PCR tiling of SARS-CoV-2 virus - Rapid Barcoding Kit 96 V14 and Midnight RT PCR Expansion (SQK-RBK114.96 and EXP-MRT001)

Oxford Nanopore Technologies
Document type icon

MinION: Protocol

PCR tiling of SARS-CoV-2 virus - Rapid Barcoding Kit 96 V14 and Midnight RT PCR Expansion (SQK-RBK114.96 and EXP-MRT001) V MRT_9186_v114_revG_17Aug24

  • This protocol uses extracted RNA samples
  • Includes reverse transcription and tiled PCR amplification
  • For multiplexing 1-96 samples
  • Library preparation time ~315 minutes
  • Fragmentation
  • Compatible with R10.4.1 flow cells

For Research Use Only

This is an Early Access product For more information about our Early Access programmes, please see this article on product release phases.

FOR RESEARCH USE ONLY

Descripción general

  • This protocol uses extracted RNA samples
  • Includes reverse transcription and tiled PCR amplification
  • For multiplexing 1-96 samples
  • Library preparation time ~315 minutes
  • Fragmentation
  • Compatible with R10.4.1 flow cells

For Research Use Only

This is an Early Access product For more information about our Early Access programmes, please see this article on product release phases.

Document version: MRT_9186_v114_revG_17Aug24

1. Overview of the protocol

IMPORTANTE

This protocol is a work in progress and some details are expected to change over time. Please make sure you always use the most recent version of the protocol.

The PCR tiling of SARS-CoV-2 virus with Rapid Barcoding Kit 96 V14 and Midnight RT PCR Expansion (SQK-RBK114.96 and EXP-MRT001) protocol is an updated version of the PCR tiling of SARS-CoV-2 virus with rapid barcoding and Midnight RT PCR Expansion (SQK-RBK110.96 and EXP-MRT001) using our most recent Kit 14 chemistry and an updated downstream analysis.

Introduction to the protocol

To enable support for the rapidly expanding user requests, the team at Oxford Nanopore Technologies have put together an updated workflow based on the ARTIC Network protocols and analysis methods. The protocol uses Oxford Nanopore Technologies' Rapid Barcoding Kit 96 V14 (SQK-RBK114.96) and Midnight RT PCR Expansion (EXP-MRT001) for barcoding and library preparation.

While this protocol is available in the Nanopore Community, we kindly ask users to ensure they are citing the members of the ARTIC network who have been behind the development of these methods.

This protocol is similar to the ARTIC amplicon sequencing protocol for MinION for SARS-CoV-2 v3 (LoCost) by Josh Quick and the method used in Freed et al., 2020. The protocol generates amplicons in a tiled fashion across the whole SARS-CoV-2 genome.

To generate tiled PCR amplicons from the SARS-CoV-2 viral cDNA for use with the Rapid Barcoding Kit 96 V14 (SQK-RBK114.96), primers were designed by Freed et al., 2020 using Primal Scheme. These primers are in the Midnight RT PCR Expansion (EXP-MRT001) and are designed to generate 1.2 kb amplicons. Primer sequences can be found here.

As mutations in SARS-CoV-2 variants emerge amplicon drop out may be observed; for users wishing to design their own primer spike-ins to address this we suggest adding to the appropriate primer pool at a final concentration between 3.33 µM and 6.66 µM.

Steps in the sequencing workflow:

Prepare for your experiment you will need to:

  • Extract your RNA
  • Ensure you have your sequencing kit, the correct equipment and reagents
  • Download the software for acquiring and analysing your data
  • Check your flow cell to ensure it has enough pores for a good sequencing run

Prepare your library You will need to:

  • Reverse transcribe your RNA samples with random hexamers
  • Amplify the samples by tiled PCR using separate primer pools
  • Combine the primer pools
  • Attach Rapid Barcodes supplied in the kit to the DNA ends, pool the samples and SPRI purify
  • Prime the flow cell and load your DNA library into the flow cell

ARTIC SQK-RBK110.96 96 samples spike-seq (3)

Sequencing and analysis You will need to:

  • Start a sequencing run using the MinKNOW software, selecting SQK-RBK114.96 in kit selection, which will collect raw data from the device and convert it into basecalled reads
  • (Optional): Perform downstream analysis of the data using the wf-artic analysis workflow integrated within the EPI2ME Labs application

Before starting

This protocol outlines how to carry out PCR tiling of SARS-CoV-2 viral RNA samples on a 96-well plate using the Rapid Barcoding Kit 96 V14 (SQK-RBK114.96) with the Midnight RT PCR Expansion (EXP-MRT001).

It is required to use total RNA extracted from samples that have been screened by a suitable qPCR assay.

When processing multiple samples at once, we recommend making master mixes with an additional 10% of the volume. We also recommend using a template-free pre-PCR hood for making up the master mixes, and a separate template pre-PCR hood for handling the samples. It is important to clean and/or UV irradiate these hoods between sample batches. Furthermore, to track and monitor cross-contamination events, it is important to run a negative control reaction at the reverse transcription stage using nuclease-free water instead of sample, and carrying this control through the rest of the prep.

All post-PCR procedures must be carried out in a separate area to the pre-PCR preparation, with dedicated equipment for liquid handling in each area.

IMPORTANTE

Compatibility of this protocol

This protocol should only be used in combination with:

  • Rapid Barcoding Kit 96 V14 (SQK-RBK114.96)
  • Midnight RT PCR Expansion (EXP-MRT001)
  • R10.4.1 flow cells (FLO-MIN114)
  • Flow Cell Wash Kit (EXP-WSH004)

2. Equipment and consumables

Material
  • Input RNA in 10 mM Tris-HCl, pH 8.0
  • Rapid Barcoding Kit 96 V14 (SQK-RBK114.96)
  • Midnight RT PCR Expansion (EXP-MRT001)
Consumibles
  • Nuclease-free water (e.g. ThermoFisher, AM9937)
  • Etanol al 80 % recién preparado con agua sin nucleasas
  • Qubit dsDNA HS Assay Kit (Invitrogen Q32851) (kit de ensayo ADNbc alta sensibilidad)
  • Tubos de ensayo Qubit™ (Invitrogen Q32856)
  • 1.5 ml Eppendorf DNA LoBind tubes
  • 2 ml Eppendorf DNA LoBind tubes
  • 5 ml Eppendorf DNA LoBind tubes
  • Eppendorf twin.tec® PCR plate 96 LoBind, semi-skirted (Cat # 0030129504) with PCR seals
  • (Opcional) Seroalbúmina bovina (BSA) (50 mg/ml) (p. ej., Invitrogen™ UltraPure™ BSA 50 mg/ml, AM2616)
Instrumental
  • Mezclador Hula (mezclador giratorio suave)
  • Gradilla magnética
  • Centrifuge capable of taking 96-well plates
  • Microfuge
  • Mezclador vórtex
  • Termociclador
  • Multichannel pipettes suitable for dispensing 0.5–10 μl, 2–20 μl and 20–200 μl, and tips
  • Pipeta y puntas P1000
  • Pipeta y puntas P200
  • Pipeta y puntas P100
  • Pipeta y puntas P20
  • Pipeta y puntas P10
  • Cubeta con hielo
  • Temporizador
  • Qubit fluorometer (or equivalent)
Equipo opcional
  • Centrifuga Eppendorf 5424 (o equivalente)
  • PCR hood with UV steriliser (optional but recommended to reduce cross-contamination)
  • PCR-Cooler (Eppendorf)
  • Stepper pipette and tips

For this protocol, you will need your extracted RNA in 8 µl 10 mM Tris-HCl, pH 8.0.

IMPORTANTE

The Rapid Adapter (RA) used in this kit and protocol is not interchangeable with other sequencing adapters.

Rapid Barcoding Kit 96 V14 (SQK-RBK114.96) contents

RBK114.96 tubes (1)

Name Acronym Cap colour No. of vials Fill volume per vial (µl)
Rapid Adapter RA Green 2 15
Adapter Buffer ADB Clear 1 100
AMPure XP Beads AXP Amber 3 1,200
Elution Buffer EB Black 1 1,500
Sequencing Buffer SB Red 1 1,700
Library Beads LIB Pink 1 1,800
Library Solution LIS White cap, pink label 1 1,800
Flow Cell Flush FCF Clear 1 15,500
Flow Cell Tether FCT Purple 2 200
Rapid Barcodes RB01-96 - 3 plates 8 µl per well

This Product Contains AMPure XP Reagent Manufactured by Beckman Coulter, Inc. and can be stored at -20°C with the kit without detriment to reagent stability.

Midnight RT PCR Expansion (EXP-MRT001) contents

EXP-MRT001 1

Name Acronym Cap colour Number of vials Fill volume per vial (µl)
LunaScript RT SuperMix LS RT Blue 3 500
Q5 HS Master Mix Q5 Orange 6 1,500
Midnight Primer Pool A MP A White 3 15
Midnight Primer Pool B MP B Clear 3 15

Midnight Primer sequences

As mutations in SARS-CoV-2 variants emerge amplicon drop out may be observed; for users wishing to design their own primer spike-ins to address this we suggest adding to the appropriate primer pool at a final concentration between 3.33 µM and 6.66 µM.

Below are the sequences for the V3 primer scheme used in the Midnight RT PCR Expansion.

Pool A

Primer name Primer Sequence
SARSCoV_1200_1_LEFT ACCAACCAACTTTCGATCTCTTGT
SARSCoV_1200_1_RIGHT GGTTGCATTCATTTGGTGACGC
SARSCoV_1200_3_LEFT GGCTTGAAGAGAAGTTTAAGGAAGGT
SARSCoV_1200_3_RIGHT GATTGTCCTCACTGCCGTCTTG
SARSCoV_1200_5_LEFT ACCTACTAAAAAGGCTGGTGGC
SARSCoV_1200_5_RIGHT AGCATCTTGTAGAGCAGGTGGA
SARSCoV_1200_7_LEFT ACCTGGTGTATACGTTGTCTTTGG
SARSCoV_1200_7_RIGHT GCTGAAATCGGGGCCATTTGTA
SARSCoV_1200_9_LEFT AGAAGTTACTGGCGATAGTTGTAATAACT
SARSCoV_1200_9_RIGHT TGCTGATATGTCCAAAGCACCA
SARSCoV_1200_11_LEFT AGACACCTAAGTATAAGTTTGTTCGCA
SARSCoV_1200_11_RIGHT GCCCACATGGAAATGGCTTGAT
SARSCoV_1200_13_LEFT ACCTCTTACAACAGCAGCCAAAC
SARSCoV_1200_13_RIGHT CGTCCTTTTCTTGGAAGCGACA
SARSCoV_1200_15_LEFT TTTTAAGGAATTACTTGTGTATGCTGCT
SARSCoV_1200_15_RIGHT ACACACAACAGCATCGTCAGAG
SARSCoV_1200_17_LEFT TCAAGCTTTTTGCAGCAGAAACG
SARSCoV_1200_17_RIGHT CCAAGCAGGGTTACGTGTAAGG
SARSCoV_1200_19_LEFT GGCACATGGCTTTGAGTTGACA
SARSCoV_1200_19_RIGHT CCTGTTGTCCATCAAAGTGTCCC
SARSCoV_1200_21_LEFT TCTGTAGTTTCTAAGGTTGTCAAAGTGA
SARSCoV_1200_21_RIGHT GCAGGGGGTAATTGAGTTCTGG
21_right_spike GTGTATGATTGAGTTCTGGTTGTAAG
SARSCoV_1200_23_LEFT ACTTTAGAGTCCAACCAACAGAATCT
23_left_spike ACTTTAGAGTTCAACCAACAGAATCT
SARSCoV_1200_23_RIGHT TGACTAGCTACACTACGTGCCC
SARSCoV_1200_25_LEFT TGCTGCTACTAAAATGTCAGAGTGT
SARSCoV_1200_25_RIGHT CATTTCCAGCAAAGCCAAAGCC
SARSCoV_1200_27_LEFT TGGATCACCGGTGGAATTGCTA
SARSCoV_1200_27_RIGHT TGTTCGTTTAGGCGTGACAAGT
SARSCoV_1200_29_LEFT TGAGGGAGCCTTGAATACACCA
SARSCoV_1200_29_RIGHT TAGGCAGCTCTCCCTAGCATTG

Pool B

Primer name Primer sequences
SARSCoV_1200_2_LEFT CCATAATCAAGACTATTCAACCAAGGGT
SARSCoV_1200_2_RIGHT ACAGGTGACAATTTGTCCACCG
SARSCoV_1200_4_LEFT GGAATTTGGTGCCACTTCTGCT
SARSCoV_1200_4_RIGHT CCTGACCCGGGTAAGTGGTTAT
SARSCoV_1200_6_LEFT ACTTCTATTAAATGGGCAGATAACAACTG
SARSCoV_1200_6_RIGHT GATTATCCATTCCCTGCGCGTC
SARSCoV_1200_8_LEFT CAATCATGCAATTGTTTTTCAGCTATTTTG
SARSCoV_1200_8_RIGHT TGACTTTTTGCTACCTGCGCAT
SARSCoV_1200_10_LEFT TTTACCAGGAGTTTTCTGTGGTGT
SARSCoV_1200_10_RIGHT TGGGCCTCATAGCACATTGGTA
SARSCoV_1200_12_LEFT ATGGTGCTAGGAGAGTGTGGAC
SARSCoV_1200_12_RIGHT GGATTTCCCACAATGCTGATGC
SARSCoV_1200_14_LEFT ACAGGCACTAGTACTGATGTCGT
SARSCoV_1200_14_RIGHT GTGCAGCTACTGAAAAGCACGT
SARSCoV_1200_16_LEFT ACAACACAGACTTTATGAGTGTCTCT
SARSCoV_1200_16_RIGHT CTCTGTCAGACAGCACTTCACG
SARSCoV_1200_18_LEFT GCACATAAAGACAAATCAGCTCAATGC
SARSCoV_1200_18_RIGHT TGTCTGAAGCAGTGGAAAAGCA
SARSCoV_1200_20_LEFT ACAATTTGATACTTATAACCTCTGGAACAC
SARSCoV_1200_20_RIGHT GATTAGGCATAGCAACACCCGG
SARSCoV_1200_22_LEFT GTGATGTTCTTGTTAACAACTAAACGAACA
SARSCoV_1200_22_RIGHT AACAGATGCAAATCTGGTGGCG
22_right_spike AACAGATGCAAATTTGGTGGCG
SARSCoV_1200_24_LEFT GCTGAACATGTCAACAACTCATATGA
24_left_spike GCTGAATATGTCAACAACTCATATGA
SARSCoV_1200_24_RIGHT ATGAGGTGCTGACTGAGGGAAG
SARSCoV_1200_26_LEFT GCCTTGAAGCCCCTTTTCTCTA
SARSCoV_1200_26_RIGHT AATGACCACATGGAACGCGTAC
SARSCoV_1200_28_LEFT TTTGTGCTTTTTAGCCTTTCTGCT
SARSCoV_1200_28_RIGHT GTTTGGCCTTGTTGTTGTTGGC
SARSCoV_1200_28_LEFT_27837T TTTGTGCTTTTTAGCCTTTCTGTT

Rapid barcode sequences

Component Sequence
RB01 AAGAAAGTTGTCGGTGTCTTTGTG
RB02 TCGATTCCGTTTGTAGTCGTCTGT
RB03 GAGTCTTGTGTCCCAGTTACCAGG
RB04 TTCGGATTCTATCGTGTTTCCCTA
RB05 CTTGTCCAGGGTTTGTGTAACCTT
RB06 TTCTCGCAAAGGCAGAAAGTAGTC
RB07 GTGTTACCGTGGGAATGAATCCTT
RB08 TTCAGGGAACAAACCAAGTTACGT
RB09 AACTAGGCACAGCGAGTCTTGGTT
RB10 AAGCGTTGAAACCTTTGTCCTCTC
RB11 GTTTCATCTATCGGAGGGAATGGA
RB12 CAGGTAGAAAGAAGCAGAATCGGA
RB13 AGAACGACTTCCATACTCGTGTGA
RB14 AACGAGTCTCTTGGGACCCATAGA
RB15 AGGTCTACCTCGCTAACACCACTG
RB16 CGTCAACTGACAGTGGTTCGTACT
RB17 ACCCTCCAGGAAAGTACCTCTGAT
RB18 CCAAACCCAACAACCTAGATAGGC
RB19 GTTCCTCGTGCAGTGTCAAGAGAT
RB20 TTGCGTCCTGTTACGAGAACTCAT
RB21 GAGCCTCTCATTGTCCGTTCTCTA
RB22 ACCACTGCCATGTATCAAAGTACG
RB23 CTTACTACCCAGTGAACCTCCTCG
RB24 GCATAGTTCTGCATGATGGGTTAG
RB25 GTAAGTTGGGTATGCAACGCAATG
RB26 CATACAGCGACTACGCATTCTCAT
RB27 CGACGGTTAGATTCACCTCTTACA
RB28 TGAAACCTAAGAAGGCACCGTATC
RB29 CTAGACACCTTGGGTTGACAGACC
RB30 TCAGTGAGGATCTACTTCGACCCA
RB31 TGCGTACAGCAATCAGTTACATTG
RB32 CCAGTAGAAGTCCGACAACGTCAT
RB33 CAGACTTGGTACGGTTGGGTAACT
RB34 GGACGAAGAACTCAAGTCAAAGGC
RB35 CTACTTACGAAGCTGAGGGACTGC
RB36 ATGTCCCAGTTAGAGGAGGAAACA
RB37 GCTTGCGATTGATGCTTAGTATCA
RB38 ACCACAGGAGGACGATACAGAGAA
RB39 CCACAGTGTCAACTAGAGCCTCTC
RB40 TAGTTTGGATGACCAAGGATAGCC
RB41 GGAGTTCGTCCAGAGAAGTACACG
RB42 CTACGTGTAAGGCATACCTGCCAG
RB43 CTTTCGTTGTTGACTCGACGGTAG
RB44 AGTAGAAAGGGTTCCTTCCCACTC
RB45 GATCCAACAGAGATGCCTTCAGTG
RB46 GCTGTGTTCCACTTCATTCTCCTG
RB47 GTGCAACTTTCCCACAGGTAGTTC
RB48 CATCTGGAACGTGGTACACCTGTA
RB49 ACTGGTGCAGCTTTGAACATCTAG
RB50 ATGGACTTTGGTAACTTCCTGCGT
RB51 GTTGAATGAGCCTACTGGGTCCTC
RB52 TGAGAGACAAGATTGTTCGTGGAC
RB53 AGATTCAGACCGTCTCATGCAAAG
RB54 CAAGAGCTTTGACTAAGGAGCATG
RB55 TGGAAGATGAGACCCTGATCTACG
RB56 TCACTACTCAACAGGTGGCATGAA
RB57 GCTAGGTCAATCTCCTTCGGAAGT
RB58 CAGGTTACTCCTCCGTGAGTCTGA
RB59 TCAATCAAGAAGGGAAAGCAAGGT
RB60 CATGTTCAACCAAGGCTTCTATGG
RB61 AGAGGGTACTATGTGCCTCAGCAC
RB62 CACCCACACTTACTTCAGGACGTA
RB63 TTCTGAAGTTCCTGGGTCTTGAAC
RB64 GACAGACACCGTTCATCGACTTTC
RB65 TTCTCAGTCTTCCTCCAGACAAGG
RB66 CCGATCCTTGTGGCTTCTAACTTC
RB67 GTTTGTCATACTCGTGTGCTCACC
RB68 GAATCTAAGCAAACACGAAGGTGG
RB69 TACAGTCCGAGCCTCATGTGATCT
RB70 ACCGAGATCCTACGAATGGAGTGT
RB71 CCTGGGAGCATCAGGTAGTAACAG
RB72 TAGCTGACTGTCTTCCATACCGAC
RB73 AAGAAACAGGATGACAGAACCCTC
RB74 TACAAGCATCCCAACACTTCCACT
RB75 GACCATTGTGATGAACCCTGTTGT
RB76 ATGCTTGTTACATCAACCCTGGAC
RB77 CGACCTGTTTCTCAGGGATACAAC
RB78 AACAACCGAACCTTTGAATCAGAA
RB79 TCTCGGAGATAGTTCTCACTGCTG
RB80 CGGATGAACATAGGATAGCGATTC
RB81 CCTCATCTTGTGAAGTTGTTTCGG
RB82 ACGGTATGTCGAGTTCCAGGACTA
RB83 TGGCTTGATCTAGGTAAGGTCGAA
RB84 GTAGTGGACCTAGAACCTGTGCCA
RB85 AACGGAGGAGTTAGTTGGATGATC
RB86 AGGTGATCCCAACAAGCGTAAGTA
RB87 TACATGCTCCTGTTGTTAGGGAGG
RB88 TCTTCTACTACCGATCCGAAGCAG
RB89 ACAGCATCAATGTTTGGCTAGTTG
RB90 GATGTAGAGGGTACGGTTTGAGGC
RB91 GGCTCCATAGGAACTCACGCTACT
RB92 TTGTGAGTGGAAAGATACAGGACC
RB93 AGTTTCCATCACTTCAGACTTGGG
RB94 GATTGTCCTCAAACTGCCACCTAC
RB95 CCTGTCTGGAAGAAGAATGGACTT
RB96 CTGAACGGTCATAGAGTCCACCAT

3. Computer requirements and software

Requisitos informáticos para el MinION Mk1B

Para secuenciar con el MinION Mk1B es necesario tener un ordenador o portátil de alto rendimiento, que pueda soportar la velocidad de adquisición de datos. Encontrará más información en el documento MinION Mk1B IT Requirements.

Requisitos informáticos para el MinION Mk1C

El MinION Mk1C contiene ordenador y pantalla integrados, lo que elimina la dependencia de cualquier accesorio para generar y analizar datos de nanoporos. Encontrará más información en el documento MinION Mk1C IT Requirements.

Software for nanopore sequencing

MinKNOW

The MinKNOW software controls the nanopore sequencing device, collects sequencing data and basecalls in real time. You will be using MinKNOW for every sequencing experiment to sequence, basecall and demultiplex if your samples were barcoded.

For instructions on how to run the MinKNOW software, please refer to the MinKNOW protocol.

EPI2ME (optional)

The EPI2ME cloud-based platform performs further analysis of basecalled data, for example alignment to the Lambda genome, barcoding, or taxonomic classification. You will use the EPI2ME platform only if you would like further analysis of your data post-basecalling.

For instructions on how to create an EPI2ME account and install the EPI2ME Desktop Agent, please refer to the EPI2ME Platform protocol.

Verificar la celda de flujo

Antes de empezar el experimento de secuenciación, recomendamos verificar el número de poros disponibles, presentes en la celda de flujo. La comprobación deberá realizarse en las primeras 12 semanas desde su adquisición, si se trata de celdas de flujo MinION, GridION o PromethION, y en las primeras cuatro semanas tras la compra de celdas de flujo Flongle. Oxford Nanopore Technologies sustituirá cualquier celda de flujo con un número de poros inferior al indicado en la tabla siguiente, siempre y cuando el resultado se notifique dentro de los dos días siguientes a la comprobación y se hayan seguido las instrucciones de almacenamiento. Para verificar la celda de flujo, siga las instrucciones del documento Flow Cell Check.

Celda de flujo Número mínimo de poros activos cubierto por la garantía
Flongle 50
MinION/GridION 800
PromethION 5000

4. Reverse transcription

Material
  • Input RNA in 10 mM Tris-HCl, pH 8.0
  • LunaScript RT SuperMix (LS RT)
Consumibles
  • Nuclease-free water (e.g. ThermoFisher, AM9937)
  • Eppendorf twin.tec® PCR plate 96 LoBind, semi-skirted (Cat # 0030129504) with PCR seals
Instrumental
  • Multichannel pipettes suitable for dispensing 0.5–10 μl, 2–20 μl and 20–200 μl, and tips
  • Termociclador
  • Centrifuge capable of taking 96-well plates
  • Cubeta con hielo
Equipo opcional
  • PCR-Cooler (Eppendorf)
  • PCR hood with UV steriliser (optional but recommended to reduce cross-contamination)
  • Stepper pipette and tips
IMPORTANTE

Keep the RNA sample on ice as much as possible to prevent nucleolytic degradation, which may affect sensitivity.

In a clean pre-PCR hood, place a fresh 96-well plate (RT plate) into a PCR Cooler (if using). Using a stepper pipette, or multichannel pipette, add 2 µl of LunaScript RT SuperMix (LS RT) per well.

Depending on the number of samples, fill each well per column as follows:

Plate location X24 samples X48 samples X96 samples
Columns 1-3 1-6 1-12

RT plate prep

To each well containing LunaScript RT SuperMix (LS RT), add 8 µl of sample and gently mix by pipetting. If adding less than 8 µl, make up the rest of the volume with nuclease-free water.

Example for X48 samples: RT plate x48 small

IMPORTANTE

We recommend having a negative control and a positive control for every plate of samples.

Seal the RT plate and spin down.

Incubate the samples in the thermal cycler using the following program:

Step Temperature Time Cycles
Primer annealing 25°C 2 min 1
cDNA synthesis 55°C 10 min 1
Heat inactivation 95°C 1 min 1
Hold 4°C ∞
FIN DEL PROCESO

While the reverse transcription reaction is running, prepare the master mixes as described in the next section.

5. PCR

Material
  • Q5 HS Master Mix (Q5)
  • Midnight Primer Pool A (MP A)
  • Midnight Primer Pool B (MP B)
Consumibles
  • Nuclease-free water (e.g. ThermoFisher, AM9937)
  • 1.5 ml Eppendorf DNA LoBind tubes
  • Eppendorf twin.tec® PCR plate 96 LoBind, semi-skirted (Cat # 0030129504) with PCR seals
Instrumental
  • Multichannel pipettes suitable for dispensing 0.5–10 μl, 2–20 μl and 20–200 μl, and tips
  • P1000 pipette and tips
  • Pipeta y puntas P200
  • Termociclador
  • Microfuge
  • Centrifuge capable of taking 96-well plates
  • Cubeta con hielo
Equipo opcional
  • PCR-Cooler (Eppendorf)
  • PCR hood with UV steriliser (optional but recommended to reduce cross-contamination)
  • Stepper pipette and tips

Primer design

To generate tiled PCR amplicons from the SARS-CoV-2 viral cDNA, primers were designed by Freed et al., 2020 using Primal Scheme. These primers are designed to generate 1200 bp amplicons that overlap by approximately 20 bp. These primer sequences can be found here.

IMPORTANTE

We recommend handling the primers in a clean template-free PCR hood.

In the template-free pre-PCR hood, prepare the following master mixes in Eppendorf DNA LoBind tubes and mix thoroughly as follows:

Volume per sample:

Reagent Pool A Pool B
Nuclease-free water 3.7 µl 3.7 µl
Midnight Primer Pool A (MP A) 0.05 µl -
Midnight Primer Pool B (MP B) - 0.05 µl
Q5 HS Master Mix (Q5) 6.25 µl 6.25 µl
Total 10 µl 10 µl

For x24 samples:

Reagent Pool A Pool B
Nuclease-free water 102 µl 102 µl
Midnight Primer Pool A (MP A) 2 µl -
Midnight Primer Pool B (MP B) - 2 µl
Q5 HS Master Mix (Q5) 172 µl 172 µl
Total 276 µl 276 µl

For x48 samples:

Reagent Pool A Pool B
Nuclease-free water 203 µl 203 µl
Midnight Primer Pool A (MP A) 3 µl -
Midnight Primer Pool B (MP B) - 3 µl
Q5 HS Master Mix (Q5) 344 µl 344 µl
Total 550 µl 550 µl

For x96 samples:

Reagent Pool A Pool B
Nuclease-free water 407 µl 407 µl
Midnight Primer Pool A (MP A) 6 µl -
Midnight Primer Pool B (MP B) - 6 µl
Q5 HS Master Mix (Q5) 687 µl 687 µl
Total 1,100 µl 1,100 µl

Using a stepper pipette or a multichannel pipette, aliquot 10 µl of Pool A and Pool B into a clean 96-well plate(s) as follows:

Plate location X24 samples X48 samples X96 samples
Columns Pool A: 1-3
Pool B: 4-6		 Pool A: 1-6
Pool B: 7-12		 Pool A: 1-12
Pool B: 1-12

Note: For X96 samples, Pool A is a separate plate to Pool B.

Primer pools 1

Using a multichannel pipette, transfer 2.5 μl of each RT reaction from the RT plate to the corresponding well for both Pool A and Pool B in the PCR plate(s), taking care not to cross-contaminate different wells. Mix by pipetting the contents of each well up and down.

There should be two PCR reactions per sample.

Example for X48 samples: PCR x48 small

Mix by pipetting the contents of each well up and down.

IMPORTANTE

Carry forward the negative control from the reverse transcription reaction to monitor cross-contamination events.

We recommend having a negative control and a positive control for every plate of samples.

Seal the plate(s) and spin down briefly.

Incubate using the following program, with the heated lid set to 105°C:

Step Temperature Time Cycles
Initial denaturation 98°C 30 sec 1
Denaturation

Annealing and extension		 98°C

61°C
65°C		 15 sec

2 min
3 min
35
Hold 4°C ∞
MEDIDA OPCIONAL

If necessary, the protocol can be paused at this point. The samples should be kept at 4°C and can be stored overnight.

6. Addition of rapid barcodes

Material
  • Rapid Barcode Plate (RB01-96)
Consumibles
  • Nuclease-free water (e.g. ThermoFisher, AM9937)
  • Eppendorf twin.tec® PCR plate 96 LoBind, semi-skirted (Cat # 0030129504) with PCR seals
Instrumental
  • Multichannel pipettes suitable for dispensing 2–20 μl and 20–200 μl, and tips
  • Termociclador
  • Centrifuge capable of taking 96-well plates

Spin down the Rapid Barcode Plate and PCR reactions prior to opening to collect material in the bottom of the wells.

Using a multichannel pipette or stepper pipette, transfer 2.5 μl nuclease-free water to the wells of a fresh 96-well plate (Barcode Attachment Plate).

Depending on the number of samples, aliquot into each well of the columns as follows:

Plate location X24 samples X48 samples X96 samples
Columns 1-3 1-6 1-12

Barcode attachment plate prep

Using a multichannel pipette, transfer the entire contents of each well of PCR Pool B to the corresponding well of PCR Pool A and mix by pipetting.

Depending on the number of samples, Pool B columns will correspond to different Pool A columns.

No. of samples Pool B column Corresponding Pool A column
X24 4
5
6		 1
2
3
X48 7
8
9
10
11
12		 1
2
3
4
5
6
X96 1
2
3
4
5
6
7
8
9
10
11
12		 1
2
3
4
5
6
7
8
9
10
11
12

Example for X48 samples: PCR pools x48 small

Using a multichannel pipette, transfer 5 µl from each well of PCR Pool A (now containing pooled PCR products) to the corresponding well of the Barcode Attachment Plate and mix by pipetting.

Depending on the number of samples, PCR Pool A will be in each well of the following columns:

Plate location X24 samples X48 samples X96 samples
Columns 1-3 1-6 1-12

Example for X48 samples: Barcode attachment plate x48 small

Using a multichannel pipette, transfer 2.5 μl from the Rapid Barcode Plate to the corresponding well of the Barcode Attachment Plate, taking care not to cross-contaminate different wells. Mix by pipetting.

Depending on the number of samples, aliquot into each well of the columns as follows:

Plate location X24 samples X48 samples X96 samples
Columns 1-3 1-6 1-12

Example for X48 samples: Rapid barcode plate x48 small

IMPORTANTE

Samples must be thoroughly mixed.

Seal the Barcode Attachment Plate and spin down.

Incubate the plate in a thermal cycler at 30°C for 2 minutes and then at 80°C for 2 minutes.

7. Pooling samples and clean-up

Material
  • AMPure XP Beads (AXP) (microesferas magnéticas)
  • Elution Buffer from the Oxford Nanopore kit (EB)
  • Rapid Adapter (RA)
  • Adapter Buffer (ADB)
Consumibles
  • Etanol al 80 % recién preparado con agua sin nucleasas
  • 1.5 ml Eppendorf DNA LoBind tubes
  • 5 ml Eppendorf DNA LoBind tubes
  • Qubit dsDNA HS Assay Kit (Invitrogen Q32851) (kit de ensayo ADNbc alta sensibilidad)
  • Tubos de ensayo Qubit™ (Invitrogen Q32856)
Instrumental
  • Microfuge
  • Centrifuge capable of taking 96-well plates
  • Mezclador Hula (mezclador giratorio suave)
  • Gradilla magnética
  • Cubeta con hielo
  • P1000 pipette and tips
  • Pipeta y puntas P200
  • Pipeta y puntas P20
  • Pipeta y puntas P10
  • Qubit fluorometer plate reader (or equivalent for QC check)

Briefly spin down the Barcode Attachment Plate to collect the liquid at the bottom of the wells prior to opening.

Pool the barcoded samples in a 1.5 ml Eppendorf DNA LoBind tube.

We expect to have about ~10 µl per sample.

X24 samples X48 samples X96 samples
Total volume ~240 µl ~480 µl ~960 µl

Mix pooled samples by vortexing.

IMPORTANTE

Pooled barcoded samples must be thoroughly mixed.

Transfer half of the barcoded pooled sample to a clean 1.5 ml Eppendorf DNA LoBind tube.

Per sample, we expect to take forward ~5 µl.

X24 samples X48 samples X96 samples
Example volume 120 µl 240 µl 480 µl

Resuspend the AMPure XP Beads (AXP) by vortexing.

To the pooled barcoded sample, add an equal volume of resuspended AMPure XP Beads (AXP, or SPRI) and mix by pipetting.

Example volume X24 samples X48 samples X96 samples
Volume of 1X AXP 120 µl 240 µl 480 µl

Incubar en el mezclador Hula (o mezclador giratorio suave) durante 5 minutos a temperatura ambiente.

Prepare at least 3 ml of fresh 80% ethanol in nuclease-free water.

Centrifugar la muestra y precipitar en un imán. Dejar el tubo en el imán y retirar el sobrenadante con una pipeta.

Keep the tube on the magnet and wash the beads with 1 ml of freshly-prepared 80% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.

Repeat the previous step.

Briefly spin down and place the tube back on the magnet. Pipette off any residual ethanol. Allow to dry for 30 seconds, but do not dry the pellet to the point of cracking.

Remove the tube from the magnetic rack and resuspend the pellet by pipetting in 15 µl Elution Buffer (EB). Incubate for 10 minutes at room temperature.

Pellet the beads on a magnet until the eluate is clear and colourless.

Remove and retain 15 µl of eluate containing the DNA library into a clean 1.5 ml Eppendorf DNA LoBind tube.

CHECKPOINT

Quantify DNA concentration by using the Qubit dsDNA HS Assay Kit.

Take forward 11 µl of your eluted DNA library.

In a fresh 1.5 ml Eppendorf DNA LoBind tube, dilute the Rapid Adapter (RA) as follows and pipette mix:

Reagent Volume
Rapid Adapter (RA) 1.5 μl
Adapter Buffer (ADB) 3.5 μl
Total 5 μl

Add 1 µl of the diluted Rapid Adapter (RA) to the barcoded DNA.

Mix gently by flicking the tubes, and spin down.

Incubate the reaction for 5 minutes at room temperature.

FIN DEL PROCESO

The prepared library is used for loading into the flow cell. Store the library on ice until ready to load.

8. Priming and loading the SpotON flow cell

Material
  • Flow Cell Flush (FCF)
  • Flow Cell Tether (FCT) (anclaje de celda de flujo)
  • Library Solution (LIS)
  • Library Beads (LIB) (microesferas de carga de la biblioteca)
  • Sequencing Buffer (SB)
Consumibles
  • Tubos de 1,5 ml Eppendorf DNA LoBind
  • Celda de flujo MinION/GridION
  • Agua sin nucleasas (p. ej., ThermoFisher AM9937)
  • (Opcional) Seroalbúmina bovina (BSA) (50 mg/ml) (p. ej., Invitrogen™ UltraPure™ BSA 50 mg/ml, AM2616)
Instrumental
  • Dispositivo MinION o GridION
  • Pantalla protectora celdas de flujo MinION/GridION
  • Pipeta y puntas P1000
  • Pipeta y puntas P100
  • Pipeta y puntas P20
  • Pipeta y puntas P10
IMPORTANTE

Nótese, este kit es compatible solo con las celdas de flujo R10.4.1 (FLO-MIN114).

CONSEJO

Cebado y carga de la celda de flujo

Se recomienda a los nuevos usuarios que miren el vídeo Priming and loading your flow cell antes de realizar su primer experimento.

Uso de Library Solution (LIS)

En la mayoría de experimentos de secuenciación, recomendamos usar Library Beads (LIB) para cargar la biblioteca en la celda de flujo. Nótese, si previamente se ha usado agua para cargar la biblioteca, se deberá usar Library Solution (LIS) en su lugar. Nota: Algunos clientes han notado que las bibliotecas viscosas pueden cargarse con mayor facilidad cuando no se usan Library Beads (LIB).

Descongelar los viales Sequencing Buffer (SB), Library Beads (LIB) o Library Solution (LIS), -si se requiere-, y un tubo de Flow Cell Flush (FCF) a temperatura ambiente. Agitar en vórtex, centrifugar y colocar en hielo.

IMPORTANTE

Para obtener un rendimiento de secuenciación óptimo y mejorar el rendimiento de las celdas de flujo MinION R10.4.1 (FLO-MIN114), recomendamos añadir seroalbúmina bovina (BSA), en una concentración total de 0,2 mg/ml, a la mezcla de cebado de la celda de flujo.

Nota: No se aconseja utilizar ningún otro tipo de albúmina (p. ej., seroalbúmina humana recombinante).

Prepare the flow cell priming mix with BSA in a suitable tube for the number of flow cells to flush. Once combined, mix well by pipette mixing.

Reagents Volume per flow cell
Flow Cell Flush (FCF) 1,170 µl
Bovine Serum Albumin (BSA) at 50 mg/ml 5 µl
Flow Cell Tether (FCT) 30 µl
Total volume 1,205 µl

Abrir la tapa del dispositivo MinION o GridION y deslizar la celda de flujo debajo del clip. Presionar la celda de flujo con firmeza para asegurar un contacto eléctrico y térmico adecuados.

Flow Cell Loading Diagrams Step 1a

Flow Cell Loading Diagrams Step 1b

MEDIDA OPCIONAL

Antes de cargar la biblioteca, verifique la celda de flujo para determinar el número de poros disponible.

Si se ha verificado con anterioridad la cantidad de poros presentes en la celda de flujo, este paso se puede omitir.

Dispone de más información en las instrucciones de comprobación de la celda de flujo, del protocolo de MinKNOW.

Abrir el puerto de cebado de la celda de flujo, deslizando la tapa en el sentido de las agujas del reloj.

Flow Cell Loading Diagrams Step 2

IMPORTANTE

Tenga cuidado a la hora de extraer el tampón de la celda de flujo. No retire más de 20-30 μl y asegúrese de que el tampón cubra la matriz de poros en todo momento. La introducción de burbujas de aire en la matriz puede dañar los poros de manera irreversible.

Tras abrir el puerto de cebado, verificar si hay una burbuja de aire bajo la tapa. Retirar una pequeña cantidad de tampón para quitar las burbujas:

  1. Ajustar una pipeta P1000 a 200 μl.
  2. Introducir la punta de la pipeta en el puerto de cebado.
  3. Girar la rueda hasta que el indicador de volumen marque 220-230 μl o hasta que se pueda ver una pequeña cantidad de tampón entrar en la punta de la pipeta.

Nota: Comprobar que haya un flujo continuo de tampón circulando desde el puerto de cebado a través de la matriz de poros.

Flow Cell Loading Diagrams Step 03 V5

Cargar 800 μl de solución en el puerto de cebado, evitando introducir burbujas de aire. Esperar 5 minutos. Durante este tiempo, preparar la biblioteca para cargar siguiendo los pasos a continuación.

Flow Cell Loading Diagrams Step 04 V5 SPANISH

Mezclar con la pipeta, minuciosamente, el contenido del vial Library Beads (LIB).

IMPORTANTE

Este vial contiene microesferas en suspensión. Las microesferas precipitan muy rápido; por eso, es fundamental mezclarlas justo antes de usar.

En la mayoría de experimentos de secuenciación, se recomienda usar Library Beads (LIB) . El reactivo Library Solution (LIS) está indicado para bibliotecas de ADN más viscosas.

En un tubo nuevo de 1,5 ml Eppendorf DNA LoBind, preparar la biblioteca de la siguiente manera:

Reactivo Volumen por celda de flujo
Sequencing Buffer (SB) 37,5 µl
Library Beads (LIB) mezcladas justo antes de usar, o Library Solution (LIS), si se requiere 25,5 µl
Biblioteca de ADN 12 µl
Total 75 µl

Completar el cebado de la celda de flujo:

  1. Levantar suavemente la tapa del puerto de carga SpotON.
  2. Cargar 200 µl de solución en el puerto de cebado (no en el puerto de muestra SpotON), evitando introducir burbujas de aire.

Flow Cell Loading Diagrams Step 5

Flow Cell Loading Diagrams Step 06 V5 SPANISH 2

Mezclar la biblioteca pipeteando suavemente, justo antes de cargar.

Añadir, gota a gota, 75 μl de la biblioteca preparada en el puerto de muestra SpotON. Procurar que cada gota fluya hacia adentro del puerto antes de añadir la siguiente.

Flow Cell Loading Diagram Step 07 V5 SPANISH

Volver a colocar con cuidado, la tapa del puerto de muestra SpotON, procurando que el tapón encaje en el agujero y cerrar el puerto de cebado.

Step 8 update - SPANISH

Flow Cell Loading Diagrams Step 9 SPANISH

IMPORTANTE

Para obtener resultados de secuenciación óptimos, coloque la pantalla protectora sobre la celda de flujo justo después de cargar la biblioteca.

Recomendamos colocar la pantalla protectora en la celda de flujo y dejarla puesta mientras la biblioteca esté cargada, incluyendo los lavados y pasos de recarga. Retirar la pantalla cuando se haya extraído la biblioteca de la celda de flujo.

Colocar la pantalla protectora de la siguiente manera:

  1. Colocar con cuidado el borde delantero de la pantalla protectora contra el clip. Nota: No hacer fuerza sobre ella.

  2. Colocar la pantalla protectora con suavidad sobre la celda de flujo. La pieza debe asentarse alrededor de la tapa SpotON y debe cubrir por completo la sección superior de la celda de flujo.

J2264 - Light shield animation Flow Cell FAW optimised. SPANISH

ATENCIÓN

La pantalla protectora no está fijada a la celda de flujo. Una vez colocada, es necesario manipularla con cuidado.

FIN DEL PROCESO

Cerrar la tapa del dispositivo y configurar un experimento de secuenciación en MinKNOW.

9. Data acquisition and basecalling

Aspectos generales del análisis de datos de nanoporos

Para obtener una descripción completa del análisis de datos de nanoporos, que incluya distintas posibilidades para el análisis de identificación y postidentificicación de bases, consultar el documento Data Analysis.

IMPORTANTE

Required settings in MinKNOW

The correct barcoding parameters must be set up on MinKNOW prior to the sequencing run. During the run setup, in the Analysis tab:

  1. Enable Barcoding.
  2. Select Edit options.
  3. Enable Mid-read barcode filtering.
  4. Enable Override minimum barcoding score and set the value to 60.
  5. Enable Override minimum mid-read barcoding score and set the value to 50.

MRT Run setup analysis - Barcoding highlights

MRT Run setup Barcoding options

Cómo empezar a secuenciar

El programa MinKNOW realiza el control del dispositivo de secuenciación, la adquisición de datos y la identificación de bases en tiempo real. Una vez que el usuario ha instalado MinKNOW en su ordenador, hay diferentes maneras de llevar a cabo la secuenciación:

1. Adquisición de datos e identificación de bases en tiempo real con el programa MinKNOW.

Seguir las instrucciones del protocolo de MinKNOW, desde el apartado "Starting a sequencing run" hasta el final del apartado "Completing a MinKNOW run".

2. Adquisición de datos e identificación de bases en tiempo real con el dispositivo GridION.

Seguir las instrucciones del manual de usuario de GridION.

3. Adquisición de datos e identificación de bases en tiempo real con el dispositivo MinION Mk1C.

Seguir las instrucciones del manual de usuario de MinION Mk1C.

4. Adquisición de datos e identificación de bases en tiempo real con el dispositivo PromethION.

Seguir las instrucciones de los manuales de usuario de PromethION o PromethION 2 Solo.

5. Adquisición de datos e identificación de bases posterior mediante MinKNOW.

Seguir las instrucciones del protocolo de MinKNOW, desde el apartado "Starting a sequencing run" hasta el final del apartado "Completing a MinKNOW run". Al configurar los parámetros del experimento, ajustar la pestaña Basecalling (Identificación de bases) en posición de APAGADO. Al terminar el experimento de secuenciación, seguir las instrucciones del apartado "Post-run analysis" del protocolo de MinKNOW.

10. Downstream analysis

Recommended pipeline analysis

The wf-artic is a bioinformatics workflow for the analysis of ARTIC sequencing data prepared using the Midnight protocol. The bioinformatics workflow is orchestrated by the Nextflow software. Nextflow is a publicly available and open-source project that enables the execution of scientific workflows in a scalable and reproducible way. The use of the Nextflow software has been integrated into the EPI2ME Labs software that we recommend for running our downstream analysis methods.

Alternative methods for downstream analysis are available using your device terminal or command line, however we only suggest this for experienced users.

Demultiplexed sequence reads are processed using the ARTIC Field Bioinformatics software that has been modified for the analysis of FASTQ sequences prepared using Oxford Nanopore Rapid Sequencing kits. The other modification to the ARTIC workflow is the use of a primer scheme that defines the sequencing primers used by the Midnight protocol and their genomic locations on the SARS-CoV-2 genome.

The wf-artic workflow includes other analytical steps that include cladistic analysis using Nextclade and strain assignment using Pangolin. The data facets included in the report are parameterised and additional information such as plots of depth-of-coverage across the reference genome is optional.

The complete source for wf-artic is linked, and the Nextflow software will download the scripts and logic flow from this location.

The wf-artic workflow needs to be started manually as outlined below in 'Running a Midnight analysis using EPI2ME Labs'.

Software set-up and installation

The EPI2ME application provides a clean interface to accessing bioinformatics workflows, and is our recommended method in performing your post-sequencing analysis.

Follow the instructions in the EPI2ME Installation guide to install the application on your device.

For more information on how to use EPI2ME, refer to the EPI2ME Quick Start guide.

Installing and updating the wf-artic workflow in EPI2ME Labs:

Ensure you have installed the wf-artic workflow prior to the first analysis set-up.

In the EPI2ME Labs home page, scroll down to the "Install workflows" section and click on epi2me-labs/wf-artic:

EPI2ME labs install wfartic

If you have already installed the wf-artic workflow, ensure you are using the latest version.

Updating the workflow can be done directly through EPI2ME Labs by navigating to the wf-artic workflow page and clicking Update Workflow:

12 EPI2ME labs wfartic analysis updating the workflow

Demultiplexing of multiple barcoded samples

The wf-artic analysis requires FASTQ sequence data that has already been demultiplexed.

Reads will be demultiplexed during sequencing if you are following the recommended "Required settings in MinKNOW". However, demultiplexing can also be done post-sequencing using the MinKNOW software.

For more information and guides on demultiplexing using MinKNOW, refer to the "Post-run analysis" section in our MinKNOW Protocol.

The expected input for wf-artic is a folder of folders as shown below. Each of the barcode folders should contain the FASTQ sequence data and files may either be uncompressed or gzipped.

$ tree -d MidnightFastq/

MidnightFastq/

├── barcode01

├── barcode02

├── barcode03

├── barcode04

├── barcode05

├── barcode06

└── unclassified

IMPORTANTE

Basecalling model

The basecalling model should be specified when setting up the wf-artic analysis. This should reflect the basecalling model selected during your run set-up as follows:

  • If using the default model, High-accuracy basecalling (HAC): r1041_e82_400bps_hac_variant_g615
  • If you have used Super accurate basecalling (SUP), please use: r1041_e82_400bps_sup_variant_g615
  • If you have used FAST basecalling, please use: r1041_e82_400bps_fast_variant_g615

Running a Midnight analysis using EPI2ME Labs

Open the EPI2ME Labs application on your device.

EPI2ME labs application logo

Open the "Workflows" tab in the EPI2ME Labs application and click on the "wf-artic" workflow:

3 EPI2ME labs wf-artic workflow

In the "wf-artic" workflow page, select "Run this workflow" to open analysis set-up:

4 EPI2ME labs wfartic workflow run

Complete the wf-artic run set-up:

Select your data input file location. Please note, this folder must contain the demultiplexed FASTQ files of your sequencing run.

5 EPI2ME labs wfartic run setup fastqs

Expand the Primer Scheme Selection tab and set the Scheme version to Midnight-ONT/V3.

6 EPI2ME labs wfartic run setup primer scheme selection

Expand the Advanced Options tab and set the Medaka model to the basecalling model used in your sequencing run.

7 EPI2ME labs wfartic run setup advanced options

8 EPI2ME labs wfartic run setup medaka model

Expand the Extra configuration tab and set the Run name for your wf-artic analysis.

9 EPI2ME labs wfartic run setup run name

Click Launch workflow at the bottom of the page to begin your analysis.

Navigate to the "Analysis" tab in the EPI2ME Labs application to monitor your run:

10 EPI2ME labs wfartic analysis run monitoring

Completed analysis and result files

The wf-artic analysis outputs will be written to the Working Directory folder specified in the EPI2ME Labs Settings tab. The location of this folder is specified in the wf-artic run Instance parameters preceeded by out_dir.

However, these files can also be accessed directly in the EPI2ME Labs application from the completed analysis page for your run:

11 EPI2ME labs wfartic analysis completed run

These outputs include:

  • all_consensus.fasta A multi-FASTA format sequence file containing the consensus sequence for each of the samples investigated. This consensus sequence has been prepared for the whole SARS-CoV-2 genome, not just the spike protein region. The consensus sequence masks the non-spike regions and regions of low sequence coverage with N residues.

  • all_variants.vcf.gz A gzipped VCF file that describes all high-quality genetic variants called by medaka from the sequenced samples.

  • all_variants.vcf.gz.tbi An index file for the gzipped VCF file.

  • consensus_status.txt A tab delimited file that reports whether a consensus sequence has been successfully prepared for a sample, or not.

  • wf-artic-report.html A report summarising these data. This HTML format report also includes the output of the Nextclade software that can be used for a visual inspection of, for example, primer drop out or other qualitative consensus sequence aspects.

Other files are included in the work-directory. This includes per sample VCF files of all genetic variants prior to filtering and other sequences.

Housekeeping and disk usage

The "Working Directory" can be specified in the EPI2ME Labs "Settings" tab and defines where the workflow intermediate files and outputs are stored.

This folder will accumulate a significant number of files that correspond to raw BAM files, other larger intermediates and analysis results files. We recommend this folder to be routinely cleared.

11. Reutilización y devoluciones de las celdas de flujo

Material
  • Flow Cell Wash Kit (EXP-WSH004) (kit de lavado de celda de flujo)

Si al terminar el experimento desea volver a usar la celda de flujo, siga las instrucciones del protocolo Flow Cell Wash Kit y guarde la celda de flujo lavada a 2-8 ⁰C.

El protocolo Flow Cell Wash Kit está disponible en la comunidad Nanopore.

CONSEJO

Una vez terminado el experimento, recomendamos lavar la celda de flujo cuanto antes. Si no es posible, se puede dejar en el dispositivo y lavar al día siguiente.

Otra posibilidad es seguir el procedimiento de devolución para lavar la celda de flujo y enviarla a Oxford Nanopore.

Aquí puede encontrar las instrucciones para devolver celdas de flujo.

Nota: Antes de proceder a su devolución, las celdas de flujo deben lavarse con agua desionizada.

IMPORTANTE

Ante cualquier duda o pregunta acerca del experimento de secuenciación, consulte la guía de resolución de problemas, Troubleshooting Guide, que se encuentra en la versión en línea de este protocolo.

12. Problemas durante la extracción de ADN/ARN y la preparación de bibliotecas

A continuación hay una lista de los problemas más frecuentes, con algunas posibles causas y soluciones propuestas.

También disponemos de una página de preguntas frecuentes, FAQ, en la sección Support de la comunidad Nanopore.

Si ha probado las soluciones propuestas y continúa teniendo problemas, póngase en contacto con el departamento de asistencia técnica, bien por correo electrónico (support@nanoporetech.com) o a través del Live Chat de la comunidad Nanopore.

Baja calidad de la muestra

Observación Posible causa Comentarios y acciones recomendadas
Baja pureza del ADN (la lectura del Nanodrop para ADN OD 260/280 es <1,8 y OD 260/230 es <2,0-2,2) El método de extracción de ADN no proporciona la pureza necesaria Los efectos de los contaminantes se muestran en la página Contaminants. Pruebe con un método de extracción alternativo que no provoque el arrastre de contaminantes.

Considere realizar un paso adicional de limpieza SPRI.
Baja integridad del ARN (número de integridad del ARN <9,5 RIN o la banda ARNr se muestra como una mancha en el gel). El ARN se degradó durante la extracción Probar un método de extracción de ARN diferente. Encontrará más información sobre RIN en la página RNA Integrity Number. Asimismo, dispone de información adicional en la página DNA/RNA Handling.
El ARN tiene una longitud de fragmento más corta de lo esperado El ARN se degradó durante la extracción Probar un método de extracción de ARN diferente. Encontrará más información sobre RIN en la página RNA Integrity Number. Asimismo, dispone de información adicional en la página DNA/RNA Handling.

Cuando se trabaje con ARN, recomendamos que el espacio de trabajo y el instrumental de laboratorio estén libres de ribonucleasas.

Escasa recuperación de ADN tras la limpieza con microesferas magnéticas AMPure

Observación Posible causa Comentarios y acciones recomendadas
Escasa recuperación Pérdida de ADN debido a una proporción de microesferas magnéticas AMPure por muestra inferior a lo previsto. 1. Las microesferas magnéticas AMPure precipitan con rapidez; antes de añadirlas a la muestra hay que asegurarse de que estén bien resuspendidas.

2. Si la proporción de microesferas por muestra es inferior a 0.4:1, los fragmentos de ADN, sean del tamaño que sean, se perderán durante la limpieza.
Escasa recuperación Los fragmentos de ADN son más cortos de lo esperado Cuanto menor sea la proporción de microesferas magnéticas AMPure por muestra, más rigurosa será la selección de fragmentos largos frente a los cortos. Determinar siempre la longitud de la muestra de ADN en un gel de agarosa u otros métodos de electroforesis en gel, y, a continuación, calcular la cantidad adecuada de microesferas magnéticas que se debe utilizar. SPRI cleanup
Escasa recuperación tras la preparación de extremos El paso de lavado utilizó etanol a <70 % Cuando se utilice etanol a <70 %, el ADN se eluirá de las microesferas magnéticas. Asegúrese de utilizar el porcentaje correcto.

13. Issues during the sequencing run

A continuación hay una lista de los problemas más frecuentes, con algunas posibles causas y soluciones propuestas.

También disponemos de una página de preguntas frecuentes, FAQ, en la sección Support de la comunidad Nanopore.

Si ha probado las soluciones propuestas y continúa teniendo problemas, póngase en contacto con el departamento de asistencia técnica, bien por correo electrónico (support@nanoporetech.com) o a través del Live Chat de la comunidad Nanopore.

Menos poros al inicio de la secuenciación que después de verificar la celda de flujo

Observación Posible causa Comentarios y acciones recomendadas
MinKNOW presentó al inicio de la secuenciación un número de poros inferior al indicado durante la comprobación de la celda de flujo Se introdujo una burbuja de aire en la matriz de nanoporos Tras comprobar el número de poros presente en la celda de flujo, es imprescindible quitar las burbujas que haya cerca del puerto de cebado. Si no se quitan, pueden desplazarse a la matriz de nanoporos y dañar de manera irreversible los nanoporos expuestos al aire. En este vídeo se muestran algunas buenas prácticas para evitar que esto ocurra.
MinKNOW presentó al inicio de la secuenciación un número de poros inferior al indicado durante la comprobación de la celda de flujo La celda de flujo no está colocada correctamente Detener el ciclo de secuenciación, quitar la celda de flujo del dispositivo e insertarla de nuevo. Comprobar que está firmemente asentada en el dispositivo y que ha alcanzado la temperatura deseada. Si procede, probar con una posición diferente del dispositivo (GriION/PromethION).
MinKNOW presentó al inicio de la secuenciación un número de poros inferior al indicado durante la comprobación de la celda de flujo La presencia de contaminantes en la biblioteca ha dañado o bloqueado los poros El número de poros resultante tras la comprobación de la celda de flujo se realiza usando el control de calidad de las moléculas de ADN presentes en el tampón de almacenamiento de la celda de flujo. Al inicio de la secuenciación, se utiliza la misma biblioteca para estimar el número de poros activos. Por este motivo, se estima que puede haber una variabilidad del 10 % en el número de poros detectados. Tener un número de poros considerablemente inferior al inicio de la secuenciación puede deberse a la presencia de contaminantes en la biblioteca que hayan dañado las membranas o bloqueado los poros. Para mejorar la pureza del material de entrada tal vez sea necesario usar métodos de purificación o extracción de ADN/ARN alternativos. Los efectos de los contaminantes están descritos en la página Contaminants. Se recomienda, probar con un método de extracción alternativo que no provoque el arrastre de contaminantes.

Error en el script de MinKNOW

Observación Posible causa Comentarios y acciones recomendadas
MinKNOW muestra el mensaje "Error en el script"
Reiniciar el ordenador y reiniciar MinKNOW. Si el problema continúa, reúna los archivos de registro MinKNOW log files y contacte con el servicio de asistencia técnica. Si no dispone de otro dispositivo de secuenciación, recomendamos que guarde la celda de flujo con la biblioteca cargada a 4 °C y contacte con el servicio de asistencia técnica para recibir recomendaciones de almacenamiento adicionales.

Pore occupancy below 40%

Observation Possible cause Comments and actions
Pore occupancy <40% Not enough library was loaded on the flow cell Ensure you load the recommended amount of good quality library in the relevant library prep protocol onto your flow cell. Please quantify the library before loading and calculate mols using tools like the Promega Biomath Calculator, choosing "dsDNA: µg to pmol"
Pore occupancy close to 0 The Ligation Sequencing Kit was used, and sequencing adapters did not ligate to the DNA Make sure to use the NEBNext Quick Ligation Module (E6056) and Oxford Nanopore Technologies Ligation Buffer (LNB, provided in the sequencing kit) at the sequencing adapter ligation step, and use the correct amount of each reagent. A Lambda control library can be prepared to test the integrity of the third-party reagents.
Pore occupancy close to 0 The Ligation Sequencing Kit was used, and ethanol was used instead of LFB or SFB at the wash step after sequencing adapter ligation Ethanol can denature the motor protein on the sequencing adapters. Make sure the LFB or SFB buffer was used after ligation of sequencing adapters.
Pore occupancy close to 0 No tether on the flow cell Tethers are adding during flow cell priming (FLT/FCT tube). Make sure FLT/FCT was added to FB/FCF before priming.

Longitud de lectura más corta de lo esperado

Observación Posible causa Comentarios y acciones recomendadas
Longitud de lectura más corta de lo esperado Fragmentación no deseada de la muestra de ADN La longitud de lectura refleja la longitud del fragmento de la muestra de ADN. La muestra de ADN se puede fragmentar durante la extracción de la preparación de la biblioteca.

1. Consulte la sección de buenas prácticas de los métodos de extracción en la página Extraction Methods de la comunidad Nanopore.

2. Visualizar la distribución de la longitud de los fragmentos de las muestras de ADN en un gel de agarosa antes de proceder a la preparación de la biblioteca. DNA gel2 En la imagen superior, la muestra 1 contiene alto peso molecular, mientras que la muestra 2 se ha fragmentado.

3. Durante la preparación de la biblioteca, evitar pipetear y agitar en vórtex cuando se mezclen los reactivos. Dar suaves golpes con el dedo o invertir el vial es suficiente.

Gran proporción de poros no disponibles

Observación Posible causa Comentarios y acciones recomendadas
Gran proporción de poros no disponibles (se muestran en azul oscuro en el panel de canales y en el gráfico de actividad de poros)

image2022-3-25 10-43-25 Conforme pasa el tiempo, el gráfico de actividad de poros de arriba muestra una proporción creciente de poros no disponibles.		 Hay contaminantes presentes en la muestra Algunos contaminantes se pueden eliminar de los poros mediante la función de desbloqueo incorporada en MinKNOW. Si funciona, el estado de los poros cambiará a "sequencing pores" (secuenciación de poros). Si la porción poros no disponibles se mantiene elevada o aumenta, pruebe una de las siguientes opciones:

1. Realizar un enjuague de nucleasa con el kit de lavado Flow Cell Wash Kit (EXP-WSH004)
2. Realizar varios ciclos de PCR para intentar diluir cualquier contaminante que pueda estar causando problemas.

Gran proporción de poros inactivos

Observación Posible causa Comentarios y acciones recomendadas
Gran proporción de poros inactivos/no disponibles (se muestran en azul claro en el panel de canales y en el gráfico de actividad de poros. Los poros o membranas están dañados de manera irreversible) Se han introducido burbujas de aire en la celda de flujo Las burbujas de aire introducidas durante el cebado de la celda y la carga de la biblioteca pueden dañar los poros de forma permanente. Para conocer las buenas prácticas de cebado y carga de la celda de flujo, ver el vídeo Priming and loading your flow cell
Gran proporción de poros inactivos/no disponibles Ciertos compuestos copurificados con ADN Compuestos conocidos, incluidos los polisacáridos, se asocian generalmente con el ADN genómico de las plantas.

1. Consulte la página Plant leaf DNA extraction method.
2. Limpiar usando el kit QIAGEN PowerClean Pro.
3. Realizar una amplificación del genoma completo con la muestra original de ADNg utilizando el kit QIAGEN REPLI-g.
Gran proporción de poros inactivos/no disponibles Hay contaminantes presentes en la muestra Los efectos de los contaminantes se muestran en la página Contaminants. Probar con un método de extracción alternativo que no provoque el arrastre de contaminantes.

Reducción de la velocidad de secuenciación y del índice de calidad Qscore en una fase avanzada de la secuenciación

Observación Posible causa Comentarios y acciones recomendadas
Reducción de la velocidad de secuenciación y el índice de calidad Qscore en una fase avanzada de la secuenciación En la química del kit 9 (p. ej., SQK-LSK109), cuando la celda de flujo está sobrecargada con la biblioteca se observa un consumo rápido de combustible (consulte el protocolo correspondiente a su biblioteca de ADN para ver las recomendaciones) Añadir más combustible a la celda de flujo, siguiendo las instrucciones en el protocolo de MinKNOW. En futuros experimentos, cargar cantidades menores de biblioteca en la celda de flujo.

Fluctuación de la temperatura

Observación Posible causa Comentarios y acciones recomendadas
Fluctuación de la temperatura La celda de flujo ha perdido contacto con el dispositivo Comprobar que una almohadilla térmica cubra la placa metálica de la parte posterior de la celda de flujo. Reinsertar la celda de flujo y presionar para asegurarse de que las clavijas del conector estén bien conectadas al dispositivo. Si el problema continúa, contacte con el servicio de asistencia técnica.

Error al intentar alcanzar la temperatura deseada

Observación Posible causa Comentarios y acciones recomendadas
MinKNOW muestra el mensaje "Error al intentar alcanzar la temperatura deseada" El dispositivo ha sido colocado en un lugar a una temperatura ambiente inferior a la media o en un lugar con escasa ventilación (lo que provoca el sobrecalientamiento de las celdas de flujo). MinKNOW tiene un tiempo predeterminado para que las celdas de flujo alcancen la temperatura fijada. Una vez acabado el tiempo, aparece un mensaje de error, pero el experimento de secuenciación continua. Secuenciar a una temperatura incorrecta puede llevar a una disminución en el rendimiento y a generar un índice de calidad Qscore menor. Corrija la ubicación del dispositivo, procure que esté a temperatura ambiente y tenga buena ventilación; a continuación, reinicie el proceso en MinKNOW. Para obtener más información sobre el control de temperatura de MinKNOW Mk 1B, consulte la sección de preguntas frecuentes, FAQ.

Guppy – no input .fast5 was found or basecalled

Observation Possible cause Comments and actions
No input .fast5 was found or basecalled input_path did not point to the .fast5 file location The --input_path has to be followed by the full file path to the .fast5 files to be basecalled, and the location has to be accessible either locally or remotely through SSH.
No input .fast5 was found or basecalled The .fast5 files were in a subfolder at the input_path location To allow Guppy to look into subfolders, add the --recursive flag to the command

Guppy – no Pass or Fail folders were generated after basecalling

Observation Possible cause Comments and actions
No Pass or Fail folders were generated after basecalling The --qscore_filtering flag was not included in the command The --qscore_filtering flag enables filtering of reads into Pass and Fail folders inside the output folder, based on their strand q-score. When performing live basecalling in MinKNOW, a q-score of 7 (corresponding to a basecall accuracy of ~80%) is used to separate reads into Pass and Fail folders.

Guppy – unusually slow processing on a GPU computer

Observation Possible cause Comments and actions
Unusually slow processing on a GPU computer The --device flag wasn't included in the command The --device flag specifies a GPU device to use for accelerate basecalling. If not included in the command, GPU will not be used. GPUs are counted from zero. An example is --device cuda:0 cuda:1, when 2 GPUs are specified to use by the Guppy command.

Last updated: 9/17/2024

Document options

MinION