To enable support for the rapidly expanding user requests, the team at Oxford Nanopore Technologies have put together an updated workflow based on the ARTIC Network protocols and analysis methods. The protocol uses Oxford Nanopore Technologies' Rapid Barcoding Kit 96 (SQK-RBK110.96) and Midnight RT PCR Expansion (EXP-MRT001) for barcoding and library preparation.

We have developed this automated protocol on the Agilent Bravo liquid handling robot. The majority of the process is automated with minimal hands-on time which is required for sample quantification and deck re-loading.

While this protocol is available in the Nanopore Community, we kindly ask users to ensure they are citing the members of the ARTIC network who have been behind the development of these methods.

This protocol is similar to the ARTIC amplicon sequencing protocol for MinION for SARS-CoV-2 v3 (LoCost) by Josh Quick and the method used in Freed et al., 2020. The protocol generates amplicons in a tiled fashion across the whole SARS-CoV-2 genome.

To generate tiled PCR amplicons from the SARS-CoV-2 viral cDNA for use with the Rapid Barcoding Kit 96 (SQK-RBK110.96), primers were designed by Freed et al., 2020 using Primal Scheme. These primers are in the Midnight RT PCR Expansion (EXP-MRT001) and are designed to generate 1.2 kb amplicons. Primer sequences can be found here.

Steps in the sequencing workflow:

Prepare for your experiment

you will need to:

Before starting - Manual steps:

• Extract your RNA
• Ensure you have your sequencing kit, the correct equipment and reagents
• Prepare your reagents, samples and labware to load on the Agilent Bravo
• Download the software for acquiring and analysing your data
• Check your flow cell to ensure it has enough pores for a good sequencing run

### Prepare your library You will need to:

Automated steps:

• Reverse transcribe your RNA samples with random hexamers
• Amplify the samples by tiled PCR using separate primer pools
• Combine the primer pools
• Attach Rapid Barcodes supplied in the kit to the DNA ends, pool the samples and SPRI purify

__Manual steps:__

• Quantify your DNA library as a quality control
• Prime the flow cell and load your DNA library into the flow cell

Overview of library preparation workflow:

The image below is representative of the steps that take place in the automated runs for X96 samples.

Note: Timings are dependent on number of samples and include hands on time, such as deck loading and sample quantification

Sequencing and analysis

You will need to:

• Start a sequencing run using the MinKNOW software, selecting SQK-RBK110.96 and EXP-MRT001 in kit selection, which will collect raw data from the device and convert it into basecalled reads

Note: Timings are approximate and subject to change with updates.

Process	X24 samples	X48 samples	X96 samples	Hands-on time
Deck set-up				~30 minutes
Process 1: cDNA synthesis	8 minutes	16 minutes	24 minutes
Off-Deck thermocyler	17 minutes	17 minutes	17 minutes
Process 2: cDNA amplification	10 minutes	16 minutes	21 minutes
Off-Deck thermocyler	~3 hours 30 minutes	~3 hours 30 minutes	~3 hours 30 minutes
Process 3: Rapid Barcoding	5 minutes	8 minutes	10 minutes
Off-Deck thermocyler	8 minutes	8 minutes	8 minutes
Process 4: cDNA amplicon pooling/cleanup	40 minutes	50 minutes	60 minutes
Quantification				~10 minutes
Total	4 hours 58 minutes	5 hours 25 minutes	5 hours 50 minutes	~40 minutes

Throughout this document, 'Protocol' is defined as the assay on the whole and 'Run' refers to the individual scripts for the automated liquid handling robot, which are specific to indicated protocol step(s).

This protocol outlines how to carry out PCR tiling of SARS-CoV-2 viral RNA samples on a 96-well plate using the Rapid Barcoding Kit 96 (SQK-RBK110.96) with the Midnight RT PCR Expansion (EXP-MRT001) using the Agilent Bravo liquid handling robot.

When processing multiple samples at once, we recommend making master mixes following the indicated volumes to account for the necessary excess. We also recommend using a template-free pre-PCR hood for making up the master mixes, and a separate template pre-PCR hood for handling the samples. It is important to clean and/or UV irradiate these hoods between sample batches. Furthermore, to track and monitor cross-contamination events, it is important to run a negative control reaction at the reverse transcription stage using nuclease-free water instead of sample, and carrying this control through the rest of the prep.

All post-PCR procedures should be carried out in a separate area to the pre-PCR preparation, with dedicated equipment for liquid handling in each area to minimise risk of contamination.

If only one liquid handling robot is available, both pre-PCR and post-PCR sections of the assay can be performed in the same robot. In this scenario, cleaning the equipment thoroughly between runs is required and we recommend validating the process for your unique set-up.

Name	Acronym	Cap colour	No. of vials	Fill volume per vial (µl)
Rapid Barcode plate	RB96	-	3 plates	8 µl per well
AMPure XP Beads	AXP	Brown	3	1,200
Sequencing Buffer II	SBII	Red	1	500
Rapid Adapter F	RAP-F	Green	1	25
Elution Buffer	EB	Black	1	500
Loading Beads II	LBII	Pink	1	360
Loading Solution	LS	White cap, pink label	1	400
Flush Tether	FLT	Purple	1	400
Flush Buffer	FB	White	1 bottle	15,500

This product contains AMPure XP reagent manufactured by Beckman Coulter, Inc.

Name	Acronym	Cap colour	Number of vials	Fill volume per vial (µl)
LunaScript RT SuperMix	LS RT	Blue	3	500
Q5 HS Master Mix	Q5	Orange	6	1,500
Midnight Primer Pool A	MP A	White	3	15
Midnight Primer Pool B	MP B	Clear	3	15

As mutations in SARS-CoV-2 variants emerge amplicon drop out may be observed; for users wishing to design their own primer spike-ins to address this we suggest adding to the appropriate primer pool at a final concentration between 3.33 µM and 6.66 µM.

Below are the sequences for the V3 primer scheme used in the Midnight RT PCR Expansion.

Pool A

Primer name	Primer Sequence
SARSCoV_1200_1_LEFT	ACCAACCAACTTTCGATCTCTTGT
SARSCoV_1200_1_RIGHT	GGTTGCATTCATTTGGTGACGC
SARSCoV_1200_3_LEFT	GGCTTGAAGAGAAGTTTAAGGAAGGT
SARSCoV_1200_3_RIGHT	GATTGTCCTCACTGCCGTCTTG
SARSCoV_1200_5_LEFT	ACCTACTAAAAAGGCTGGTGGC
SARSCoV_1200_5_RIGHT	AGCATCTTGTAGAGCAGGTGGA
SARSCoV_1200_7_LEFT	ACCTGGTGTATACGTTGTCTTTGG
SARSCoV_1200_7_RIGHT	GCTGAAATCGGGGCCATTTGTA
SARSCoV_1200_9_LEFT	AGAAGTTACTGGCGATAGTTGTAATAACT
SARSCoV_1200_9_RIGHT	TGCTGATATGTCCAAAGCACCA
SARSCoV_1200_11_LEFT	AGACACCTAAGTATAAGTTTGTTCGCA
SARSCoV_1200_11_RIGHT	GCCCACATGGAAATGGCTTGAT
SARSCoV_1200_13_LEFT	ACCTCTTACAACAGCAGCCAAAC
SARSCoV_1200_13_RIGHT	CGTCCTTTTCTTGGAAGCGACA
SARSCoV_1200_15_LEFT	TTTTAAGGAATTACTTGTGTATGCTGCT
SARSCoV_1200_15_RIGHT	ACACACAACAGCATCGTCAGAG
SARSCoV_1200_17_LEFT	TCAAGCTTTTTGCAGCAGAAACG
SARSCoV_1200_17_RIGHT	CCAAGCAGGGTTACGTGTAAGG
SARSCoV_1200_19_LEFT	GGCACATGGCTTTGAGTTGACA
SARSCoV_1200_19_RIGHT	CCTGTTGTCCATCAAAGTGTCCC
SARSCoV_1200_21_LEFT	TCTGTAGTTTCTAAGGTTGTCAAAGTGA
SARSCoV_1200_21_RIGHT	GCAGGGGGTAATTGAGTTCTGG
21_right_spike	GTGTATGATTGAGTTCTGGTTGTAAG
SARSCoV_1200_23_LEFT	ACTTTAGAGTCCAACCAACAGAATCT
23_left_spike	ACTTTAGAGTTCAACCAACAGAATCT
SARSCoV_1200_23_RIGHT	TGACTAGCTACACTACGTGCCC
SARSCoV_1200_25_LEFT	TGCTGCTACTAAAATGTCAGAGTGT
SARSCoV_1200_25_RIGHT	CATTTCCAGCAAAGCCAAAGCC
SARSCoV_1200_27_LEFT	TGGATCACCGGTGGAATTGCTA
SARSCoV_1200_27_RIGHT	TGTTCGTTTAGGCGTGACAAGT
SARSCoV_1200_29_LEFT	TGAGGGAGCCTTGAATACACCA
SARSCoV_1200_29_RIGHT	TAGGCAGCTCTCCCTAGCATTG

Pool B

Primer name	Primer sequences
SARSCoV_1200_2_LEFT	CCATAATCAAGACTATTCAACCAAGGGT
SARSCoV_1200_2_RIGHT	ACAGGTGACAATTTGTCCACCG
SARSCoV_1200_4_LEFT	GGAATTTGGTGCCACTTCTGCT
SARSCoV_1200_4_RIGHT	CCTGACCCGGGTAAGTGGTTAT
SARSCoV_1200_6_LEFT	ACTTCTATTAAATGGGCAGATAACAACTG
SARSCoV_1200_6_RIGHT	GATTATCCATTCCCTGCGCGTC
SARSCoV_1200_8_LEFT	CAATCATGCAATTGTTTTTCAGCTATTTTG
SARSCoV_1200_8_RIGHT	TGACTTTTTGCTACCTGCGCAT
SARSCoV_1200_10_LEFT	TTTACCAGGAGTTTTCTGTGGTGT
SARSCoV_1200_10_RIGHT	TGGGCCTCATAGCACATTGGTA
SARSCoV_1200_12_LEFT	ATGGTGCTAGGAGAGTGTGGAC
SARSCoV_1200_12_RIGHT	GGATTTCCCACAATGCTGATGC
SARSCoV_1200_14_LEFT	ACAGGCACTAGTACTGATGTCGT
SARSCoV_1200_14_RIGHT	GTGCAGCTACTGAAAAGCACGT
SARSCoV_1200_16_LEFT	ACAACACAGACTTTATGAGTGTCTCT
SARSCoV_1200_16_RIGHT	CTCTGTCAGACAGCACTTCACG
SARSCoV_1200_18_LEFT	GCACATAAAGACAAATCAGCTCAATGC
SARSCoV_1200_18_RIGHT	TGTCTGAAGCAGTGGAAAAGCA
SARSCoV_1200_20_LEFT	ACAATTTGATACTTATAACCTCTGGAACAC
SARSCoV_1200_20_RIGHT	GATTAGGCATAGCAACACCCGG
SARSCoV_1200_22_LEFT	GTGATGTTCTTGTTAACAACTAAACGAACA
SARSCoV_1200_22_RIGHT	AACAGATGCAAATCTGGTGGCG
22_right_spike	AACAGATGCAAATTTGGTGGCG
SARSCoV_1200_24_LEFT	GCTGAACATGTCAACAACTCATATGA
24_left_spike	GCTGAATATGTCAACAACTCATATGA
SARSCoV_1200_24_RIGHT	ATGAGGTGCTGACTGAGGGAAG
SARSCoV_1200_26_LEFT	GCCTTGAAGCCCCTTTTCTCTA
SARSCoV_1200_26_RIGHT	AATGACCACATGGAACGCGTAC
SARSCoV_1200_28_LEFT	TTTGTGCTTTTTAGCCTTTCTGCT
SARSCoV_1200_28_RIGHT	GTTTGGCCTTGTTGTTGTTGGC
SARSCoV_1200_28_LEFT_27837T	TTTGTGCTTTTTAGCCTTTCTGTT

Sequencing on a MinION Mk1B requires a high-spec computer or laptop to keep up with the rate of data acquisition. Read more in the MinION Mk1B IT Requirements document.

The MinION Mk1C contains fully-integrated compute and screen, removing the need for any accessories to generate and analyse nanopore data. Read more in the MinION Mk1C IT requirements document.

MinKNOW

The MinKNOW software controls the nanopore sequencing device, collects sequencing data and basecalls in real time. You will be using MinKNOW for every sequencing experiment to sequence, basecall and demultiplex if your samples were barcoded.

For instructions on how to run the MinKNOW software, please refer to the MinKNOW protocol.

EPI2ME (optional)

The EPI2ME cloud-based platform performs further analysis of basecalled data, for example alignment to the Lambda genome, barcoding, or taxonomic classification. You will use the EPI2ME platform only if you would like further analysis of your data post-basecalling.

For instructions on how to create an EPI2ME account and install the EPI2ME Desktop Agent, please refer to the EPI2ME Platform protocol.

We highly recommend that you check the number of pores in your flow cell prior to starting a sequencing experiment. This should be done within 12 weeks of purchasing for MinION/GridION/PromethION or within four weeks of purchasing Flongle Flow Cells. Oxford Nanopore Technologies will replace any flow cell with fewer than the number of pores in the table below, when the result is reported within two days of performing the flow cell check, and when the storage recommendations have been followed. To do the flow cell check, please follow the instructions in the Flow Cell Check document.

Flow cell	Minimum number of active pores covered by warranty
Flongle Flow Cell	50
MinION/GridION Flow Cell	800
PromethION Flow Cell	5000

We recommend using the Loading Beads II (LBII) for loading your library onto the flow cell for most sequencing experiments. However, if you have previously used water to load your library, you must use Loading Solution (LS) instead of water. Note: some customers have noticed that viscous libraries can be loaded more easily when not using Loading Beads II.

For a full overview of nanopore data analysis, which includes options for basecalling and post-basecalling analysis, please refer to the Data Analysis document.

The sequencing device control, data acquisition and real-time basecalling are carried out by the MinKNOW software. Please ensure MinKNOW is installed on your computer or device. There are multiple options for how to carry out sequencing:

1. Data acquisition and basecalling in real-time using MinKNOW on a computer

Follow the instructions in the MinKNOW protocol beginning from the "Starting a sequencing run" section until the end of the "Completing a MinKNOW run" section.

2. Data acquisition and basecalling in real-time using the GridION device

Follow the instructions in the GridION user manual.

3. Data acquisition and basecalling in real-time using the MinION Mk1C device

Follow the instructions in the MinION Mk1C user manual.

4. Data acquisition and basecalling in real-time using the PromethION device

Follow the instructions in the PromethION user manual or the PromethION 2 Solo user manual.

5. Data acquisition using MinKNOW on a computer and basecalling at a later time using MinKNOW

Follow the instructions in the MinKNOW protocol beginning from the "Starting a sequencing run" section until the end of the "Completing a MinKNOW run" section. When setting your experiment parameters, set the Basecalling tab to OFF. After the sequencing experiment has completed, follow the instructions in the Post-run analysis section of the MinKNOW protocol.

The wf-artic is a bioinformatics workflow for the analysis of ARTIC sequencing data prepared using the Midnight protocol. The bioinformatics workflow is orchestrated by the Nextflow software. Nextflow is a publicly available and open-source project that enables the execution of scientific workflows in a scalable and reproducible way. The software is natively supported on the GridION device and can be simply installed on most Linux computers and servers. The installation is outlined later in the document.

The Midnight analysis uses the ARTIC bioinformatics workflow.

Demultiplexed sequence reads are processed using the ARTIC FieldBioinformatics software that has been subtly modified for the analysis of FASTQ sequences prepared using Oxford Nanopore rapid sequencing kits. The other modification to the ARTIC workflow is the use of a primer scheme that defines the sequencing primers used by the Midnight protocol and their genomic locations on the SARS-CoV-2 genome.

The wf-artic workflow includes other analytical steps that include cladistic analysis using Nextclade and strain assignment using Pangolin. The data facets included in the report are parameterised and additional information such as plots of depth-of-coverage across the reference genome is optional.

The complete source for wf-artic is linked and the Nextflow software will download the scripts and logic flow from this location.

On GridION devices, the wf-artic workflow will start automatically after sequencing. However, on other devices, this will have to be started manually as outlined further on this page under 'Running a Midnight analysis'.

The wf-artic workflow requires the Nextflow and Docker software to have been installed. The EPI2ME quickstart guide provides instructions for the installation of these requirements for GridION, PromethION and general Ubuntu Linux users and provides a little more introduction to the Nextflow software.

Automatic start on GridION:

To set up the Midnight analysis to start automatically after sequencing on GridION, select the Rapid Barcoding Kit 96 (SQK-RBK110.96) kit with the Midnight RT PCR Expansion (EXP-MRT001) pack on MinKNOW when setting up a sequencing run.

When the workflow has finished, the relevant analysis files will be available in the following output folder:

processing/artic/artic_DATE_TIME_67195e17

Post-run analysis on GridION:

The Midnight analysis can also be started post-run on GridION:

1. On the start page, click 'Analysis'
2. Click 'Workflow'
3. From the dropdown menu, select 'post_processing/artic/artic'
4. Select your input folder with the sequencing data and the location for the output folder

Using Linux command line:

The wf-artic workflow can be run from the Linux command line. The workflow can be installed or updated with the command:

$ nextflow pull epi2me-labs/wf-artic

The wf-artic requires FASTQ format sequence data that has already been demultiplexed. Sequences can either be demultiplexed directly in the MinKNOW software or as a post-sequencing step by the guppy_barcoder software provided by the Guppy software.

The Midnight protocol uses a rapid barcoding kit; it is therefore important to note that the demultiplexing step must not require barcodes at both ends of the sequence.

The expected input for wf-artic is a folder of folders as shown below. Each of the barcode folders should contain the FASTQ sequence data and files may either be uncompressed or gzipped.

$ tree -d MidnightFastq/

MidnightFastq/

├── barcode01

├── barcode02

├── barcode03

├── barcode04

├── barcode05

├── barcode06

└── unclassified

The reference command for running a Midnight analysis is as follows. The parameters are explained further on in the document.

nextflow run epi2me-labs/wf-artic \

--scheme_name SARS-CoV-2 \

--scheme_version V1200 \

--min_len 200 \

--max_len 1100 \

--out_dir PATH_TO_OUTPUT \

--fastq PATH_TO_FASTQ_PASS \

-work-dir PATH_TO_INTERMEDIATE_FILES

Type the command into you linux terminal and press enter.

Nextflow will describe the analysis as it progresses; the figure above shows an example run from a 48-plex analysis. We can see which processes have completed and the processes that are still running and or queued.

• nextflow run epi2me-labs/wf-artic An instruction to use the Nextflow software to run a workflow, which is further explained here.

• --scheme_name SARS-CoV-2 An instruction for the ARTIC software to use the primer scheme that corresponds to the amplicons tiled across the whole SARS-CoV-2 genome.

• --scheme_version V1200 This defines the version of the ARTIC primers to use. The Midnight protocol uses the primer set refered to as V1200.

• –-min_len 200 This sets the minimum allowed sequence length as 200 nucleotides.

• –-max_len 1100 This sets the maximum allowed sequence length as 1100 nucleotides.

• --out_dir PATH_TO_OUTPUT This instructs the Nextflow software where the results should be stored; please change PATH_TO_OUTPUT to the location on your computer where files should be stored.

• --fastq PATH_TO_FASTQ_PASS This instructs Nextflow which sequences should be used in the analysis. Please change PATH_TO_FASTQ_PASS to an existing fastq_pass folder from a Midnight run.

• -work_dir PATH TO WORK DIRECTORY Please note the single hyphen; this is a Nextflow parameter. This defines where the intermediate files are stored. This folder may contain a significant amount of information; please see the section on housekeeping.

Other command line parameters

Other commands and options can be provided to the Nextflow command:

• --samples This describes a sample file that links barcode identifier with sample names. These sample names will be reported in the HTML format report and in the CSV file of genotypes. The sample file should be a comma-delimited file and must contain the column names barcode and sample_name.

• --help This will display the help-file which describes the available parameters and other information on default values and their meanings.

• --medaka_model This defines the model that should be used by the Medaka software for variant calling (and thus consensus preparation).

Results will be written to the location specified by the --out_dir parameter. These output results include:

• all_consensus.fasta A multi-FASTA format sequence file containing the consensus sequence for each of the samples investigated. This consensus sequence has been prepared for the whole SARS-CoV-2 genome, not just the spike protein region. The consensus sequence masks the non-spike regions and regions of low sequence coverage with N residues.

• all_variants.vcf.gz A gzipped VCF file that describes all high-quality genetic variants called by medaka from the sequenced samples.

• all_variants.vcf.gz.tbi An index file for the gzipped VCF file.

• consensus_status.txt A tab delimited file that reports whether a consensus sequence has been successfully prepared for a sample, or not.

• wf-artic-report.html A report summarising these data. This HTML format report also includes the output of the Nextclade software that can be used for a visual inspection of, for example, primer drop out or other qualitative consensus sequence aspects.

Other files are included in the work-directory. This includes per sample VCF files of all genetic variants prior to filtering and other sequences.

The nextflow parameter, -work-dir, was introduced as a parameter to define where the workflow intermediate files are stored. This folder will accumulate a significant number of files that correspond to raw BAM files and other larger intermediates. We recommend this folder to be routinely cleared.

Updated versions of the wf-artic software may be released and an alert to the availability of newer workflow versions will be noted by the Nextflow software at run-time.

To update the software:

nextflow pull epi2me-labs/wf-artic

It may be necessary to first delete the cached workflow files. This can be achieved with the command:

nextflow drop -f epi2me-labs/wf-artic

We also have an FAQ section available on the Nanopore Community Support section.

If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

We also have an FAQ section available on the Nanopore Community Support section.

If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.