
Total 75 µl

Completar el cebado de la celda de flujo:

  1. Levantar suavemente la tapa del puerto de carga SpotON.
  2. Cargar 200 µl de solución en el puerto de cebado (no en el puerto de muestra SpotON), evitando introducir burbujas de aire.

Flow Cell Loading Diagrams Step 5

Flow Cell Loading Diagrams Step 06 V5 SPANISH 2

Mezclar la biblioteca pipeteando suavemente, justo antes de cargar.

Añadir, gota a gota, 75 μl de la biblioteca preparada en el puerto de muestra SpotON. Procurar que cada gota fluya hacia adentro del puerto antes de añadir la siguiente.

Flow Cell Loading Diagram Step 07 V5 SPANISH

Volver a colocar con cuidado, la tapa del puerto de muestra SpotON, procurando que el tapón encaje en el agujero y cerrar el puerto de cebado.

Step 8 update - SPANISH

Flow Cell Loading Diagrams Step 9 SPANISH

IMPORTANTE

Para obtener resultados de secuenciación óptimos, coloque la pantalla protectora sobre la celda de flujo justo después de cargar la biblioteca.

Recomendamos colocar la pantalla protectora en la celda de flujo y dejarla puesta mientras la biblioteca esté cargada, incluyendo los lavados y pasos de recarga. Retirar la pantalla cuando se haya extraído la biblioteca de la celda de flujo.

Colocar la pantalla protectora de la siguiente manera:

  1. Colocar con cuidado el borde delantero de la pantalla protectora contra el clip. Nota: No hacer fuerza sobre ella.

  2. Colocar la pantalla protectora con suavidad sobre la celda de flujo. La pieza debe asentarse alrededor de la tapa SpotON y debe cubrir por completo la sección superior de la celda de flujo.

J2264 - Light shield animation Flow Cell FAW optimised. SPANISH

ATENCIÓN

La pantalla protectora no está fijada a la celda de flujo. Una vez colocada, es necesario manipularla con cuidado.

FIN DEL PROCESO

Cerrar la tapa del dispositivo y configurar un experimento de secuenciación en MinKNOW.

10. Data acquisition and basecalling

Aspectos generales del análisis de datos de nanoporos

Para obtener una descripción completa del análisis de datos de nanoporos, que incluya distintas posibilidades para el análisis de identificación y postidentificicación de bases, consultar el documento Data Analysis.

How to start sequencing

The sequencing device control, data acquisition and real-time basecalling are carried out by the MinKNOW software. Please ensure MinKNOW is installed on your computer or device. Instructions for this can be found in the MinKNOW protocol.

MinKNOW settings for real-time basecalling:

We recommend setting up real-time basecalling as follows:

Real-time basecalling

Follow the instructions in the MinKNOW protocol beginning from the "Starting a sequencing run" section for your device until the end of the "Completing a MinKNOW run" section.

Select Ligation Sequencing Kit (SQK-LSK114) in "Kit selection". The barcoding option will be unavailable as default. Other parameters can be kept at their default settings.

Picture1

Post-run barcode demultiplexing:

We currently recommend performing demultiplexing for the dual barcoding protocol post-sequencing using the Guppy software.

For a complete guide please refer to our Guppy protocol

Barcode demultiplexing in Guppy for dual barcoding:

To demultiplex your reads by barcode, use the dual barcoding configuration file, specifying the barcode kit as "EXP-DUAL00":

guppy_barcoder --input_path <folder containing FASTQ and/or FASTA files> --save_path <output folder> --config configuration_dual.cfg --barcode_kits "EXP-DUAL00"

For more information and instructions on how to use Guppy, please refer to the relevant sections of the protocol:

Barcode demultiplexing Quick Start

11. Downstream analysis

Análisis posterior a la identificación de bases

Existen varias opciones para completar el análisis de los datos de identificación de bases:

1. Procesos de trabajo en EPI2ME

Para realizar un análisis de datos exhaustivo, Oxford Nanopore Technologies ofrece una serie de tutoriales y procesos de trabajo de bioinformática, disponibles en EPI2ME Labs, situados en la sección EPI2ME de la comunidad Nanopore. La plataforma proporciona un espacio donde los procesos de trabajo que depositan en GitHub nuestros equipos de Investigación y Aplicaciones, se pueden exponer con textos descriptivos, código bioinformático funcional y datos de ejemplo.

2. Herramientas de análisis

El departamento de Investigación de Oxford Nanopore Technologies ha creado una serie de herramientas de análisis que están disponibles en el repositorio Oxford Nanopore de GitHub. Las herramientas están diseñadas para usuarios avanzados y contienen instrucciones sobre cómo instalar y ejecutar el programa. Estas herramientas están públicamente disponibles y cuentan con un mantenimiento mínimo.

3. Herramientas de análisis desarrolladas por la comunidad

Si en ninguno de los recursos anteriores se proporciona un método de análisis que responda a las necesidades de investigación requeridas, puede consultar la sección Bioinformatics del centro de recursos. Varios miembros de la comunidad Nanopore han desarrollado sus propias herramientas y cartera de productos en desarrollo para analizar los datos de la secuenciación por nanoporos. La mayoría de ellas está disponible en GitHub. Oxford Nanopore Technologies no desarrolla ni mantiene esas herramientas y no garantiza que sean compatibles con la última configuración de química/software.

12. Reutilización y devolución de celdas de flujo

Material
  • Flow Cell Wash Kit (EXP-WSH004) (kit de lavado de celda de flujo)

Si al terminar el experimento desea volver a usar la celda de flujo, siga las instrucciones del protocolo Flow Cell Wash Kit y guarde la celda de flujo lavada a entre 2 °C y 8 ⁰C.

El protocolo Flow Cell Wash Kit está disponible en la comunidad Nanopore.

CONSEJO

Una vez terminado el experimento, recomendamos lavar la celda de flujo cuanto antes. Si no es posible, se puede dejar en el dispositivo y lavar al día siguiente.

Otra posibilidad es seguir el procedimiento de devolución para lavar la celda de flujo y enviarla a Oxford Nanopore.

Aquí puede encontrar las instrucciones para devolver celdas de flujo.

IMPORTANTE

Ante cualquier duda o pregunta acerca del experimento de secuenciación, consulte la guía de resolución de problemas, Troubleshooting Guide, que se encuentra en la versión en línea de este protocolo.

13. Issues during DNA/RNA extraction and library preparation for Kit 14

A continuación hay una lista de los problemas más frecuentes, con algunas posibles causas y soluciones propuestas.

También disponemos de una página de preguntas frecuentes, FAQ, en la sección Support de la comunidad Nanopore.

Si ha probado las soluciones propuestas y continúa teniendo problemas, póngase en contacto con el departamento de asistencia técnica, bien por correo electrónico (support@nanoporetech.com) o a través del Live Chat de la comunidad Nanopore.

Baja calidad de la muestra

Observación Posible causa Comentarios y acciones recomendadas
Baja pureza del ADN (la lectura del Nanodrop para ADN OD 260/280 es <1,8 y OD 260/230 es <2,0-2,2) El método de extracción de ADN no proporciona la pureza necesaria Los efectos de los contaminantes se muestran en la página Contaminants. Pruebe con un método de extracción alternativo que no provoque el arrastre de contaminantes.

Considere realizar un paso adicional de limpieza SPRI.
Baja integridad del ARN (número de integridad del ARN <9,5 RIN o la banda ARNr se muestra como una mancha en el gel). El ARN se degradó durante la extracción Probar un método de extracción de ARN diferente. Encontrará más información sobre RIN en la página RNA Integrity Number. Asimismo, dispone de información adicional en la página DNA/RNA Handling.
El ARN tiene una longitud de fragmento más corta de lo esperado El ARN se degradó durante la extracción Probar un método de extracción de ARN diferente. Encontrará más información sobre RIN en la página RNA Integrity Number. Asimismo, dispone de información adicional en la página DNA/RNA Handling.

Cuando se trabaje con ARN, recomendamos que el espacio de trabajo y el instrumental de laboratorio estén libres de ribonucleasas.

Escasa recuperación de ADN tras la limpieza con microesferas magnéticas AMPure

Observación Posible causa Comentarios y acciones recomendadas
Escasa recuperación Pérdida de ADN debido a una proporción de microesferas magnéticas AMPure por muestra inferior a lo previsto. 1. Las microesferas magnéticas AMPure precipitan con rapidez; antes de añadirlas a la muestra hay que asegurarse de que estén bien resuspendidas.

2. Si la proporción de microesferas por muestra es inferior a 0.4:1, los fragmentos de ADN, sean del tamaño que sean, se perderán durante la limpieza.
Escasa recuperación Los fragmentos de ADN son más cortos de lo esperado Cuanto menor sea la proporción de microesferas magnéticas AMPure por muestra, más rigurosa será la selección de fragmentos largos frente a los cortos. Determinar siempre la longitud de la muestra de ADN en un gel de agarosa u otros métodos de electroforesis en gel, y, a continuación, calcular la cantidad adecuada de microesferas magnéticas que se debe utilizar. SPRI cleanup
Escasa recuperación tras la preparación de extremos El paso de lavado utilizó etanol a <70 % Cuando se utilice etanol a <70 %, el ADN se eluirá de las microesferas magnéticas. Asegúrese de utilizar el porcentaje correcto.

14. Issues during the sequencing run for Kit 14

A continuación hay una lista de los problemas más frecuentes, con algunas posibles causas y soluciones propuestas.

También disponemos de una página de preguntas frecuentes, FAQ, en la sección Support de la comunidad Nanopore.

Si ha probado las soluciones propuestas y continúa teniendo problemas, póngase en contacto con el departamento de asistencia técnica, bien por correo electrónico (support@nanoporetech.com) o a través del Live Chat de la comunidad Nanopore.

Menos poros al inicio de la secuenciación que después de verificar la celda de flujo

Observación Posible causa Comentarios y acciones recomendadas
MinKNOW presentó al inicio de la secuenciación un número de poros inferior al indicado durante la comprobación de la celda de flujo Se introdujo una burbuja de aire en la matriz de nanoporos Tras comprobar el número de poros presente en la celda de flujo, es imprescindible quitar las burbujas que haya cerca del puerto de cebado. Si no se quitan, pueden desplazarse a la matriz de nanoporos y dañar de manera irreversible los nanoporos expuestos al aire. En este vídeo se muestran algunas buenas prácticas para evitar que esto ocurra.
MinKNOW presentó al inicio de la secuenciación un número de poros inferior al indicado durante la comprobación de la celda de flujo La celda de flujo no está colocada correctamente Detener el ciclo de secuenciación, quitar la celda de flujo del dispositivo e insertarla de nuevo. Comprobar que está firmemente asentada en el dispositivo y que ha alcanzado la temperatura deseada. Si procede, probar con una posición diferente del dispositivo (GriION/PromethION).
MinKNOW presentó al inicio de la secuenciación un número de poros inferior al indicado durante la comprobación de la celda de flujo La presencia de contaminantes en la biblioteca ha dañado o bloqueado los poros El número de poros resultante tras la comprobación de la celda de flujo se realiza usando el control de calidad de las moléculas de ADN presentes en el tampón de almacenamiento de la celda de flujo. Al inicio de la secuenciación, se utiliza la misma biblioteca para estimar el número de poros activos. Por este motivo, se estima que puede haber una variabilidad del 10 % en el número de poros detectados. Tener un número de poros considerablemente inferior al inicio de la secuenciación puede deberse a la presencia de contaminantes en la biblioteca que hayan dañado las membranas o bloqueado los poros. Para mejorar la pureza del material de entrada tal vez sea necesario usar métodos de purificación o extracción de ADN/ARN alternativos. Los efectos de los contaminantes están descritos en la página Contaminants. Se recomienda, probar con un método de extracción alternativo que no provoque el arrastre de contaminantes.

Error en el script de MinKNOW

Observación Posible causa Comentarios y acciones recomendadas
MinKNOW muestra el mensaje "Error en el script"
Reiniciar el ordenador y reiniciar MinKNOW. Si el problema continúa, reúna los archivos de registro MinKNOW log files y contacte con el servicio de asistencia técnica. Si no dispone de otro dispositivo de secuenciación, recomendamos que guarde la celda de flujo con la biblioteca cargada a 4 °C y contacte con el servicio de asistencia técnica para recibir recomendaciones de almacenamiento adicionales.

Pore occupancy below 40%

Observation Possible cause Comments and actions
Pore occupancy <40% Not enough library was loaded on the flow cell 10–20 fmol of good quality library can be loaded on to a MinION/GridION flow cell. Please quantify the library before loading and calculate mols using tools like the Promega Biomath Calculator, choosing "dsDNA: µg to pmol"
Pore occupancy close to 0 The Native Barcoding Kit was used, and ethanol was used instead of LFB or SFB at the wash step after sequencing adapter ligation Ethanol can denature the motor protein on the sequencing adapters. Make sure the LFB or SFB buffer was used after ligation of sequencing adapters.
Pore occupancy close to 0 No tether on the flow cell Tethers are adding during flow cell priming (FCT tube). Make sure FCT was added to FCF before priming.

Longitud de lectura más corta de lo esperado

Observación Posible causa Comentarios y acciones recomendadas
Longitud de lectura más corta de lo esperado Fragmentación no deseada de la muestra de ADN La longitud de lectura refleja la longitud del fragmento de la muestra de ADN. La muestra de ADN se puede fragmentar durante la extracción de la preparación de la biblioteca.

1. Consulte la sección de buenas prácticas de los métodos de extracción en la página Extraction Methods de la comunidad Nanopore.

2. Visualizar la distribución de la longitud de los fragmentos de las muestras de ADN en un gel de agarosa antes de proceder a la preparación de la biblioteca. DNA gel2 En la imagen superior, la muestra 1 contiene alto peso molecular, mientras que la muestra 2 se ha fragmentado.

3. Durante la preparación de la biblioteca, evitar pipetear y agitar en vórtex cuando se mezclen los reactivos. Dar suaves golpes con el dedo o invertir el vial es suficiente.

Gran proporción de poros no disponibles

Observación Posible causa Comentarios y acciones recomendadas
Gran proporción de poros no disponibles (se muestran en azul oscuro en el panel de canales y en el gráfico de actividad de poros)

image2022-3-25 10-43-25 Conforme pasa el tiempo, el gráfico de actividad de poros de arriba muestra una proporción creciente de poros no disponibles.
Hay contaminantes presentes en la muestra Algunos contaminantes se pueden eliminar de los poros mediante la función de desbloqueo incorporada en MinKNOW. Si funciona, el estado de los poros cambiará a "sequencing pores" (secuenciación de poros). Si la porción poros no disponibles se mantiene elevada o aumenta, pruebe una de las siguientes opciones:

1. Realizar un enjuague de nucleasa con el kit de lavado Flow Cell Wash Kit (EXP-WSH004)
2. Realizar varios ciclos de PCR para intentar diluir cualquier contaminante que pueda estar causando problemas.

Gran proporción de poros inactivos

Observación Posible causa Comentarios y acciones recomendadas
Gran proporción de poros inactivos/no disponibles (se muestran en azul claro en el panel de canales y en el gráfico de actividad de poros. Los poros o membranas están dañados de manera irreversible) Se han introducido burbujas de aire en la celda de flujo Las burbujas de aire introducidas durante el cebado de la celda y la carga de la biblioteca pueden dañar los poros de forma permanente. Para conocer las buenas prácticas de cebado y carga de la celda de flujo, ver el vídeo Priming and loading your flow cell
Gran proporción de poros inactivos/no disponibles Ciertos compuestos copurificados con ADN Compuestos conocidos, incluidos los polisacáridos, se asocian generalmente con el ADN genómico de las plantas.

1. Consulte la página Plant leaf DNA extraction method.
2. Limpiar usando el kit QIAGEN PowerClean Pro.
3. Realizar una amplificación del genoma completo con la muestra original de ADNg utilizando el kit QIAGEN REPLI-g.
Gran proporción de poros inactivos/no disponibles Hay contaminantes presentes en la muestra Los efectos de los contaminantes se muestran en la página Contaminants. Probar con un método de extracción alternativo que no provoque el arrastre de contaminantes.

Reduction in sequencing speed and q-score later into the run

Observation Possible cause Comments and actions
Reduction in sequencing speed and q-score later into the run Fast fuel consumption is typically seen in Kit 9 chemistry (e.g. SQK-LSK109) when the flow cell is overloaded with library. Please see the appropriate protocol for your DNA library to find the recommendation. Add more fuel to the flow cell by following the instructions in the MinKNOW protocol. In future experiments, load lower amounts of library to the flow cell.

Fluctuación de la temperatura

Observación Posible causa Comentarios y acciones recomendadas
Fluctuación de la temperatura La celda de flujo ha perdido contacto con el dispositivo Comprobar que una almohadilla térmica cubra la placa metálica de la parte posterior de la celda de flujo. Reinsertar la celda de flujo y presionar para asegurarse de que las clavijas del conector estén bien conectadas al dispositivo. Si el problema continúa, contacte con el servicio de asistencia técnica.

Error al intentar alcanzar la temperatura deseada

Observación Posible causa Comentarios y acciones recomendadas
MinKNOW muestra el mensaje "Error al intentar alcanzar la temperatura deseada" El dispositivo ha sido colocado en un lugar a una temperatura ambiente inferior a la media o en un lugar con escasa ventilación (lo que provoca el sobrecalientamiento de las celdas de flujo). MinKNOW tiene un tiempo predeterminado para que las celdas de flujo alcancen la temperatura fijada. Una vez transcurrido ese tiempo, aparece un mensaje de error, pero el experimento de secuenciación continua. Secuenciar a una temperatura incorrecta puede llevar a una disminución en el rendimiento y a generar un índice de calidad Qscore menor. Corrija la ubicación del dispositivo, procure que esté a temperatura ambiente y tenga buena ventilación; a continuación, reinicie el proceso en MinKNOW. Encontrará más información sobre el control de temperatura del MinION en este enlace.

Last updated: 12/12/2024

Document options

MinION