PCR tiling of SARS-CoV-2 virus - Rapid Barcoding Kit 96 V14 and Midnight RT PCR Expansion (SQK-RBK114.96 and EXP-MRT001)
- Home
- Documentation
- PCR tiling of SARS-CoV-2 virus - Rapid Barcoding Kit 96 V14 and Midnight RT PCR Expansion (SQK-RBK114.96 and EXP-MRT001)
MinION: Protocol
PCR tiling of SARS-CoV-2 virus - Rapid Barcoding Kit 96 V14 and Midnight RT PCR Expansion (SQK-RBK114.96 and EXP-MRT001) V MRT_9186_v114_revH_13Dec2024
- This protocol uses extracted RNA samples
- Includes reverse transcription and tiled PCR amplification
- For multiplexing 1-96 samples
- Library preparation time ~315 minutes
- Fragmentation
- Compatible with R10.4.1 flow cells
For Research Use Only
This is an Early Access product For more information about our Early Access programmes, please see this article on product release phases.
FOR RESEARCH USE ONLY
Contents
Introduction to the protocol
Library preparation
- 4. Reverse transcription
- 5. PCR
- 6. Addition of rapid barcodes
- 7. Pooling samples and clean-up
- 8. Priming and loading the SpotON flow cell
Sequencing and data analysis
- 9. Data acquisition and basecalling
- 10. Downstream analysis
- 11. Reutilización y devolución de celdas de flujo
Troubleshooting
Descripción general
- This protocol uses extracted RNA samples
- Includes reverse transcription and tiled PCR amplification
- For multiplexing 1-96 samples
- Library preparation time ~315 minutes
- Fragmentation
- Compatible with R10.4.1 flow cells
For Research Use Only
This is an Early Access product For more information about our Early Access programmes, please see this article on product release phases.
1. Overview of the protocol
IMPORTANTE
This protocol is a work in progress and some details are expected to change over time. Please make sure you always use the most recent version of the protocol.
The PCR tiling of SARS-CoV-2 virus with Rapid Barcoding Kit 96 V14 and Midnight RT PCR Expansion (SQK-RBK114.96 and EXP-MRT001) protocol is an updated version of the PCR tiling of SARS-CoV-2 virus with rapid barcoding and Midnight RT PCR Expansion (SQK-RBK110.96 and EXP-MRT001) using our most recent Kit 14 chemistry and an updated downstream analysis.
Introduction to the protocol
To enable support for the rapidly expanding user requests, the team at Oxford Nanopore Technologies have put together an updated workflow based on the ARTIC Network protocols and analysis methods. The protocol uses Oxford Nanopore Technologies' Rapid Barcoding Kit 96 V14 (SQK-RBK114.96) and Midnight RT PCR Expansion (EXP-MRT001) for barcoding and library preparation.
While this protocol is available in the Nanopore Community, we kindly ask users to ensure they are citing the members of the ARTIC network who have been behind the development of these methods.
This protocol is similar to the ARTIC amplicon sequencing protocol for MinION for SARS-CoV-2 v3 (LoCost) by Josh Quick and the method used in Freed et al., 2020. The protocol generates amplicons in a tiled fashion across the whole SARS-CoV-2 genome.
To generate tiled PCR amplicons from the SARS-CoV-2 viral cDNA for use with the Rapid Barcoding Kit 96 V14 (SQK-RBK114.96), primers were designed by Freed et al., 2020 using Primal Scheme. These primers are in the Midnight RT PCR Expansion (EXP-MRT001) and are designed to generate 1.2 kb amplicons. Primer sequences can be found here.
As mutations in SARS-CoV-2 variants emerge amplicon drop out may be observed; for users wishing to design their own primer spike-ins to address this we suggest adding to the appropriate primer pool at a final concentration between 3.33 µM and 6.66 µM.
Steps in the sequencing workflow:
Prepare for your experiment you will need to:
- Extract your RNA
- Ensure you have your sequencing kit, the correct equipment and reagents
- Download the software for acquiring and analysing your data
- Check your flow cell to ensure it has enough pores for a good sequencing run
Prepare your library You will need to:
- Reverse transcribe your RNA samples with random hexamers
- Amplify the samples by tiled PCR using separate primer pools
- Combine the primer pools
- Attach Rapid Barcodes supplied in the kit to the DNA ends, pool the samples and SPRI purify
- Prime the flow cell and load your DNA library into the flow cell
Sequencing and analysis You will need to:
- Start a sequencing run using the MinKNOW software, selecting SQK-RBK114.96 in kit selection, which will collect raw data from the device and convert it into basecalled reads
- (Optional): Perform downstream analysis of the data using the wf-artic analysis workflow integrated within the EPI2ME Labs application
Before starting
This protocol outlines how to carry out PCR tiling of SARS-CoV-2 viral RNA samples on a 96-well plate using the Rapid Barcoding Kit 96 V14 (SQK-RBK114.96) with the Midnight RT PCR Expansion (EXP-MRT001).
It is required to use total RNA extracted from samples that have been screened by a suitable qPCR assay.
When processing multiple samples at once, we recommend making master mixes with an additional 10% of the volume. We also recommend using a template-free pre-PCR hood for making up the master mixes, and a separate template pre-PCR hood for handling the samples. It is important to clean and/or UV irradiate these hoods between sample batches. Furthermore, to track and monitor cross-contamination events, it is important to run a negative control reaction at the reverse transcription stage using nuclease-free water instead of sample, and carrying this control through the rest of the prep.
All post-PCR procedures must be carried out in a separate area to the pre-PCR preparation, with dedicated equipment for liquid handling in each area.
IMPORTANTE
Compatibility of this protocol
This protocol should only be used in combination with:
- Rapid Barcoding Kit 96 V14 (SQK-RBK114.96)
- Midnight RT PCR Expansion (EXP-MRT001)
- R10.4.1 flow cells (FLO-MIN114)
- Flow Cell Wash Kit (EXP-WSH004)
2. Equipment and consumables
Material
- Input RNA in 10 mM Tris-HCl, pH 8.0
- Rapid Barcoding Kit 96 V14 (SQK-RBK114.96)
- Midnight RT PCR Expansion (EXP-MRT001)
Consumibles
- Nuclease-free water (e.g. ThermoFisher, AM9937)
- Etanol al 80 % recién preparado con agua sin nucleasas
- Qubit dsDNA HS Assay Kit (Invitrogen Q32851) (kit de ensayo ADNbc alta sensibilidad)
- Tubos de ensayo Qubit™ (Invitrogen Q32856)
- 1.5 ml Eppendorf DNA LoBind tubes
- 2 ml Eppendorf DNA LoBind tubes
- 5 ml Eppendorf DNA LoBind tubes
- Eppendorf twin.tec® PCR plate 96 LoBind, semi-skirted (Cat # 0030129504) with PCR seals
- (Opcional) Seroalbúmina bovina (BSA) (50 mg/ml) (p. ej., Invitrogen™ UltraPure™ BSA 50 mg/ml, AM2616)
Instrumental
- Mezclador Hula (mezclador giratorio suave)
- Gradilla magnética
- Centrifuge capable of taking 96-well plates
- Microfuge
- Mezclador vórtex
- Termociclador
- Multichannel pipettes suitable for dispensing 0.5–10 μl, 2–20 μl and 20–200 μl, and tips
- Pipeta y puntas P1000
- Pipeta y puntas P200
- Pipeta y puntas P100
- Pipeta y puntas P20
- Pipeta y puntas P10
- Cubeta con hielo
- Temporizador
- Qubit fluorometer (or equivalent)
Equipo opcional
- Centrifuga Eppendorf 5424 (o equivalente)
- PCR hood with UV steriliser (optional but recommended to reduce cross-contamination)
- PCR-Cooler (Eppendorf)
- Stepper pipette and tips
For this protocol, you will need your extracted RNA in 8 µl 10 mM Tris-HCl, pH 8.0.
IMPORTANTE
The Rapid Adapter (RA) used in this kit and protocol is not interchangeable with other sequencing adapters.
Rapid Barcoding Kit 96 V14 (SQK-RBK114.96) contents
Name | Acronym | Cap colour | No. of vials | Fill volume per vial (µl) |
---|---|---|---|---|
Rapid Adapter | RA | Green | 2 | 15 |
Adapter Buffer | ADB | Clear | 1 | 100 |
AMPure XP Beads | AXP | Amber | 3 | 1,200 |
Elution Buffer | EB | Black | 1 | 1,500 |
Sequencing Buffer | SB | Red | 1 | 1,700 |
Library Beads | LIB | Pink | 1 | 1,800 |
Library Solution | LIS | White cap, pink label | 1 | 1,800 |
Flow Cell Flush | FCF | Clear | 1 | 15,500 |
Flow Cell Tether | FCT | Purple | 2 | 200 |
Rapid Barcodes | RB01-96 | - | 3 plates | 8 µl per well |
This Product Contains AMPure XP Reagent Manufactured by Beckman Coulter, Inc. and can be stored at -20°C with the kit without detriment to reagent stability.
Midnight RT PCR Expansion (EXP-MRT001) contents
Name | Acronym | Cap colour | Number of vials | Fill volume per vial (µl) |
---|---|---|---|---|
LunaScript RT SuperMix | LS RT | Blue | 3 | 500 |
Q5 HS Master Mix | Q5 | Orange | 6 | 1,500 |
Midnight Primer Pool A | MP A | White | 3 | 15 |
Midnight Primer Pool B | MP B | Clear | 3 | 15 |
Midnight Primer sequences
As mutations in SARS-CoV-2 variants emerge amplicon drop out may be observed; for users wishing to design their own primer spike-ins to address this we suggest adding to the appropriate primer pool at a final concentration between 3.33 µM and 6.66 µM.
Below are the sequences for the V3 primer scheme used in the Midnight RT PCR Expansion.
Pool A
Primer name | Primer Sequence |
---|---|
SARSCoV_1200_1_LEFT | ACCAACCAACTTTCGATCTCTTGT |
SARSCoV_1200_1_RIGHT | GGTTGCATTCATTTGGTGACGC |
SARSCoV_1200_3_LEFT | GGCTTGAAGAGAAGTTTAAGGAAGGT |
SARSCoV_1200_3_RIGHT | GATTGTCCTCACTGCCGTCTTG |
SARSCoV_1200_5_LEFT | ACCTACTAAAAAGGCTGGTGGC |
SARSCoV_1200_5_RIGHT | AGCATCTTGTAGAGCAGGTGGA |
SARSCoV_1200_7_LEFT | ACCTGGTGTATACGTTGTCTTTGG |
SARSCoV_1200_7_RIGHT | GCTGAAATCGGGGCCATTTGTA |
SARSCoV_1200_9_LEFT | AGAAGTTACTGGCGATAGTTGTAATAACT |
SARSCoV_1200_9_RIGHT | TGCTGATATGTCCAAAGCACCA |
SARSCoV_1200_11_LEFT | AGACACCTAAGTATAAGTTTGTTCGCA |
SARSCoV_1200_11_RIGHT | GCCCACATGGAAATGGCTTGAT |
SARSCoV_1200_13_LEFT | ACCTCTTACAACAGCAGCCAAAC |
SARSCoV_1200_13_RIGHT | CGTCCTTTTCTTGGAAGCGACA |
SARSCoV_1200_15_LEFT | TTTTAAGGAATTACTTGTGTATGCTGCT |
SARSCoV_1200_15_RIGHT | ACACACAACAGCATCGTCAGAG |
SARSCoV_1200_17_LEFT | TCAAGCTTTTTGCAGCAGAAACG |
SARSCoV_1200_17_RIGHT | CCAAGCAGGGTTACGTGTAAGG |
SARSCoV_1200_19_LEFT | GGCACATGGCTTTGAGTTGACA |
SARSCoV_1200_19_RIGHT | CCTGTTGTCCATCAAAGTGTCCC |
SARSCoV_1200_21_LEFT | TCTGTAGTTTCTAAGGTTGTCAAAGTGA |
SARSCoV_1200_21_RIGHT | GCAGGGGGTAATTGAGTTCTGG |
21_right_spike | GTGTATGATTGAGTTCTGGTTGTAAG |
SARSCoV_1200_23_LEFT | ACTTTAGAGTCCAACCAACAGAATCT |
23_left_spike | ACTTTAGAGTTCAACCAACAGAATCT |
SARSCoV_1200_23_RIGHT | TGACTAGCTACACTACGTGCCC |
SARSCoV_1200_25_LEFT | TGCTGCTACTAAAATGTCAGAGTGT |
SARSCoV_1200_25_RIGHT | CATTTCCAGCAAAGCCAAAGCC |
SARSCoV_1200_27_LEFT | TGGATCACCGGTGGAATTGCTA |
SARSCoV_1200_27_RIGHT | TGTTCGTTTAGGCGTGACAAGT |
SARSCoV_1200_29_LEFT | TGAGGGAGCCTTGAATACACCA |
SARSCoV_1200_29_RIGHT | TAGGCAGCTCTCCCTAGCATTG |
Pool B
Primer name | Primer sequences |
---|---|
SARSCoV_1200_2_LEFT | CCATAATCAAGACTATTCAACCAAGGGT |
SARSCoV_1200_2_RIGHT | ACAGGTGACAATTTGTCCACCG |
SARSCoV_1200_4_LEFT | GGAATTTGGTGCCACTTCTGCT |
SARSCoV_1200_4_RIGHT | CCTGACCCGGGTAAGTGGTTAT |
SARSCoV_1200_6_LEFT | ACTTCTATTAAATGGGCAGATAACAACTG |
SARSCoV_1200_6_RIGHT | GATTATCCATTCCCTGCGCGTC |
SARSCoV_1200_8_LEFT | CAATCATGCAATTGTTTTTCAGCTATTTTG |
SARSCoV_1200_8_RIGHT | TGACTTTTTGCTACCTGCGCAT |
SARSCoV_1200_10_LEFT | TTTACCAGGAGTTTTCTGTGGTGT |
SARSCoV_1200_10_RIGHT | TGGGCCTCATAGCACATTGGTA |
SARSCoV_1200_12_LEFT | ATGGTGCTAGGAGAGTGTGGAC |
SARSCoV_1200_12_RIGHT | GGATTTCCCACAATGCTGATGC |
SARSCoV_1200_14_LEFT | ACAGGCACTAGTACTGATGTCGT |
SARSCoV_1200_14_RIGHT | GTGCAGCTACTGAAAAGCACGT |
SARSCoV_1200_16_LEFT | ACAACACAGACTTTATGAGTGTCTCT |
SARSCoV_1200_16_RIGHT | CTCTGTCAGACAGCACTTCACG |
SARSCoV_1200_18_LEFT | GCACATAAAGACAAATCAGCTCAATGC |
SARSCoV_1200_18_RIGHT | TGTCTGAAGCAGTGGAAAAGCA |
SARSCoV_1200_20_LEFT | ACAATTTGATACTTATAACCTCTGGAACAC |
SARSCoV_1200_20_RIGHT | GATTAGGCATAGCAACACCCGG |
SARSCoV_1200_22_LEFT | GTGATGTTCTTGTTAACAACTAAACGAACA |
SARSCoV_1200_22_RIGHT | AACAGATGCAAATCTGGTGGCG |
22_right_spike | AACAGATGCAAATTTGGTGGCG |
SARSCoV_1200_24_LEFT | GCTGAACATGTCAACAACTCATATGA |
24_left_spike | GCTGAATATGTCAACAACTCATATGA |
SARSCoV_1200_24_RIGHT | ATGAGGTGCTGACTGAGGGAAG |
SARSCoV_1200_26_LEFT | GCCTTGAAGCCCCTTTTCTCTA |
SARSCoV_1200_26_RIGHT | AATGACCACATGGAACGCGTAC |
SARSCoV_1200_28_LEFT | TTTGTGCTTTTTAGCCTTTCTGCT |
SARSCoV_1200_28_RIGHT | GTTTGGCCTTGTTGTTGTTGGC |
SARSCoV_1200_28_LEFT_27837T | TTTGTGCTTTTTAGCCTTTCTGTT |
Rapid barcode sequences
Component | Sequence |
---|---|
RB01 | AAGAAAGTTGTCGGTGTCTTTGTG |
RB02 | TCGATTCCGTTTGTAGTCGTCTGT |
RB03 | GAGTCTTGTGTCCCAGTTACCAGG |
RB04 | TTCGGATTCTATCGTGTTTCCCTA |
RB05 | CTTGTCCAGGGTTTGTGTAACCTT |
RB06 | TTCTCGCAAAGGCAGAAAGTAGTC |
RB07 | GTGTTACCGTGGGAATGAATCCTT |
RB08 | TTCAGGGAACAAACCAAGTTACGT |
RB09 | AACTAGGCACAGCGAGTCTTGGTT |
RB10 | AAGCGTTGAAACCTTTGTCCTCTC |
RB11 | GTTTCATCTATCGGAGGGAATGGA |
RB12 | CAGGTAGAAAGAAGCAGAATCGGA |
RB13 | AGAACGACTTCCATACTCGTGTGA |
RB14 | AACGAGTCTCTTGGGACCCATAGA |
RB15 | AGGTCTACCTCGCTAACACCACTG |
RB16 | CGTCAACTGACAGTGGTTCGTACT |
RB17 | ACCCTCCAGGAAAGTACCTCTGAT |
RB18 | CCAAACCCAACAACCTAGATAGGC |
RB19 | GTTCCTCGTGCAGTGTCAAGAGAT |
RB20 | TTGCGTCCTGTTACGAGAACTCAT |
RB21 | GAGCCTCTCATTGTCCGTTCTCTA |
RB22 | ACCACTGCCATGTATCAAAGTACG |
RB23 | CTTACTACCCAGTGAACCTCCTCG |
RB24 | GCATAGTTCTGCATGATGGGTTAG |
RB25 | GTAAGTTGGGTATGCAACGCAATG |
RB26 | CATACAGCGACTACGCATTCTCAT |
RB27 | CGACGGTTAGATTCACCTCTTACA |
RB28 | TGAAACCTAAGAAGGCACCGTATC |
RB29 | CTAGACACCTTGGGTTGACAGACC |
RB30 | TCAGTGAGGATCTACTTCGACCCA |
RB31 | TGCGTACAGCAATCAGTTACATTG |
RB32 | CCAGTAGAAGTCCGACAACGTCAT |
RB33 | CAGACTTGGTACGGTTGGGTAACT |
RB34 | GGACGAAGAACTCAAGTCAAAGGC |
RB35 | CTACTTACGAAGCTGAGGGACTGC |
RB36 | ATGTCCCAGTTAGAGGAGGAAACA |
RB37 | GCTTGCGATTGATGCTTAGTATCA |
RB38 | ACCACAGGAGGACGATACAGAGAA |
RB39 | CCACAGTGTCAACTAGAGCCTCTC |
RB40 | TAGTTTGGATGACCAAGGATAGCC |
RB41 | GGAGTTCGTCCAGAGAAGTACACG |
RB42 | CTACGTGTAAGGCATACCTGCCAG |
RB43 | CTTTCGTTGTTGACTCGACGGTAG |
RB44 | AGTAGAAAGGGTTCCTTCCCACTC |
RB45 | GATCCAACAGAGATGCCTTCAGTG |
RB46 | GCTGTGTTCCACTTCATTCTCCTG |
RB47 | GTGCAACTTTCCCACAGGTAGTTC |
RB48 | CATCTGGAACGTGGTACACCTGTA |
RB49 | ACTGGTGCAGCTTTGAACATCTAG |
RB50 | ATGGACTTTGGTAACTTCCTGCGT |
RB51 | GTTGAATGAGCCTACTGGGTCCTC |
RB52 | TGAGAGACAAGATTGTTCGTGGAC |
RB53 | AGATTCAGACCGTCTCATGCAAAG |
RB54 | CAAGAGCTTTGACTAAGGAGCATG |
RB55 | TGGAAGATGAGACCCTGATCTACG |
RB56 | TCACTACTCAACAGGTGGCATGAA |
RB57 | GCTAGGTCAATCTCCTTCGGAAGT |
RB58 | CAGGTTACTCCTCCGTGAGTCTGA |
RB59 | TCAATCAAGAAGGGAAAGCAAGGT |
RB60 | CATGTTCAACCAAGGCTTCTATGG |
RB61 | AGAGGGTACTATGTGCCTCAGCAC |
RB62 | CACCCACACTTACTTCAGGACGTA |
RB63 | TTCTGAAGTTCCTGGGTCTTGAAC |
RB64 | GACAGACACCGTTCATCGACTTTC |
RB65 | TTCTCAGTCTTCCTCCAGACAAGG |
RB66 | CCGATCCTTGTGGCTTCTAACTTC |
RB67 | GTTTGTCATACTCGTGTGCTCACC |
RB68 | GAATCTAAGCAAACACGAAGGTGG |
RB69 | TACAGTCCGAGCCTCATGTGATCT |
RB70 | ACCGAGATCCTACGAATGGAGTGT |
RB71 | CCTGGGAGCATCAGGTAGTAACAG |
RB72 | TAGCTGACTGTCTTCCATACCGAC |
RB73 | AAGAAACAGGATGACAGAACCCTC |
RB74 | TACAAGCATCCCAACACTTCCACT |
RB75 | GACCATTGTGATGAACCCTGTTGT |
RB76 | ATGCTTGTTACATCAACCCTGGAC |
RB77 | CGACCTGTTTCTCAGGGATACAAC |
RB78 | AACAACCGAACCTTTGAATCAGAA |
RB79 | TCTCGGAGATAGTTCTCACTGCTG |
RB80 | CGGATGAACATAGGATAGCGATTC |
RB81 | CCTCATCTTGTGAAGTTGTTTCGG |
RB82 | ACGGTATGTCGAGTTCCAGGACTA |
RB83 | TGGCTTGATCTAGGTAAGGTCGAA |
RB84 | GTAGTGGACCTAGAACCTGTGCCA |
RB85 | AACGGAGGAGTTAGTTGGATGATC |
RB86 | AGGTGATCCCAACAAGCGTAAGTA |
RB87 | TACATGCTCCTGTTGTTAGGGAGG |
RB88 | TCTTCTACTACCGATCCGAAGCAG |
RB89 | ACAGCATCAATGTTTGGCTAGTTG |
RB90 | GATGTAGAGGGTACGGTTTGAGGC |
RB91 | GGCTCCATAGGAACTCACGCTACT |
RB92 | TTGTGAGTGGAAAGATACAGGACC |
RB93 | AGTTTCCATCACTTCAGACTTGGG |
RB94 | GATTGTCCTCAAACTGCCACCTAC |
RB95 | CCTGTCTGGAAGAAGAATGGACTT |
RB96 | CTGAACGGTCATAGAGTCCACCAT |
3. Computer requirements and software
Requisitos informáticos para el MinION Mk1B
Para secuenciar con el MinION Mk1B es necesario tener un ordenador o portátil de alto rendimiento, que pueda soportar la velocidad de adquisición de datos. Encontrará más información en el documento MinION Mk1B IT Requirements.
Requisitos informáticos para el MinION Mk1C
El MinION Mk1C contiene ordenador y pantalla integrados, lo que elimina la dependencia de cualquier accesorio para generar y analizar datos de nanoporos. Encontrará más información en el documento MinION Mk1C IT Requirements.
MinION Mk1D IT requirements
Sequencing on a MinION Mk1D requires a high-spec computer or laptop to keep up with the rate of data acquisition. For more information, refer to the MinION Mk1D IT requirements document.
Software for nanopore sequencing
MinKNOW
The MinKNOW software controls the nanopore sequencing device, collects sequencing data and basecalls in real time. You will be using MinKNOW for every sequencing experiment to sequence, basecall and demultiplex if your samples were barcoded.
For instructions on how to run the MinKNOW software, please refer to the MinKNOW protocol.
EPI2ME (optional)
The EPI2ME cloud-based platform performs further analysis of basecalled data, for example alignment to the Lambda genome, barcoding, or taxonomic classification. You will use the EPI2ME platform only if you would like further analysis of your data post-basecalling.
For instructions on how to create an EPI2ME account and install the EPI2ME Desktop Agent, please refer to this link.
Verificar la celda de flujo
Antes de empezar el experimento de secuenciación, recomendamos verificar el número de poros disponibles, presentes en la celda de flujo. La comprobación deberá realizarse en las primeras 12 semanas desde su adquisición, si se trata de celdas de flujo MinION, GridION o PromethION, y en las primeras cuatro semanas tras la compra de celdas de flujo Flongle. Oxford Nanopore Technologies sustituirá cualquier celda de flujo con un número de poros inferior al indicado en la tabla siguiente, siempre y cuando el resultado se notifique dentro de los dos días siguientes a la comprobación y se hayan seguido las instrucciones de almacenamiento. Para verificar la celda de flujo, siga las instrucciones del documento Flow Cell Check.
Celda de flujo | Número mínimo de poros activos cubierto por la garantía |
---|---|
Flongle | 50 |
MinION/GridION | 800 |
PromethION | 5000 |
4. Reverse transcription
Material
- Input RNA in 10 mM Tris-HCl, pH 8.0
- LunaScript RT SuperMix (LS RT)
Consumibles
- Nuclease-free water (e.g. ThermoFisher, AM9937)
- Eppendorf twin.tec® PCR plate 96 LoBind, semi-skirted (Cat # 0030129504) with PCR seals
Instrumental
- Multichannel pipettes suitable for dispensing 0.5–10 μl, 2–20 μl and 20–200 μl, and tips
- Termociclador
- Centrifuge capable of taking 96-well plates
- Cubeta con hielo
Equipo opcional
- PCR-Cooler (Eppendorf)
- PCR hood with UV steriliser (optional but recommended to reduce cross-contamination)
- Stepper pipette and tips
IMPORTANTE
Keep the RNA sample on ice as much as possible to prevent nucleolytic degradation, which may affect sensitivity.
In a clean pre-PCR hood, place a fresh 96-well plate (RT plate) into a PCR Cooler (if using). Using a stepper pipette, or multichannel pipette, add 2 µl of LunaScript RT SuperMix (LS RT) per well.
Depending on the number of samples, fill each well per column as follows:
Plate location | X24 samples | X48 samples | X96 samples |
---|---|---|---|
Columns | 1-3 | 1-6 | 1-12 |
To each well containing LunaScript RT SuperMix (LS RT), add 8 µl of sample and gently mix by pipetting. If adding less than 8 µl, make up the rest of the volume with nuclease-free water.
Example for X48 samples:
IMPORTANTE
We recommend having a negative control and a positive control for every plate of samples.
Seal the RT plate and spin down.
Incubate the samples in the thermal cycler using the following program:
Step | Temperature | Time | Cycles |
---|---|---|---|
Primer annealing | 25°C | 2 min | 1 |
cDNA synthesis | 55°C | 10 min | 1 |
Heat inactivation | 95°C | 1 min | 1 |
Hold | 4°C | ∞ |
FIN DEL PROCESO
While the reverse transcription reaction is running, prepare the master mixes as described in the next section.
5. PCR
Material
- Q5 HS Master Mix (Q5)
- Midnight Primer Pool A (MP A)
- Midnight Primer Pool B (MP B)
Consumibles
- Nuclease-free water (e.g. ThermoFisher, AM9937)
- 1.5 ml Eppendorf DNA LoBind tubes
- Eppendorf twin.tec® PCR plate 96 LoBind, semi-skirted (Cat # 0030129504) with PCR seals
Instrumental
- Multichannel pipettes suitable for dispensing 0.5–10 μl, 2–20 μl and 20–200 μl, and tips
- P1000 pipette and tips
- Pipeta y puntas P200
- Termociclador
- Microfuge
- Centrifuge capable of taking 96-well plates
- Cubeta con hielo
Equipo opcional
- PCR-Cooler (Eppendorf)
- PCR hood with UV steriliser (optional but recommended to reduce cross-contamination)
- Stepper pipette and tips
Primer design
To generate tiled PCR amplicons from the SARS-CoV-2 viral cDNA, primers were designed by Freed et al., 2020 using Primal Scheme. These primers are designed to generate 1200 bp amplicons that overlap by approximately 20 bp. These primer sequences can be found here.
IMPORTANTE
We recommend handling the primers in a clean template-free PCR hood.
In the template-free pre-PCR hood, prepare the following master mixes in Eppendorf DNA LoBind tubes and mix thoroughly as follows:
Volume per sample:
Reagent | Pool A | Pool B |
---|---|---|
Nuclease-free water | 3.7 µl | 3.7 µl |
Midnight Primer Pool A (MP A) | 0.05 µl | - |
Midnight Primer Pool B (MP B) | - | 0.05 µl |
Q5 HS Master Mix (Q5) | 6.25 µl | 6.25 µl |
Total | 10 µl | 10 µl |
For x24 samples:
Reagent | Pool A | Pool B |
---|---|---|
Nuclease-free water | 102 µl | 102 µl |
Midnight Primer Pool A (MP A) | 2 µl | - |
Midnight Primer Pool B (MP B) | - | 2 µl |
Q5 HS Master Mix (Q5) | 172 µl | 172 µl |
Total | 276 µl | 276 µl |
For x48 samples:
Reagent | Pool A | Pool B |
---|---|---|
Nuclease-free water | 203 µl | 203 µl |
Midnight Primer Pool A (MP A) | 3 µl | - |
Midnight Primer Pool B (MP B) | - | 3 µl |
Q5 HS Master Mix (Q5) | 344 µl | 344 µl |
Total | 550 µl | 550 µl |
For x96 samples:
Reagent | Pool A | Pool B |
---|---|---|
Nuclease-free water | 407 µl | 407 µl |
Midnight Primer Pool A (MP A) | 6 µl | - |
Midnight Primer Pool B (MP B) | - | 6 µl |
Q5 HS Master Mix (Q5) | 687 µl | 687 µl |
Total | 1,100 µl | 1,100 µl |
Using a stepper pipette or a multichannel pipette, aliquot 10 µl of Pool A and Pool B into a clean 96-well plate(s) as follows:
Plate location | X24 samples | X48 samples | X96 samples |
---|---|---|---|
Columns | Pool A: 1-3 Pool B: 4-6 | Pool A: 1-6 Pool B: 7-12 | Pool A: 1-12 Pool B: 1-12 |
Note: For X96 samples, Pool A is a separate plate to Pool B.
Using a multichannel pipette, transfer 2.5 μl of each RT reaction from the RT plate to the corresponding well for both Pool A and Pool B in the PCR plate(s), taking care not to cross-contaminate different wells. Mix by pipetting the contents of each well up and down.
There should be two PCR reactions per sample.
Example for X48 samples:
Mix by pipetting the contents of each well up and down.
IMPORTANTE
Carry forward the negative control from the reverse transcription reaction to monitor cross-contamination events.
We recommend having a negative control and a positive control for every plate of samples.
Seal the plate(s) and spin down briefly.
Incubate using the following program, with the heated lid set to 105°C:
Step | Temperature | Time | Cycles |
---|---|---|---|
Initial denaturation | 98°C | 30 sec | 1 |
Denaturation Annealing and extension | 98°C 61°C 65°C | 15 sec 2 min 3 min | 35 |
Hold | 4°C | ∞ |
MEDIDA OPCIONAL
If necessary, the protocol can be paused at this point. The samples should be kept at 4°C and can be stored overnight.
6. Addition of rapid barcodes
Material
- Rapid Barcode Plate (RB01-96)
Consumibles
- Nuclease-free water (e.g. ThermoFisher, AM9937)
- Eppendorf twin.tec® PCR plate 96 LoBind, semi-skirted (Cat # 0030129504) with PCR seals
Instrumental
- Multichannel pipettes suitable for dispensing 2–20 μl and 20–200 μl, and tips
- Termociclador
- Centrifuge capable of taking 96-well plates
Spin down the Rapid Barcode Plate and PCR reactions prior to opening to collect material in the bottom of the wells.
Using a multichannel pipette or stepper pipette, transfer 2.5 μl nuclease-free water to the wells of a fresh 96-well plate (Barcode Attachment Plate).
Depending on the number of samples, aliquot into each well of the columns as follows:
Plate location | X24 samples | X48 samples | X96 samples |
---|---|---|---|
Columns | 1-3 | 1-6 | 1-12 |
Using a multichannel pipette, transfer the entire contents of each well of PCR Pool B to the corresponding well of PCR Pool A and mix by pipetting.
Depending on the number of samples, Pool B columns will correspond to different Pool A columns.
No. of samples | Pool B column | Corresponding Pool A column |
---|---|---|
X24 | 4 5 6 | 1 2 3 |
X48 | 7 8 9 10 11 12 | 1 2 3 4 5 6 |
X96 | 1 2 3 4 5 6 7 8 9 10 11 12 | 1 2 3 4 5 6 7 8 9 10 11 12 |
Example for X48 samples:
Using a multichannel pipette, transfer 5 µl from each well of PCR Pool A (now containing pooled PCR products) to the corresponding well of the Barcode Attachment Plate and mix by pipetting.
Depending on the number of samples, PCR Pool A will be in each well of the following columns:
Plate location | X24 samples | X48 samples | X96 samples |
---|---|---|---|
Columns | 1-3 | 1-6 | 1-12 |
Example for X48 samples:
Using a multichannel pipette, transfer 2.5 μl from the Rapid Barcode Plate to the corresponding well of the Barcode Attachment Plate, taking care not to cross-contaminate different wells. Mix by pipetting.
Depending on the number of samples, aliquot into each well of the columns as follows:
Plate location | X24 samples | X48 samples | X96 samples |
---|---|---|---|
Columns | 1-3 | 1-6 | 1-12 |
Example for X48 samples:
IMPORTANTE
Samples must be thoroughly mixed.
Seal the Barcode Attachment Plate and spin down.
Incubate the plate in a thermal cycler at 30°C for 2 minutes and then at 80°C for 2 minutes.
7. Pooling samples and clean-up
Material
- AMPure XP Beads (AXP) (microesferas magnéticas)
- Elution Buffer from the Oxford Nanopore kit (EB)
- Rapid Adapter (RA)
- Adapter Buffer (ADB)
Consumibles
- Etanol al 80 % recién preparado con agua sin nucleasas
- 1.5 ml Eppendorf DNA LoBind tubes
- 5 ml Eppendorf DNA LoBind tubes
- Qubit dsDNA HS Assay Kit (Invitrogen Q32851) (kit de ensayo ADNbc alta sensibilidad)
- Tubos de ensayo Qubit™ (Invitrogen Q32856)
Instrumental
- Microfuge
- Centrifuge capable of taking 96-well plates
- Mezclador Hula (mezclador giratorio suave)
- Gradilla magnética
- Cubeta con hielo
- P1000 pipette and tips
- Pipeta y puntas P200
- Pipeta y puntas P20
- Pipeta y puntas P10
- Qubit fluorometer plate reader (or equivalent for QC check)
Briefly spin down the Barcode Attachment Plate to collect the liquid at the bottom of the wells prior to opening.
Pool the barcoded samples in a 1.5 ml Eppendorf DNA LoBind tube.
We expect to have about ~10 µl per sample.
X24 samples | X48 samples | X96 samples | |
---|---|---|---|
Total volume | ~240 µl | ~480 µl | ~960 µl |
Mix pooled samples by vortexing.
IMPORTANTE
Pooled barcoded samples must be thoroughly mixed.
Transfer half of the barcoded pooled sample to a clean 1.5 ml Eppendorf DNA LoBind tube.
Per sample, we expect to take forward ~5 µl.
X24 samples | X48 samples | X96 samples | |
---|---|---|---|
Example volume | 120 µl | 240 µl | 480 µl |
Resuspend the AMPure XP Beads (AXP) by vortexing.
To the pooled barcoded sample, add an equal volume of resuspended AMPure XP Beads (AXP, or SPRI) and mix by pipetting.
Example volume | X24 samples | X48 samples | X96 samples |
---|---|---|---|
Volume of 1X AXP | 120 µl | 240 µl | 480 µl |
Incubar en el mezclador Hula (o mezclador giratorio suave) durante 5 minutos a temperatura ambiente.
Prepare at least 3 ml of fresh 80% ethanol in nuclease-free water.
Centrifugar la muestra y precipitar en un imán. Dejar el tubo en el imán y retirar el sobrenadante con una pipeta.
Keep the tube on the magnet and wash the beads with 1 ml of freshly-prepared 80% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.
Repeat the previous step.
Briefly spin down and place the tube back on the magnet. Pipette off any residual ethanol. Allow to dry for 30 seconds, but do not dry the pellet to the point of cracking.
Remove the tube from the magnetic rack and resuspend the pellet by pipetting in 15 µl Elution Buffer (EB). Incubate for 10 minutes at room temperature.
Pellet the beads on a magnet until the eluate is clear and colourless.
Remove and retain 15 µl of eluate containing the DNA library into a clean 1.5 ml Eppendorf DNA LoBind tube.
CHECKPOINT
Quantify DNA concentration by using the Qubit dsDNA HS Assay Kit.
Take forward 11 µl of your eluted DNA library.
In a fresh 1.5 ml Eppendorf DNA LoBind tube, dilute the Rapid Adapter (RA) as follows and pipette mix:
Reagent | Volume |
---|---|
Rapid Adapter (RA) | 1.5 μl |
Adapter Buffer (ADB) | 3.5 μl |
Total | 5 μl |
Add 1 µl of the diluted Rapid Adapter (RA) to the barcoded DNA.
Mix gently by flicking the tubes, and spin down.
Incubate the reaction for 5 minutes at room temperature.
FIN DEL PROCESO
The prepared library is used for loading into the flow cell. Store the library on ice until ready to load.
8. Priming and loading the SpotON flow cell
Material
- Flow Cell Flush (FCF)
- Flow Cell Tether (FCT) (anclaje de celda de flujo)
- Library Solution (LIS)
- Library Beads (LIB) (microesferas de carga de la biblioteca)
- Sequencing Buffer (SB)
Consumibles
- Tubos de 1,5 ml Eppendorf DNA LoBind
- Celda de flujo MinION/GridION
- Agua sin nucleasas (p. ej., ThermoFisher AM9937)
- (Opcional) Seroalbúmina bovina (BSA) (50 mg/ml) (p. ej., Invitrogen™ UltraPure™ BSA 50 mg/ml, AM2616)
Instrumental
- Dispositivo MinION o GridION
- Pantalla protectora celdas de flujo MinION/GridION
- Pipeta y puntas P1000
- Pipeta y puntas P100
- Pipeta y puntas P20
- Pipeta y puntas P10
IMPORTANTE
Nótese, este kit es compatible solo con las celdas de flujo R10.4.1 (FLO-MIN114).
CONSEJO
Cebado y carga de la celda de flujo
Se recomienda a los nuevos usuarios que miren el vídeo Priming and loading your flow cell antes de realizar su primer experimento.
Uso de Library Solution (LIS)
En la mayoría de experimentos de secuenciación, recomendamos usar Library Beads (LIB) para cargar la biblioteca en la celda de flujo. Nótese, si previamente se ha usado agua para cargar la biblioteca, se deberá usar Library Solution (LIS) en su lugar. Nota: Algunos clientes han notado que las bibliotecas viscosas pueden cargarse con mayor facilidad cuando no se usan Library Beads (LIB).
Descongelar los viales Sequencing Buffer (SB), Library Beads (LIB) o Library Solution (LIS), -si se requiere-, y un tubo de Flow Cell Flush (FCF) a temperatura ambiente. Agitar en vórtex, centrifugar y colocar en hielo.
IMPORTANTE
Para obtener un rendimiento de secuenciación óptimo y mejorar el rendimiento de las celdas de flujo MinION R10.4.1 (FLO-MIN114), recomendamos añadir seroalbúmina bovina (BSA), en una concentración total de 0,2 mg/ml, a la mezcla de cebado de la celda de flujo.
Nota: No se aconseja utilizar ningún otro tipo de albúmina (p. ej., seroalbúmina humana recombinante).
Prepare the flow cell priming mix with BSA in a suitable tube for the number of flow cells to flush. Once combined, mix well by pipette mixing.
Reagents | Volume per flow cell |
---|---|
Flow Cell Flush (FCF) | 1,170 µl |
Bovine Serum Albumin (BSA) at 50 mg/ml | 5 µl |
Flow Cell Tether (FCT) | 30 µl |
Total volume | 1,205 µl |
Abrir la tapa del dispositivo MinION o GridION y deslizar la celda de flujo debajo del clip. Presionar la celda de flujo con firmeza para asegurar un contacto eléctrico y térmico adecuados.
MEDIDA OPCIONAL
Antes de cargar la biblioteca, verifique la celda de flujo para determinar el número de poros disponible.
Si se ha verificado con anterioridad la cantidad de poros presentes en la celda de flujo, este paso se puede omitir.
Dispone de más información en las instrucciones de comprobación de la celda de flujo, del protocolo de MinKNOW.
Abrir el puerto de cebado de la celda de flujo, deslizando la tapa en el sentido de las agujas del reloj.
IMPORTANTE
Tenga cuidado a la hora de extraer el tampón de la celda de flujo. No retire más de 20-30 μl y asegúrese de que el tampón cubra la matriz de poros en todo momento. La introducción de burbujas de aire en la matriz puede dañar los poros de manera irreversible.
Tras abrir el puerto de cebado, verificar si hay una burbuja de aire bajo la tapa. Retirar una pequeña cantidad de tampón para quitar las burbujas:
- Ajustar una pipeta P1000 a 200 μl.
- Introducir la punta de la pipeta en el puerto de cebado.
- Girar la rueda hasta que el indicador de volumen marque 220-230 μl o hasta que se pueda ver una pequeña cantidad de tampón entrar en la punta de la pipeta.
Nota: Comprobar que haya un flujo continuo de tampón circulando desde el puerto de cebado a través de la matriz de poros.
Cargar 800 μl de solución en el puerto de cebado, evitando introducir burbujas de aire. Esperar 5 minutos. Durante este tiempo, preparar la biblioteca para cargar siguiendo los pasos a continuación.
Mezclar con la pipeta, minuciosamente, el contenido del vial Library Beads (LIB).
IMPORTANTE
Este vial contiene microesferas en suspensión. Las microesferas precipitan muy rápido; por eso, es fundamental mezclarlas justo antes de usar.
En la mayoría de experimentos de secuenciación, se recomienda usar Library Beads (LIB) . El reactivo Library Solution (LIS) está indicado para bibliotecas de ADN más viscosas.
En un tubo nuevo de 1,5 ml Eppendorf DNA LoBind, preparar la biblioteca de la siguiente manera:
Reactivo | Volumen por celda de flujo |
---|---|
Sequencing Buffer (SB) | 37,5 µl |
Library Beads (LIB) mezcladas justo antes de usar, o Library Solution (LIS), si se requiere | 25,5 µl |
Biblioteca de ADN | 12 µl |
Total | 75 µl |
Completar el cebado de la celda de flujo:
- Levantar suavemente la tapa del puerto de carga SpotON.
- Cargar 200 µl de solución en el puerto de cebado (no en el puerto de muestra SpotON), evitando introducir burbujas de aire.
Mezclar la biblioteca pipeteando suavemente, justo antes de cargar.
Añadir, gota a gota, 75 μl de la biblioteca preparada en el puerto de muestra SpotON. Procurar que cada gota fluya hacia adentro del puerto antes de añadir la siguiente.
Volver a colocar con cuidado, la tapa del puerto de muestra SpotON, procurando que el tapón encaje en el agujero y cerrar el puerto de cebado.
IMPORTANTE
Para obtener resultados de secuenciación óptimos, coloque la pantalla protectora sobre la celda de flujo justo después de cargar la biblioteca.
Recomendamos colocar la pantalla protectora en la celda de flujo y dejarla puesta mientras la biblioteca esté cargada, incluyendo los lavados y pasos de recarga. Retirar la pantalla cuando se haya extraído la biblioteca de la celda de flujo.
Colocar la pantalla protectora de la siguiente manera:
Colocar con cuidado el borde delantero de la pantalla protectora contra el clip. Nota: No hacer fuerza sobre ella.
Colocar la pantalla protectora con suavidad sobre la celda de flujo. La pieza debe asentarse alrededor de la tapa SpotON y debe cubrir por completo la sección superior de la celda de flujo.
ATENCIÓN
La pantalla protectora no está fijada a la celda de flujo. Una vez colocada, es necesario manipularla con cuidado.
FIN DEL PROCESO
Cerrar la tapa del dispositivo y configurar un experimento de secuenciación en MinKNOW.
9. Data acquisition and basecalling
Aspectos generales del análisis de datos de nanoporos
Para obtener una descripción completa del análisis de datos de nanoporos, que incluya distintas posibilidades para el análisis de identificación y postidentificicación de bases, consultar el documento Data Analysis.
IMPORTANTE
Required settings in MinKNOW
The correct barcoding parameters must be set up on MinKNOW prior to the sequencing run. During the run setup, in the Analysis tab:
- Enable Barcoding.
- Select Edit options.
- Enable Mid-read barcode filtering.
- Enable Override minimum barcoding score and set the value to 60.
- Enable Override minimum mid-read barcoding score and set the value to 50.
Cómo empezar a secuenciar
El programa MinKNOW realiza el control del dispositivo de secuenciación, la adquisición de datos y la identificación de bases en tiempo real. Una vez que el usuario ha instalado MinKNOW en su ordenador, hay diferentes maneras de llevar a cabo la secuenciación:
1. Adquisición de datos e identificación de bases en tiempo real con el programa MinKNOW.
Seguir las instrucciones del protocolo de MinKNOW, desde el apartado "Starting a sequencing run" hasta el final del apartado "Completing a MinKNOW run".
2. Adquisición de datos e identificación de bases en tiempo real con el dispositivo GridION.
Seguir las instrucciones del manual de usuario de GridION.
3. Adquisición de datos e identificación de bases en tiempo real con el dispositivo MinION Mk1C.
Seguir las instrucciones del manual de usuario de MinION Mk1C.
4. Adquisición de datos e identificación de bases en tiempo real con el dispositivo PromethION.
Seguir las instrucciones de los manuales de usuario de PromethION o PromethION 2 Solo.
5. Adquisición de datos e identificación de bases posterior mediante MinKNOW.
Seguir las instrucciones del protocolo de MinKNOW, desde el apartado "Starting a sequencing run" hasta el final del apartado "Completing a MinKNOW run". Al configurar los parámetros del experimento, ajustar la pestaña Basecalling (Identificación de bases) en posición de APAGADO. Al terminar el experimento de secuenciación, seguir las instrucciones del apartado "Post-run analysis" del protocolo de MinKNOW.
10. Downstream analysis
Recommended pipeline analysis
The wf-artic is a bioinformatics workflow for the analysis of ARTIC sequencing data prepared using the Midnight protocol. The bioinformatics workflow is orchestrated by the Nextflow software. Nextflow is a publicly available and open-source project that enables the execution of scientific workflows in a scalable and reproducible way. The use of the Nextflow software has been integrated into the EPI2ME Labs software that we recommend for running our downstream analysis methods.
Alternative methods for downstream analysis are available using your device terminal or command line, however we only suggest this for experienced users.
Demultiplexed sequence reads are processed using the ARTIC Field Bioinformatics software that has been modified for the analysis of FASTQ sequences prepared using Oxford Nanopore Rapid Sequencing kits. The other modification to the ARTIC workflow is the use of a primer scheme that defines the sequencing primers used by the Midnight protocol and their genomic locations on the SARS-CoV-2 genome.
The wf-artic workflow includes other analytical steps that include cladistic analysis using Nextclade and strain assignment using Pangolin. The data facets included in the report are parameterised and additional information such as plots of depth-of-coverage across the reference genome is optional.
The complete source for wf-artic is linked, and the Nextflow software will download the scripts and logic flow from this location.
The wf-artic workflow needs to be started manually as outlined below in 'Running a Midnight analysis using EPI2ME Labs'.
Software set-up and installation
The EPI2ME application provides a clean interface to accessing bioinformatics workflows, and is our recommended method in performing your post-sequencing analysis.
Follow the instructions in the EPI2ME Installation guide to install the application on your device.
For more information on how to use EPI2ME, refer to the EPI2ME Quick Start guide.
Installing and updating the wf-artic workflow in EPI2ME Labs:
Ensure you have installed the wf-artic workflow prior to the first analysis set-up.
In the EPI2ME Labs home page, scroll down to the "Install workflows" section and click on epi2me-labs/wf-artic:
If you have already installed the wf-artic workflow, ensure you are using the latest version.
Updating the workflow can be done directly through EPI2ME Labs by navigating to the wf-artic workflow page and clicking Update Workflow:
Demultiplexing of multiple barcoded samples
The wf-artic analysis requires FASTQ sequence data that has already been demultiplexed.
Reads will be demultiplexed during sequencing if you are following the recommended "Required settings in MinKNOW". However, demultiplexing can also be done post-sequencing using the MinKNOW software.
For more information and guides on demultiplexing using MinKNOW, refer to the "Post-run analysis" section in our MinKNOW Protocol.
The expected input for wf-artic is a folder of folders as shown below. Each of the barcode folders should contain the FASTQ sequence data and files may either be uncompressed or gzipped.
$ tree -d MidnightFastq/
MidnightFastq/
├── barcode01
├── barcode02
├── barcode03
├── barcode04
├── barcode05
├── barcode06
└── unclassified
IMPORTANTE
Basecalling model
The basecalling model should be specified when setting up the wf-artic analysis. This should reflect the basecalling model selected during your run set-up as follows:
- If using the default model, High-accuracy basecalling (HAC): r1041_e82_400bps_hac_variant_g615
- If you have used Super accurate basecalling (SUP), please use: r1041_e82_400bps_sup_variant_g615
- If you have used FAST basecalling, please use: r1041_e82_400bps_fast_variant_g615
Running a Midnight analysis using EPI2ME Labs
Open the EPI2ME Labs application on your device.
Open the "Workflows" tab in the EPI2ME Labs application and click on the "wf-artic" workflow:
In the "wf-artic" workflow page, select "Run this workflow" to open analysis set-up:
Complete the wf-artic run set-up:
Select your data input file location. Please note, this folder must contain the demultiplexed FASTQ files of your sequencing run.
Expand the Primer Scheme Selection tab and set the Scheme version to Midnight-ONT/V3.
Expand the Advanced Options tab and set the Medaka model to the basecalling model used in your sequencing run.
Expand the Extra configuration tab and set the Run name for your wf-artic analysis.
Click Launch workflow at the bottom of the page to begin your analysis.
Navigate to the "Analysis" tab in the EPI2ME Labs application to monitor your run:
Completed analysis and result files
The wf-artic analysis outputs will be written to the Working Directory folder specified in the EPI2ME Labs Settings tab.
The location of this folder is specified in the wf-artic run Instance parameters preceeded by out_dir
.
However, these files can also be accessed directly in the EPI2ME Labs application from the completed analysis page for your run:
These outputs include:
all_consensus.fasta
A multi-FASTA format sequence file containing the consensus sequence for each of the samples investigated. This consensus sequence has been prepared for the whole SARS-CoV-2 genome, not just the spike protein region. The consensus sequence masks the non-spike regions and regions of low sequence coverage with N residues.all_variants.vcf.gz
A gzipped VCF file that describes all high-quality genetic variants called by medaka from the sequenced samples.all_variants.vcf.gz.tbi
An index file for the gzipped VCF file.consensus_status.txt
A tab delimited file that reports whether a consensus sequence has been successfully prepared for a sample, or not.wf-artic-report.html
A report summarising these data. This HTML format report also includes the output of the Nextclade software that can be used for a visual inspection of, for example, primer drop out or other qualitative consensus sequence aspects.
Other files are included in the work-directory
. This includes per sample VCF files of all genetic variants prior to filtering and other sequences.
Housekeeping and disk usage
The "Working Directory" can be specified in the EPI2ME Labs "Settings" tab and defines where the workflow intermediate files and outputs are stored.
This folder will accumulate a significant number of files that correspond to raw BAM files, other larger intermediates and analysis results files. We recommend this folder to be routinely cleared.
11. Reutilización y devolución de celdas de flujo
Material
- Flow Cell Wash Kit (EXP-WSH004) (kit de lavado de celda de flujo)
Si al terminar el experimento desea volver a usar la celda de flujo, siga las instrucciones del protocolo Flow Cell Wash Kit y guarde la celda de flujo lavada a entre 2 °C y 8 ⁰C.
El protocolo Flow Cell Wash Kit está disponible en la comunidad Nanopore.
CONSEJO
Una vez terminado el experimento, recomendamos lavar la celda de flujo cuanto antes. Si no es posible, se puede dejar en el dispositivo y lavar al día siguiente.
Otra posibilidad es seguir el procedimiento de devolución para lavar la celda de flujo y enviarla a Oxford Nanopore.
Aquí puede encontrar las instrucciones para devolver celdas de flujo.
IMPORTANTE
Ante cualquier duda o pregunta acerca del experimento de secuenciación, consulte la guía de resolución de problemas, Troubleshooting Guide, que se encuentra en la versión en línea de este protocolo.
12. Problemas durante la extracción de ADN/ARN y la preparación de bibliotecas
A continuación hay una lista de los problemas más frecuentes, con algunas posibles causas y soluciones propuestas.
También disponemos de una página de preguntas frecuentes, FAQ, en la sección Support de la comunidad Nanopore.
Si ha probado las soluciones propuestas y continúa teniendo problemas, póngase en contacto con el departamento de asistencia técnica, bien por correo electrónico (support@nanoporetech.com) o a través del Live Chat de la comunidad Nanopore.
Baja calidad de la muestra
Observación | Posible causa | Comentarios y acciones recomendadas |
---|---|---|
Baja pureza del ADN (la lectura del Nanodrop para ADN OD 260/280 es <1,8 y OD 260/230 es <2,0-2,2) | El método de extracción de ADN no proporciona la pureza necesaria | Los efectos de los contaminantes se muestran en la página Contaminants. Pruebe con un método de extracción alternativo que no provoque el arrastre de contaminantes. Considere realizar un paso adicional de limpieza SPRI. |
Baja integridad del ARN (número de integridad del ARN <9,5 RIN o la banda ARNr se muestra como una mancha en el gel). | El ARN se degradó durante la extracción | Probar un método de extracción de ARN diferente. Encontrará más información sobre RIN en la página RNA Integrity Number. Asimismo, dispone de información adicional en la página DNA/RNA Handling. |
El ARN tiene una longitud de fragmento más corta de lo esperado | El ARN se degradó durante la extracción | Probar un método de extracción de ARN diferente. Encontrará más información sobre RIN en la página RNA Integrity Number. Asimismo, dispone de información adicional en la página DNA/RNA Handling. Cuando se trabaje con ARN, recomendamos que el espacio de trabajo y el instrumental de laboratorio estén libres de ribonucleasas. |
Escasa recuperación de ADN tras la limpieza con microesferas magnéticas AMPure
Observación | Posible causa | Comentarios y acciones recomendadas |
---|---|---|
Escasa recuperación | Pérdida de ADN debido a una proporción de microesferas magnéticas AMPure por muestra inferior a lo previsto. | 1. Las microesferas magnéticas AMPure precipitan con rapidez; antes de añadirlas a la muestra hay que asegurarse de que estén bien resuspendidas. 2. Si la proporción de microesferas por muestra es inferior a 0.4:1, los fragmentos de ADN, sean del tamaño que sean, se perderán durante la limpieza. |
Escasa recuperación | Los fragmentos de ADN son más cortos de lo esperado | Cuanto menor sea la proporción de microesferas magnéticas AMPure por muestra, más rigurosa será la selección de fragmentos largos frente a los cortos. Determinar siempre la longitud de la muestra de ADN en un gel de agarosa u otros métodos de electroforesis en gel, y, a continuación, calcular la cantidad adecuada de microesferas magnéticas que se debe utilizar. |
Escasa recuperación tras la preparación de extremos | El paso de lavado utilizó etanol a <70 % | Cuando se utilice etanol a <70 %, el ADN se eluirá de las microesferas magnéticas. Asegúrese de utilizar el porcentaje correcto. |
13. Issues during the sequencing run
A continuación hay una lista de los problemas más frecuentes, con algunas posibles causas y soluciones propuestas.
También disponemos de una página de preguntas frecuentes, FAQ, en la sección Support de la comunidad Nanopore.
Si ha probado las soluciones propuestas y continúa teniendo problemas, póngase en contacto con el departamento de asistencia técnica, bien por correo electrónico (support@nanoporetech.com) o a través del Live Chat de la comunidad Nanopore.
Menos poros al inicio de la secuenciación que después de verificar la celda de flujo
Observación | Posible causa | Comentarios y acciones recomendadas |
---|---|---|
MinKNOW presentó al inicio de la secuenciación un número de poros inferior al indicado durante la comprobación de la celda de flujo | Se introdujo una burbuja de aire en la matriz de nanoporos | Tras comprobar el número de poros presente en la celda de flujo, es imprescindible quitar las burbujas que haya cerca del puerto de cebado. Si no se quitan, pueden desplazarse a la matriz de nanoporos y dañar de manera irreversible los nanoporos expuestos al aire. En este vídeo se muestran algunas buenas prácticas para evitar que esto ocurra. |
MinKNOW presentó al inicio de la secuenciación un número de poros inferior al indicado durante la comprobación de la celda de flujo | La celda de flujo no está colocada correctamente | Detener el ciclo de secuenciación, quitar la celda de flujo del dispositivo e insertarla de nuevo. Comprobar que está firmemente asentada en el dispositivo y que ha alcanzado la temperatura deseada. Si procede, probar con una posición diferente del dispositivo (GriION/PromethION). |
MinKNOW presentó al inicio de la secuenciación un número de poros inferior al indicado durante la comprobación de la celda de flujo | La presencia de contaminantes en la biblioteca ha dañado o bloqueado los poros | El número de poros resultante tras la comprobación de la celda de flujo se realiza usando el control de calidad de las moléculas de ADN presentes en el tampón de almacenamiento de la celda de flujo. Al inicio de la secuenciación, se utiliza la misma biblioteca para estimar el número de poros activos. Por este motivo, se estima que puede haber una variabilidad del 10 % en el número de poros detectados. Tener un número de poros considerablemente inferior al inicio de la secuenciación puede deberse a la presencia de contaminantes en la biblioteca que hayan dañado las membranas o bloqueado los poros. Para mejorar la pureza del material de entrada tal vez sea necesario usar métodos de purificación o extracción de ADN/ARN alternativos. Los efectos de los contaminantes están descritos en la página Contaminants. Se recomienda, probar con un método de extracción alternativo que no provoque el arrastre de contaminantes. |
Error en el script de MinKNOW
Observación | Posible causa | Comentarios y acciones recomendadas |
---|---|---|
MinKNOW muestra el mensaje "Error en el script" | Reiniciar el ordenador y reiniciar MinKNOW. Si el problema continúa, reúna los archivos de registro MinKNOW log files y contacte con el servicio de asistencia técnica. Si no dispone de otro dispositivo de secuenciación, recomendamos que guarde la celda de flujo con la biblioteca cargada a 4 °C y contacte con el servicio de asistencia técnica para recibir recomendaciones de almacenamiento adicionales. |
Pore occupancy below 40%
Observation | Possible cause | Comments and actions |
---|---|---|
Pore occupancy <40% | Not enough library was loaded on the flow cell | Ensure you load the recommended amount of good quality library in the relevant library prep protocol onto your flow cell. Please quantify the library before loading and calculate mols using tools like the Promega Biomath Calculator, choosing "dsDNA: µg to pmol" |
Pore occupancy close to 0 | The Ligation Sequencing Kit was used, and sequencing adapters did not ligate to the DNA | Make sure to use the NEBNext Quick Ligation Module (E6056) and Oxford Nanopore Technologies Ligation Buffer (LNB, provided in the sequencing kit) at the sequencing adapter ligation step, and use the correct amount of each reagent. A Lambda control library can be prepared to test the integrity of the third-party reagents. |
Pore occupancy close to 0 | The Ligation Sequencing Kit was used, and ethanol was used instead of LFB or SFB at the wash step after sequencing adapter ligation | Ethanol can denature the motor protein on the sequencing adapters. Make sure the LFB or SFB buffer was used after ligation of sequencing adapters. |
Pore occupancy close to 0 | No tether on the flow cell | Tethers are adding during flow cell priming (FLT/FCT tube). Make sure FLT/FCT was added to FB/FCF before priming. |
Longitud de lectura más corta de lo esperado
Observación | Posible causa | Comentarios y acciones recomendadas |
---|---|---|
Longitud de lectura más corta de lo esperado | Fragmentación no deseada de la muestra de ADN | La longitud de lectura refleja la longitud del fragmento de la muestra de ADN. La muestra de ADN se puede fragmentar durante la extracción de la preparación de la biblioteca. 1. Consulte la sección de buenas prácticas de los métodos de extracción en la página Extraction Methods de la comunidad Nanopore. 2. Visualizar la distribución de la longitud de los fragmentos de las muestras de ADN en un gel de agarosa antes de proceder a la preparación de la biblioteca. En la imagen superior, la muestra 1 contiene alto peso molecular, mientras que la muestra 2 se ha fragmentado. 3. Durante la preparación de la biblioteca, evitar pipetear y agitar en vórtex cuando se mezclen los reactivos. Dar suaves golpes con el dedo o invertir el vial es suficiente. |
Gran proporción de poros no disponibles
Observación | Posible causa | Comentarios y acciones recomendadas |
---|---|---|
Gran proporción de poros no disponibles (se muestran en azul oscuro en el panel de canales y en el gráfico de actividad de poros) Conforme pasa el tiempo, el gráfico de actividad de poros de arriba muestra una proporción creciente de poros no disponibles. | Hay contaminantes presentes en la muestra | Algunos contaminantes se pueden eliminar de los poros mediante la función de desbloqueo incorporada en MinKNOW. Si funciona, el estado de los poros cambiará a "sequencing pores" (secuenciación de poros). Si la porción poros no disponibles se mantiene elevada o aumenta, pruebe una de las siguientes opciones: 1. Realizar un enjuague de nucleasa con el kit de lavado Flow Cell Wash Kit (EXP-WSH004) 2. Realizar varios ciclos de PCR para intentar diluir cualquier contaminante que pueda estar causando problemas. |
Gran proporción de poros inactivos
Observación | Posible causa | Comentarios y acciones recomendadas |
---|---|---|
Gran proporción de poros inactivos/no disponibles (se muestran en azul claro en el panel de canales y en el gráfico de actividad de poros. Los poros o membranas están dañados de manera irreversible) | Se han introducido burbujas de aire en la celda de flujo | Las burbujas de aire introducidas durante el cebado de la celda y la carga de la biblioteca pueden dañar los poros de forma permanente. Para conocer las buenas prácticas de cebado y carga de la celda de flujo, ver el vídeo Priming and loading your flow cell |
Gran proporción de poros inactivos/no disponibles | Ciertos compuestos copurificados con ADN | Compuestos conocidos, incluidos los polisacáridos, se asocian generalmente con el ADN genómico de las plantas. 1. Consulte la página Plant leaf DNA extraction method. 2. Limpiar usando el kit QIAGEN PowerClean Pro. 3. Realizar una amplificación del genoma completo con la muestra original de ADNg utilizando el kit QIAGEN REPLI-g. |
Gran proporción de poros inactivos/no disponibles | Hay contaminantes presentes en la muestra | Los efectos de los contaminantes se muestran en la página Contaminants. Probar con un método de extracción alternativo que no provoque el arrastre de contaminantes. |
Reducción de la velocidad de secuenciación y del índice de calidad Qscore en una fase avanzada de la secuenciación
Observación | Posible causa | Comentarios y acciones recomendadas |
---|---|---|
Reducción de la velocidad de secuenciación y el índice de calidad Qscore en una fase avanzada de la secuenciación | En la química del kit 9 (p. ej., SQK-LSK109), cuando la celda de flujo está sobrecargada con la biblioteca se observa un consumo rápido de combustible (consulte el protocolo correspondiente a su biblioteca de ADN para ver las recomendaciones) | Añadir más combustible a la celda de flujo, siguiendo las instrucciones en el protocolo de MinKNOW. En futuros experimentos, cargar cantidades menores de biblioteca en la celda de flujo. |
Fluctuación de la temperatura
Observación | Posible causa | Comentarios y acciones recomendadas |
---|---|---|
Fluctuación de la temperatura | La celda de flujo ha perdido contacto con el dispositivo | Comprobar que una almohadilla térmica cubra la placa metálica de la parte posterior de la celda de flujo. Reinsertar la celda de flujo y presionar para asegurarse de que las clavijas del conector estén bien conectadas al dispositivo. Si el problema continúa, contacte con el servicio de asistencia técnica. |
Error al intentar alcanzar la temperatura deseada
Observación | Posible causa | Comentarios y acciones recomendadas |
---|---|---|
MinKNOW muestra el mensaje "Error al intentar alcanzar la temperatura deseada" | El dispositivo ha sido colocado en un lugar a una temperatura ambiente inferior a la media o en un lugar con escasa ventilación (lo que provoca el sobrecalientamiento de las celdas de flujo). | MinKNOW tiene un tiempo predeterminado para que las celdas de flujo alcancen la temperatura fijada. Una vez transcurrido ese tiempo, aparece un mensaje de error, pero el experimento de secuenciación continua. Secuenciar a una temperatura incorrecta puede llevar a una disminución en el rendimiento y a generar un índice de calidad Qscore menor. Corrija la ubicación del dispositivo, procure que esté a temperatura ambiente y tenga buena ventilación; a continuación, reinicie el proceso en MinKNOW. Encontrará más información sobre el control de temperatura del MinION en este enlace. |
Guppy – no input .fast5 was found or basecalled
Observation | Possible cause | Comments and actions |
---|---|---|
No input .fast5 was found or basecalled | input_path did not point to the .fast5 file location | The --input_path has to be followed by the full file path to the .fast5 files to be basecalled, and the location has to be accessible either locally or remotely through SSH. |
No input .fast5 was found or basecalled | The .fast5 files were in a subfolder at the input_path location | To allow Guppy to look into subfolders, add the --recursive flag to the command |
Guppy – no Pass or Fail folders were generated after basecalling
Observation | Possible cause | Comments and actions |
---|---|---|
No Pass or Fail folders were generated after basecalling | The --qscore_filtering flag was not included in the command | The --qscore_filtering flag enables filtering of reads into Pass and Fail folders inside the output folder, based on their strand q-score. When performing live basecalling in MinKNOW, a q-score of 7 (corresponding to a basecall accuracy of ~80%) is used to separate reads into Pass and Fail folders. |
Guppy – unusually slow processing on a GPU computer
Observation | Possible cause | Comments and actions |
---|---|---|
Unusually slow processing on a GPU computer | The --device flag wasn't included in the command | The --device flag specifies a GPU device to use for accelerate basecalling. If not included in the command, GPU will not be used. GPUs are counted from zero. An example is --device cuda:0 cuda:1, when 2 GPUs are specified to use by the Guppy command. |