Rapid sequencing amplicons - barcoding (SQK-AMB111.24) (AMB_9131_v111_revG_04Oct2021)


1. Overview of the protocol

This is a Developer Release product

Please note, some details of this protocol and kit are expected to change before full release. We recommend always using the most recent version of the protocol.

To see previous versions of this protocol, downloads are available from the 'Previous versions' button on the first page of the protocol.

For more information about our Developer Release programmes, please see this article on product release phases.

Amplicon Barcoding Kit 24 features

This kit is recommended for users who:

  • Want to sequence their own full length amplicons without the need for post-PCR clean-up
  • Want a rapid, ligase-free library preparation that maintains the full length of the amplicons
  • Want to multiplex samples to reduce price per sample

Introduction to the Amplicon Barcoding Kit 24 protocol

This protocol describes how to carry out sequencing of up to 24 amplicon samples using the Amplicon Barcoding Kit 24 (SQK-AMB111.24).

Steps in the sequencing workflow:

Prepare for your experiment

You will need to:

  • Prepare DNA amplicons using your preferred third party reagents
  • Although not a firm requirement, checking the amplicon concentration may be beneficial for equivalent output per sample during sequencing
  • Ensure you have your sequencing kit, the correct equipment and third-party reagents
  • Download the software for acquiring and analysing your data
  • Check your flow cell to ensure it has enough pores for a good sequencing run

Library preparation

You will need to:

  • Attach the supplied Amplicon Barcodes to the respective amplicon samples
  • Pool the barcoded samples, clean up and attach rapid sequencing adapters supplied in the kit to the DNA ends
  • Prime the flow cell, and load your DNA library into the flow cell

SQK-AMB111.24 workflow 1

Sequencing and analysis

You will need to:

  • Start a sequencing run using the MinKNOW software (selecting the SQK-LSK110 kit in the kit selection window), which will collect raw data from the device and convert it into basecalled reads
  • Demultiplex your reads using the Guppy software using instructions provided in the Downstream analysis section.

Demultiplexing

Live demultiplexing in MinKNOW is not enabled for the Amplicon Barcoding Kit 24. Post-run demultiplexing using the standalone Guppy software is required.

Compatibility of this protocol

This protocol should only be used in combination with:

  • Amplicon Barcoding Kit 24 (SQK-AMB111.24)
  • R9.4.1 (FLO-MIN106) flow cells
  • Flow Cell Wash Kit (EXP-WSH004)

2. Equipment and consumables

Material
  • DNA amplicons (within PCR reagent mix or cleaned up; 2 µl per sample)
  • Amplicon Barcoding Kit 24 (SQK-AMB111.24)

Consumibles
  • 0.5 M EDTA, pH 8 (Thermo Scientific, R1021)
  • Tubos Eppendorf DNA LoBind de 1,5 ml
  • Tubos de PCR de pared fina (0,2 ml)
  • Agua sin nucleasas (p. ej., ThermoFisher AM9937)
  • Etanol al 70 % recién preparado en agua sin nucleasas
  • Thermolabile Proteinase K (e.g. NEB, cat # P8111)

Instrumental
  • Mezclador Hula (mezclador giratorio suave)
  • Separador magnético, adecuado para tubos Eppendorf de 1,5 ml
  • Microcentrífuga
  • Mezclador vórtex
  • Thermal cycler and/or heating block
  • Pipeta y puntas P1000
  • Pipeta y puntas P200
  • Pipeta y puntas P100
  • Pipeta y puntas P20
  • Pipeta y puntas P10
  • Pipeta y puntas P2
  • Cubeta con hielo
  • Temporizador
Equipo opcional
  • Fluorímetro Qubit (o equivalente para el control de calidad)

For this protocol, you will need at least 10 ng per sample; numbers based on 1 kb amplicons.

For simplicity, there is no upper limit, so taking an equal volume (e.g. 2 µl) of each amplicon should suffice in most cases. As long as amplicon concentrations are reasonably balanced, equivalent sequencing output per sample is achievable. If there is reason to suspect that amplicon samples differ significantly in concentration, you may wish to quantify your amplicons by Qubit.

Amplicon Barcoding Kit 24 (SQK-AMB111.24) contents

SQK-AMB111.24 tubes 1

Name Acronym Cap colour No. of vials Fill volume per vial (µl)
Rapid Adapter T RAP T Green 1 10
Amplicon Barcode 01-24 AB01-24 Clear 24 10
AMPure XP Beads AXP Brown 1 1,200
Elution Buffer EB Black 1 200
Sequencing Buffer II SBII Red 1 500
Loading Beads II LBII Pink 1 360
Loading Solution LS White cap, pink label 1 400
Flush Tether FLT Purple 1 200
Flush Buffer FB White 6 1,170

Amplicon Barcoding Kit 24 barcode sequences

Component Sequence
AB01 GCACCTGGAACTTGTGCCTTCCAC
AB02 CCGAAATAGGTTATCTGTTGTTGT
AB03 ATCAATCGCTGGACGATGGATTAG
AB04 CCACCCGCTCCTGCCGGTGGGCGT
AB05 AGACTCTTGGGCTCGCCACGTCCC
AB06 TCTGTATCCGGAGACGGGATGGAC
AB07 TTTCGGATCAATCGACCGCAAACG
AB08 ACTCAAACATTCTGTTAGATCGCG
AB09 AAATGGAACCCGGATATGTTTACT
AB10 TAAATCGACCTATGATGAACACAG
AB11 ACATGTTGGAGTGAAAGTCGGGTA
AB12 CCTGGACCACGATCATTGTAACAT
AB13 TATGGTGGATCTCCCTCTATCTTC
AB14 AAGTAAATGGGACGCCCACTCCGA
AB15 TGTTCGCGGCTTGATCTAATATTA
AB16 AGAGAGCTTCCCGGGAGGGTGGTC
AB17 TTGTGAATATCTGTCACAAACACC
AB18 CAATCGTACCAGGGAACATAAAGT
AB19 CACACCCAAACAATATGGACCCGT
AB20 AATAACCACATCCGCCCTCCGCAC
AB21 TCCTAATAATGTGTAGATCGGTCC
AB22 AGTCGATGGAACAAGAGAAGTTAT
AB23 AAACTCACTGTATGTCGTTTCTAT
AB24 TGACATCACTGATCGAGGAAGATC

3. Computer requirements and software

MinION Mk1B IT requirements

Sequencing on a MinION Mk1B requires a high-spec computer or laptop to keep up with the rate of data acquisition. For more information, refer to the MinION Mk1B IT requirements document.

Software for nanopore sequencing

MinKNOW

The MinKNOW software controls the nanopore sequencing device, collects sequencing data and basecalls in real time. You will be using MinKNOW for every sequencing experiment to sequence, basecall and demultiplex if your samples were barcoded.

For instructions on how to run the MinKNOW software, please refer to the MinKNOW protocol.

EPI2ME (optional)

The EPI2ME cloud-based platform performs further analysis of basecalled data, for example alignment to the Lambda genome, barcoding, or taxonomic classification. You will use the EPI2ME platform only if you would like further analysis of your data post-basecalling.

For instructions on how to create an EPI2ME account and install the EPI2ME Desktop Agent, please refer to this link.

Check your flow cell

We highly recommend that you check the number of pores in your flow cell prior to starting a sequencing experiment. This should be done within 12 weeks of purchasing for MinION/GridION/PromethION or within four weeks of purchasing Flongle Flow Cells. Oxford Nanopore Technologies will replace any flow cell with fewer than the number of pores in the table below, when the result is reported within two days of performing the flow cell check, and when the storage recommendations have been followed. To do the flow cell check, please follow the instructions in the Flow Cell Check document.

Flow cell Minimum number of active pores covered by warranty
Flongle Flow Cell 50
MinION/GridION Flow Cell 800
PromethION Flow Cell 5000

4. Library preparation

Material
  • DNA amplicons (within PCR reagent mix or cleaned up; 2 µl per sample)
  • Amplicon Barcodes (AB01-24)
  • Elution Buffer (EB)
  • Rapid Adapter T (RAP T)
  • AMPure XP Beads (AXP)

Consumibles
  • Agua sin nucleasas (p. ej., ThermoFisher AM9937)
  • 0.5 M EDTA, pH 8 (Thermo Scientific, R1021)
  • Etanol al 70 % recién preparado en agua sin nucleasas
  • Thermolabile Proteinase K (e.g. NEB, cat # P8111)
  • Tubos Eppendorf DNA LoBind de 1,5 ml
  • Tubos de PCR de pared fina (0,2 ml)

Instrumental
  • Microcentrífuga
  • Mezclador Hula (mezclador giratorio suave)
  • Gradilla magnética
  • Mezclador vórtex
  • Cubeta con hielo
  • Thermal cycler and/or heating block
  • Temporizador
  • Pipeta y puntas P1000
  • Pipeta y puntas P200
  • Pipeta y puntas P100
  • Pipeta y puntas P20
  • Pipeta y puntas P10
  • Pipeta y puntas P2
Equipo opcional
  • Qubit fluorometer (or equivalent)

For this protocol, you will need at least 10 ng per sample; numbers based on 1 kb amplicons.

For simplicity, there is no upper limit, so taking an equal volume (e.g. 2 µl) of each amplicon should suffice in most cases. As long as amplicon concentrations are reasonably balanced, equivalent sequencing output per sample is achievable. If there is reason to suspect that amplicon samples differ significantly in concentration, you may wish to quantify your amplicons by Qubit.

Thaw kit components at room temperature, spin down briefly using a microfuge and mix by pipetting as indicated by the table below:

Reagent 1. Thaw at room temperature 2. Briefly spin down 3. Mix well by pipetting
Amplicon Barcodes 01-24 (AB01-24) Not frozen
Rapid Adapter T (RAP T) Not frozen
AMPure XP Beads (AXP) Mix by pipetting or vortexing immediately before use

Spin down the Thermolabile Proteinase K, pipette mix and place on ice.

Select a unique barcode for each sample to be run together on the same flow cell. Up to 24 samples can be barcoded and combined in one experiment.

Please note: Only use one barcode per sample.

In a 0.2 ml thin-walled PCR tube, prepare the following for each amplicon sample:

Between each addition, pipette mix 10 - 20 times.

Reagent Volume
Nuclease-free water 6.5 µl
0.5 M EDTA, pH 8.0 0.5 µl
Amplicon sample 2 µl
Amplicon Barcode (AB01-24) 1 µl
Total 10 µl

Mix each reaction thoroughly by pipetting.

Incubate the reactions in a thermal cycler at 65°C for 10 minutes, then at 80°C for 2 minutes.

Pool the barcoded samples in a clean 1.5 ml Eppendorf DNA LoBind tube.

We expect ~10 µl per sample.

For 6 samples For 12 samples For 24 samples
Total volume 60 µl 120 µl 240 µl

Add the required volume of Thermolabile Proteinase K outlined below to the pooled samples and mix thoroughly by pipetting.

For 6 samples For 12 samples For 24 samples
Volume of Thermolabile Proteinase K 1.25 µl 2.5 µl 5 µl

Incubate at 37°C for 15 minutes and then at 55°C for 10 minutes.

Allow the reaction to cool at room temperature for approximately 2 minutes.

Resuspend the AMPure XP beads by vortexing.

Add a 0.7X volume of AMPure XP beads (AXP) to the pooled samples and mix by pipetting.

For 6 samples For 12 samples For 24 samples
Volume of AMPure XP beads (AXP) 42 µl 84 µl 168 µl

Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.

Prepare 1 ml of fresh 70% ethanol in nuclease-free water.

Spin down the sample and pellet on a magnet until the eluate is clear and colourless. Keep the tube on the magnetic rack, and pipette off the supernatant.

Keep the tube on the magnet and wash the beads with 400 µl of freshly prepared 70% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.

Repeat the previous step.

Spin down and place the tube back on the magnet. Pipette off any residual ethanol. Allow to dry for ~30 seconds, but do not dry the pellet to the point of cracking.

Remove the tube from the magnetic rack and resuspend the pellet in 15 µl Elution Buffer (EB). Incubate for 2 minutes at room temperature.

Pellet the beads on a magnet until the eluate is clear and colourless.

Remove and retain 15 µl of eluate containing the DNA library into a clean 1.5 ml Eppendorf DNA LoBind tube.

Dispose of the pelleted beads.

Transfer 11 µl of eluted DNA library into a clean 1.5 ml Eppendorf DNA LoBind tube.

Add 1 µl of Rapid Adapter T (RAP T) to the barcoded DNA.

Incubate the reaction for 10 minutes at room temperature.

The prepared library is used for loading into the flow cell. Store the library on ice or at 4°C until ready to load.

5. Priming and loading the SpotON flow cell

Material
  • Flush Buffer (FB)
  • Flush Tether (FLT)
  • Loading Beads II (LBII)
  • Sequencing Buffer II (SBII)
  • Loading Solution (LS)

Consumibles
  • Tubos Eppendorf DNA LoBind de 1,5 ml

Instrumental
  • MinION device
  • SpotON Flow Cell
  • Pipeta y puntas P1000
  • Pipeta y puntas P100
  • Pipeta y puntas P20

Priming and loading a MinION flow cell

We recommend all new users watch the 'Priming and loading your flow cell' video before your first run.

Using the Loading Solution

We recommend using the Loading Beads II (LBII) for loading your library onto the flow cell for most sequencing experiments. However, if you have previously used water to load your library, you must use Loading Solution (LS) instead of water. Note: some customers have noticed that viscous libraries can be loaded more easily when not using Loading Beads II.

Thaw the Sequencing Buffer II (SBII), Loading Beads II (LBII) or Loading Solution (LS, if using), Flush Tether (FLT) and one tube of Flush Buffer (FB) at room temperature before mixing the reagents by vortexing and spin down at room temperature.

To prepare the flow cell priming mix, add 30 µl of thawed and mixed Flush Tether (FLT) directly to the tube of thawed and mixed Flush Buffer (FB), and mix by vortexing at room temperature.

Open the MinION device lid and slide the flow cell under the clip.

Press down firmly on the flow cell to ensure correct thermal and electrical contact.

Flow Cell Loading Diagrams Step 1a

Flow Cell Loading Diagrams Step 1b

Complete a flow cell check to assess the number of pores available before loading the library.

This step can be omitted if the flow cell has been checked previously.

See the flow cell check instructions in the MinKNOW protocol for more information.

Slide the flow cell priming port cover clockwise to open the priming port.

Flow Cell Loading Diagrams Step 2

Take care when drawing back buffer from the flow cell. Do not remove more than 20-30 µl, and make sure that the array of pores are covered by buffer at all times. Introducing air bubbles into the array can irreversibly damage pores.

After opening the priming port, check for a small air bubble under the cover. Draw back a small volume to remove any bubbles:

  1. Set a P1000 pipette to 200 µl
  2. Insert the tip into the priming port
  3. Turn the wheel until the dial shows 220-230 µl, to draw back 20-30 µl, or until you can see a small volume of buffer entering the pipette tip

Note: Visually check that there is continuous buffer from the priming port across the sensor array.

Flow Cell Loading Diagrams Step 03 V5

Load 800 µl of the priming mix into the flow cell via the priming port, avoiding the introduction of air bubbles. Wait for five minutes. During this time, prepare the library for loading by following the steps below.

Flow Cell Loading Diagrams Step 04 V5

Thoroughly mix the contents of the Loading Beads II (LBII) by pipetting.

The Loading Beads II (LBII) tube contains a suspension of beads. These beads settle very quickly. It is vital that they are mixed immediately before use.

In a new tube, prepare the library for loading as follows:

Reagent Volume per flow cell
Sequencing Buffer II (SBII) 37.5 µl
Loading Beads II (LBII) mixed immediately before use, or Loading Solution (LS), if using 25.5 µl
DNA library 12 µl
Total 75 µl

Note: Load the library onto the flow cell immediately after adding the Sequencing Buffer II (SBII) and Loading Beads II (LBII).

Complete the flow cell priming:

  1. Gently lift the SpotON sample port cover to make the SpotON sample port accessible.
  2. Load 200 µl of the priming mix into the flow cell priming port (not the SpotON sample port), avoiding the introduction of air bubbles.

Flow Cell Loading Diagrams Step 5

Flow Cell Loading Diagrams Step 06 V5

Mix the prepared library gently by pipetting up and down just prior to loading.

Add 75 μl of the prepared library to the flow cell via the SpotON sample port in a dropwise fashion. Ensure each drop flows into the port before adding the next.

Flow Cell Loading Diagrams Step 07 V5

Gently replace the SpotON sample port cover, making sure the bung enters the SpotON port, close the priming port and replace the MinION device lid.

Flow Cell Loading Diagrams Step 8

Flow Cell Loading Diagrams Step 9

6. Data acquisition and basecalling

Overview of nanopore data analysis

For a full overview of nanopore data analysis, which includes options for basecalling and post-basecalling analysis, please refer to the Data Analysis document.

Sequencing and demultiplexing

The Amplicon Barcoding Kit 24 (SQK-AMB111.24) is not yet listed in MinKNOW. To start a sequencing run, select the SQK-LSK110 kit in the kit selection window. Live demultiplexing is not enabled for the Amplicon Barcoding Kit 24. Post-run demultiplexing using the standalone Guppy software is required - please see the next section of this protocol for details.

How to start sequencing

The sequencing device control, data acquisition and real-time basecalling are carried out by the MinKNOW software. Please ensure MinKNOW is installed on your computer or device. There are multiple options for how to carry out sequencing:

1. Data acquisition and basecalling in real-time using MinKNOW on a computer

Follow the instructions in the MinKNOW protocol beginning from the "Starting a sequencing run" section until the end of the "Completing a MinKNOW run" section.

2. Data acquisition and basecalling in real-time using the MinION Mk1B/Mk1D device

Follow the instructions in the MinION Mk1B user manual or the MinION Mk1D user manual.

3. Data acquisition and basecalling in real-time using the MinION Mk1C device

Follow the instructions in the MinION Mk1C user manual.

4. Data acquisition and basecalling in real-time using the GridION device

Follow the instructions in the GridION user manual.

5. Data acquisition and basecalling in real-time using the PromethION device

Follow the instructions in the PromethION user manual or the PromethION 2 Solo user manual.

6. Data acquisition using MinKNOW on a computer and basecalling at a later time using MinKNOW

Follow the instructions in the MinKNOW protocol beginning from the "Starting a sequencing run" section until the end of the "Completing a MinKNOW run" section. When setting your experiment parameters, set the Basecalling tab to OFF. After the sequencing experiment has completed, follow the instructions in the Post-run analysis section of the MinKNOW protocol.

7. Downstream analysis

Post-run demultiplexing of reads using the standalone Guppy software is required.

Download the demultiplexing configuration file to be used with Guppy.

Use this link to download the file.

Install the demultiplexing config:

  1. Copy the compressed file:

amb111-24_barcoding_configs.tar.gz into the location /opt/ont/guppy/data/barcoding/

  1. Run the following commands:

cd /opt/ont/guppy/data/barcoding/ sudo tar -xf amb111-24_barcoding_configs.tar.gz sudo mv amb111-24_barcoding_configs/topo_barcodes_masked.fasta ./ sudo mv amb111-24_barcoding_configs/barcode_arrs_amb111-24.toml ./barcoding_arrangements/

Demultiplex your data by running the following command:

guppy_barcoder -i [fastq input location] -s [desired output location] --barcode_kits SQK-AMB111-24 --detect_mid_strand_barcodes

Post-basecalling analysis

There are several options for further analysing your basecalled data:

1. EPI2ME workflows

For in-depth data analysis, Oxford Nanopore Technologies offers a range of bioinformatics tutorials and workflows available in EPI2ME. The platform provides a vehicle where workflows deposited in GitHub by our Research and Applications teams can be showcased with descriptive texts, functional bioinformatics code and example data.

2. Research analysis tools

Oxford Nanopore Technologies' Research division has created a number of analysis tools, which are available in the Oxford Nanopore GitHub repository. The tools are aimed at advanced users, and contain instructions for how to install and run the software. They are provided as-is, with minimal support.

3. Community-developed analysis tools

If a data analysis method for your research question is not provided in any of the resources above, please refer to the resource centre and search for bioinformatics tools for your application. Numerous members of the Nanopore Community have developed their own tools and pipelines for analysing nanopore sequencing data, most of which are available on GitHub. Please be aware that these tools are not supported by Oxford Nanopore Technologies, and are not guaranteed to be compatible with the latest chemistry/software configuration.

8. Flow cell reuse and returns

Material
  • Flow Cell Wash Kit (EXP-WSH004)

After your sequencing experiment is complete, if you would like to reuse the flow cell, please follow the Flow Cell Wash Kit protocol and store the washed flow cell at +2°C to +8°C.

The Flow Cell Wash Kit protocol is available on the Nanopore Community.

We recommend you to wash the flow cell as soon as possible after you stop the run. However, if this is not possible, leave the flow cell on the device and wash it the next day.

Alternatively, follow the returns procedure to send the flow cell back to Oxford Nanopore.

Instructions for returning flow cells can be found here.

If you encounter issues or have questions about your sequencing experiment, please refer to the Troubleshooting Guide that can be found in the online version of this protocol.

9. Issues during DNA/RNA extraction and library preparation

Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

We also have an FAQ section available on the Nanopore Community Support section.

If you have questions or encounter isuues specific to the Amplicon Barcoding Kit, please post on the dedicated private Community channel.

Low sample quality

Observation Possible cause Comments and actions
Low DNA purity (Nanodrop reading for DNA OD 260/280 is <1.8 and OD 260/230 is <2.0–2.2) The DNA extraction method does not provide the required purity The effects of contaminants are shown in the Contaminants document. Please try an alternative extraction method that does not result in contaminant carryover.

Consider performing an additional SPRI clean-up step.
Low RNA integrity (RNA integrity number <9.5 RIN, or the rRNA band is shown as a smear on the gel) The RNA degraded during extraction Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page.
RNA has a shorter than expected fragment length The RNA degraded during extraction Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page.

We recommend working in an RNase-free environment, and to keep your lab equipment RNase-free when working with RNA.

Low DNA recovery after AMPure bead clean-up

Observation Possible cause Comments and actions
Low recovery DNA loss due to a lower than intended AMPure beads-to-sample ratio 1. AMPure beads settle quickly, so ensure they are well resuspended before adding them to the sample.

2. When the AMPure beads-to-sample ratio is lower than 0.4:1, DNA fragments of any size will be lost during the clean-up.
Low recovery DNA fragments are shorter than expected The lower the AMPure beads-to-sample ratio, the more stringent the selection against short fragments. Please always determine the input DNA length on an agarose gel (or other gel electrophoresis methods) and then calculate the appropriate amount of AMPure beads to use. SPRI cleanup
Low recovery after end-prep The wash step used ethanol <70% DNA will be eluted from the beads when using ethanol <70%. Make sure to use the correct percentage.

The VolTRAX run terminated in the middle of the library prep

Observation Possible cause Comments and actions
The green light was switched off

or

An adapter was used to connect the VolTRAX USB-C cable to the computer
Insufficient power supply to the VolTRAX The green LED signals that 3 A are being supplied to the device. This is the requirement for the full capabilities of the VolTRAX V2 device. Please use computers that meet the requirements listed on the VolTRAX V2 protocol.

The VolTRAX software shows an inaccurate amount of reagents loaded

Observation Possible cause Comments and actions
The VolTRAX software shows an inaccurate amount of reagents loaded Pipette tips do not fit the VolTRAX cartridge ports Rainin 20 μl or 30 μl and Gilson 10 μl, 20 μl or 30 μl pipette tips are compatible with loading reagents into the VolTRAX cartridge. Rainin 20 μl is the most suitable.
The VolTRAX software shows an inaccurate amount of reagents loaded The angle at which reagents are pipetted into the cartridge is incorrect The pipetting angle should be slightly greater than the cartridge inlet angle. Please watch the demo video included in the VolTRAX software before loading.

10. Issues during the sequencing run

Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

We also have an FAQ section available on the Nanopore Community Support section.

If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

Fewer pores at the start of sequencing than after Flow Cell Check

Observation Possible cause Comments and actions
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check An air bubble was introduced into the nanopore array After the Flow Cell Check it is essential to remove any air bubbles near the priming port before priming the flow cell. If not removed, the air bubble can travel to the nanopore array and irreversibly damage the nanopores that have been exposed to air. The best practice to prevent this from happening is demonstrated in this video.
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check The flow cell is not correctly inserted into the device Stop the sequencing run, remove the flow cell from the sequencing device and insert it again, checking that the flow cell is firmly seated in the device and that it has reached the target temperature. If applicable, try a different position on the device (GridION/PromethION).
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check Contaminations in the library damaged or blocked the pores The pore count during the Flow Cell Check is performed using the QC DNA molecules present in the flow cell storage buffer. At the start of sequencing, the library itself is used to estimate the number of active pores. Because of this, variability of about 10% in the number of pores is expected. A significantly lower pore count reported at the start of sequencing can be due to contaminants in the library that have damaged the membranes or blocked the pores. Alternative DNA/RNA extraction or purification methods may be needed to improve the purity of the input material. The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

MinKNOW script failed

Observation Possible cause Comments and actions
MinKNOW shows "Script failed"
Restart the computer and then restart MinKNOW. If the issue persists, please collect the MinKNOW log files and contact Technical Support. If you do not have another sequencing device available, we recommend storing the flow cell and the loaded library at 4°C and contact Technical Support for further storage guidance.

Pore occupancy below 40%

Observation Possible cause Comments and actions
Pore occupancy <40% Not enough library was loaded on the flow cell Ensure the correct volume and concentration as stated on the appropriate protocol for your sequencing library is loaded onto the flow cell. Please quantify the library before loading and calculate fmols using tools like the Promega Biomath Calculator, choosing "dsDNA: µg to fmol"
Pore occupancy close to 0 The Ligation Sequencing Kit was used, and sequencing adapters did not ligate to the DNA Make sure to use the NEBNext Quick Ligation Module (E6056) and Oxford Nanopore Technologies Ligation Buffer (LNB, provided in the sequencing kit) at the sequencing adapter ligation step, and use the correct amount of each reagent. A Lambda control library can be prepared to test the integrity of the third-party reagents.
Pore occupancy close to 0 The Ligation Sequencing Kit was used, and ethanol was used instead of LFB or SFB at the wash step after sequencing adapter ligation Ethanol can denature the motor protein on the sequencing adapters. Make sure the LFB or SFB buffer was used after ligation of sequencing adapters.
Pore occupancy close to 0 No tether on the flow cell Tethers are adding during flow cell priming (FLT tube for Kit 9, 10, 11, FCT for Kit 14, and FTU for ultra-long DNA kits). Make sure FLT/FCT/FTU was added to the buffer (FB for Kit 9, 10, 11, and FCF for Kit 14) before priming.

Shorter than expected read length

Observation Possible cause Comments and actions
Shorter than expected read length Unwanted fragmentation of DNA sample Read length reflects input DNA fragment length. Input DNA can be fragmented during extraction and library prep.

1. Please review the Extraction Methods in the Nanopore Community for best practice for extraction.

2. Visualise the input DNA fragment length distribution on an agarose gel before proceeding to the library prep. DNA gel2 In the image above, Sample 1 is of high molecular weight, whereas Sample 2 has been fragmented.

3. During library prep, avoid pipetting and vortexing when mixing reagents. Flicking or inverting the tube is sufficient.

Large proportion of unavailable pores

Observation Possible cause Comments and actions
Large proportion of unavailable pores (shown as blue in the channels panel and pore activity plot)

image2022-3-25 10-43-25 The pore activity plot above shows an increasing proportion of "unavailable" pores over time.
Contaminants are present in the sample Some contaminants can be cleared from the pores by the unblocking function built into MinKNOW. If this is successful, the pore status will change to "sequencing pore". If the portion of unavailable pores stays large or increases:

1. A nuclease flush using the Flow Cell Wash Kit (EXP-WSH004) can be performed, or
2. Run several cycles of PCR to try and dilute any contaminants that may be causing problems.

Large proportion of inactive pores

Observation Possible cause Comments and actions
Large proportion of inactive/unavailable pores (shown as light blue in the channels panel and pore activity plot. Pores or membranes are irreversibly damaged) Air bubbles have been introduced into the flow cell Air bubbles introduced through flow cell priming and library loading can irreversibly damage the pores. Watch the Priming and loading your flow cell video for best practice
Large proportion of inactive/unavailable pores Certain compounds co-purified with DNA Known compounds, include polysaccharides, typically associate with plant genomic DNA.

1. Please refer to the Plant leaf DNA extraction method.
2. Clean-up using the QIAGEN PowerClean Pro kit.
3. Perform a whole genome amplification with the original gDNA sample using the QIAGEN REPLI-g kit.
Large proportion of inactive/unavailable pores Contaminants are present in the sample The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

Temperature fluctuation

Observation Possible cause Comments and actions
Temperature fluctuation The flow cell has lost contact with the device Check that there is a heat pad covering the metal plate on the back of the flow cell. Re-insert the flow cell and press it down to make sure the connector pins are firmly in contact with the device. If the problem persists, please contact Technical Services.

Failed to reach target temperature

Observation Possible cause Comments and actions
MinKNOW shows "Failed to reach target temperature" The instrument was placed in a location that is colder than normal room temperature, or a location with poor ventilation (which leads to the flow cells overheating) MinKNOW has a default timeframe for the flow cell to reach the target temperature. Once the timeframe is exceeded, an error message will appear and the sequencing experiment will continue. However, sequencing at an incorrect temperature may lead to a decrease in throughput and lower q-scores. Please adjust the location of the sequencing device to ensure that it is placed at room temperature with good ventilation, then re-start the process in MinKNOW. Please refer to this link for more information on MinION temperature control.

Last updated: 9/8/2022

Document options

MinION
Language: