PCR tiling of SARS-CoV-2 virus - automated Hamilton (SQK-RBK110.96 with EXP-MRT001) (MRTH_9156_v110_revI_12Mar2026)
MinION: Protocol
V MRTH_9156_v110_revI_12Mar2026
FOR RESEARCH USE ONLY.
Contents
Introduction to the protocol
Automated library preparation
Sequencing and data analysis
Troubleshooting
1. Overview of the protocol
This is a Legacy product.
The SQK-RBK110.96 product has been discontinued. Should you require any assistance or have questions, please contact our Customer Support: support@nanoporetech.com.
The PCR tiling of SARS-CoV-2 virus - automated Hamilton (SQK-RBK110.96 with EXP-MRT001) protocol is an automated version of the PCR tiling of SARS-CoV-2 virus with rapid barcoding and Midnight RT PCR Expansion (SQK-RBK110.96 and EXP-MRT001) using the Hamilton NGS Star 96 liquid handling robot.
Introduction to the protocol
To enable support for the rapidly expanding user requests, the team at Oxford Nanopore Technologies have put together an updated workflow based on the ARTIC Network protocols and analysis methods. The protocol uses Oxford Nanopore Technologies' Rapid Barcoding Kit 96 (SQK-RBK110.96) and Midnight RT PCR Expansion (EXP-MRT001) for barcoding and library preparation.
We have developed this automated protocol on the Hamilton NGS Star 96 liquid handling robot. The majority of the process is automated with minimal hands-on time which is required for sample quantification and deck re-loading.
While this protocol is available in the Nanopore Community, we kindly ask users to ensure they are citing the members of the ARTIC network who have been behind the development of these methods.
This protocol is similar to the ARTIC amplicon sequencing protocol for MinION for SARS-CoV-2 v3 (LoCost) by Josh Quick and the method used in Freed et al., 2020. The protocol generates amplicons in a tiled fashion across the whole SARS-CoV-2 genome.
To generate tiled PCR amplicons from the SARS-CoV-2 viral cDNA for use with the Rapid Barcoding Kit 96 (SQK-RBK110.96), primers were designed by Freed *et al.*, 2020 using Primal Scheme. These primers are in the Midnight RT PCR Expansion (EXP-MRT001) and are designed to generate 1.2 kb amplicons. Primer sequences can be found here.
Steps in the sequencing workflow:
Prepare for your experiment
you will need to:
Before starting - Manual steps:
- Extract your RNA
- Ensure you have your sequencing kit, the correct equipment and reagents
- Prepare your reagents, samples and labware to load on the Hamilton NGS Star 96
- Download the software for acquiring and analysing your data
- Check your flow cell to ensure it has enough pores for a good sequencing run
### Prepare your library You will need to:
Automated steps:
- Reverse transcribe your RNA samples with random hexamers
- Amplify the samples by tiled PCR using separate primer pools
- Combine the primer pools
- Attach Rapid Barcodes supplied in the kit to the DNA ends, pool the samples and SPRI purify
__Manual steps:__
- Quantify your DNA library as a quality control
- Prime the flow cell and load your DNA library into the flow cell
Overview of library preparation workflow:
The image below is representative of the steps that take place in the automated runs for X96 samples.
Note: Timings are dependent on number of samples and include hands on time, such as deck loading and sample quantification
Sequencing and analysis
You will need to:
- Start a sequencing run using the MinKNOW software, selecting SQK-RBK110.96 and EXP-MRT001 in kit selection, which will collect raw data from the device and convert it into basecalled reads
Timings
Note: Timings are approximate and subject to change with updates.
| Process | X24 samples | X48 samples | X96 samples | Hands-on time |
|---|---|---|---|---|
| Deck set-up | ~30 minutes | |||
| Process 1: cDNA synthesis - Pre-on deck thermocycler | 6 minutes | 8 minutes | 10 minutes | |
| cDNA synthesis - On deck thermocycler | 17 minutes | 17 minutes | 17 minutes | |
| cDNA synthesis - Post-on deck thermocycler | 4 minutes | 4 minutes | 4 minutes | |
| Process 2: cDNA amplification | 20 minutes | 20 minutes | 27 minutes | |
| cDNA amplification On/Off-deck thermocyler | ~3 hours 30 minutes | ~3 hours 30 minutes | ~3 hours 30 minutes | |
| Process 3: Rapid Barcoding - Pre-on deck thermocycler | 20 minutes | 22 minutes | 31 minutes | |
| Rapid Barcoding - On deck thermocyler | 7 minutes | 7 minutes | 7 minutes | |
| Rapid Barcoding - Post-on deck thermocyler | 1 minutes | 2 minutes | ||
| Process 4: cDNA amplicon pooling/cleanup | 34 minutes | 45 minutes | 49 minutes | |
| Quantification | ~10 minutes | |||
| Total | 5 hours 19 minutes | 5 hours 35 minutes | 5 hours 55 minutes | ~40 minutes |
Nomenclature for automation protocol
Throughout this document, 'Protocol' is defined as the assay on the whole and 'Run' refers to the individual scripts for the automated liquid handling robot, which are specific to indicated protocol step(s).
Before starting
This protocol outlines how to carry out PCR tiling of SARS-CoV-2 viral RNA samples on a 96-well plate using the Rapid Barcoding Kit 96 (SQK-RBK110.96) with the Midnight RT PCR Expansion (EXP-MRT001) using the Hamilton NGS Star 96 liquid handling robot.
We recommend performing a UV clean of the Hamilton NGS Star 96 between each run to minimise risk of contamination.
When processing multiple samples at once, we recommend making master mixes following the indicated volumes to account for the necessary excess. We also recommend using a template-free pre-PCR hood for making up the master mixes, and a separate template pre-PCR hood for handling the samples. It is important to clean and/or UV irradiate these hoods between sample batches. Furthermore, to track and monitor cross-contamination events, it is important to run a negative control reaction at the reverse transcription stage using nuclease-free water instead of sample, and carrying this control through the rest of the prep.
Compatibility of this protocol
This protocol should only be used in combination with:
- Rapid Barcoding Kit 96 (SQK-RBK110.96)
- Midnight RT PCR Expansion (EXP-MRT001)
- R9.4.1 flow cells (FLO-MIN106)
- Flow Cell Wash Kit (EXP-WSH004)
2. Equipment and consumables
材料
- Input RNA in 10 mM Tris-HCl, pH 8.0
- Rapid Barcoding Kit 96 (SQK-RBK110.96)
- Midnight RT PCR Expansion (EXP-MRT001)
耗材
- 无核酸酶水(如 Thermo Scientific,AM9937)
- 新制备的 80% 乙醇(用无核酸酶水配制)
- Qubit dsDNA HS Assay(双链DNA高灵敏度检测)试剂盒(Invitrogen, Q32851)
- Qubit™ 分析管(Invitrogen, Q32856)
- 1.5 ml Eppendorf DNA LoBind 离心管
- 2 ml Eppendorf DNA LoBind 离心管
- 5 ml Eppendorf DNA LoBind 离心管
- Hard-Shell® 96-Well PCR Plates, low profile, thin-walled, skirted, white/clear (Bio-Rad, Cat # HSP9601)
- 96-well 0.8 ml MIDI plate (we recommend Abgene™ 96 Well 0.8 ml Polypropylene Deepwell Storage Plate: ThermoFisher, Cat # AB0859)
- PCR 封板膜
- Hamilton 50 µl CO-RE tips with filter (Cat# 235948)
- Hamilton 300 µl CO-RE tips with filter (Cat# 235903)
- Hamilton 1000 µl CO-RE tips with filter (Cat# 235905)
- Hamilton PCR ComfortLid (Cat# 814300)
- Hamilton 60 ml Reagent Reservoir, Self-Standing with Lid (Cat# 56694-01)
仪器
- Hamilton NGS STAR liquid handling robot
- Hamilton On-Deck Thermal Cycler (ODTC)
- Centrifuge capable of taking 96-well plates
- 迷你离心机
- 涡旋混匀仪
- 热循环仪
- P1000 移液枪和枪头
- P200 移液枪和枪头
- P100 移液枪和枪头
- P20 移液枪和枪头
- P10 移液枪和枪头
- 盛有冰的冰桶
- 计时器
- Qubit荧光计 (或用于质控检测的等效仪器)
可选仪器
- Eppendorf 5424 离心机(或等效器材)
- PCR hood with UV steriliser (optional but recommended to reduce cross-contamination)
- PCR-Cooler (Eppendorf)
- Stepper pipette and tips
Hamilton NGS Star 96 and deck layout
This method has been tested and validated using the Hamilton NGS Star 96 (with 8 channels and MPH96), including an on-deck thermal cycler (ODTC), a Hamilton Heater Shaker (HHS) and the Inheco Cold Plate Air Cooled (CPAC) Modules. All modules are used at different stages of the protocol. This protocol may require some fine tuning for the specific NGS Star set-up and the temperature/humidity of the customer laboratory.
Please contact your Hamilton representative for further details.
Deck layout

- MIDI plates: Abgene™ 96 Well 0.8 ml Polypropylene Deepwell Storage Plate (ThermoFisher, Cat # AB0859)
- HSP plates: Bio-Rad Hard-Shell® 96-Well PCR Plates (Cat# HSP9601)
- ODTC: On-Deck Thermal Cycler Module
- HHS: Hamilton Heater Shaker Module
- CPAC: Inheco Cold Plate Air Cooled Module
- 20 ml reagent troughs: X150 Reagent tub MagNA Pure LC medium 20 plastic (zigzag troughs, Roche #03004058001
- 60 ml self-standing large troughs (Hamilton, 56694-01)
Rapid Barcoding Kit 96 (SQK-RBK110.96) contents
| Name | Acronym | Cap colour | No. of vials | Fill volume per vial (µl) |
|---|---|---|---|---|
| Rapid Barcode plate | RB96 | - | 3 plates | 8 µl per well |
| AMPure XP Beads | AXP | Brown | 3 | 1,200 |
| Sequencing Buffer II | SBII | Red | 1 | 500 |
| Rapid Adapter F | RAP-F | Green | 1 | 25 |
| Elution Buffer | EB | Black | 1 | 500 |
| Loading Beads II | LBII | Pink | 1 | 360 |
| Loading Solution | LS | White cap, pink label | 1 | 400 |
| Flush Tether | FLT | Purple | 1 | 400 |
| Flush Buffer | FB | White | 1 bottle | 15,500 |
This product contains AMPure XP reagent manufactured by Beckman Coulter, Inc.
Midnight RT PCR Expansion (EXP-MRT001) contents
| Name | Acronym | Cap colour | Number of vials | Fill volume per vial (µl) |
|---|---|---|---|---|
| LunaScript RT SuperMix | LS RT | Blue | 3 | 500 |
| Q5 HS Master Mix | Q5 | Orange | 6 | 1,500 |
| Midnight Primer Pool A | MP A | White | 3 | 15 |
| Midnight Primer Pool B | MP B | Clear | 3 | 15 |
Midnight Primer sequences
As mutations in SARS-CoV-2 variants emerge amplicon drop out may be observed; for users wishing to design their own primer spike-ins to address this we suggest adding to the appropriate primer pool at a final concentration between 3.33 µM and 6.66 µM.
Below are the sequences for the V3 primer scheme used in the Midnight RT PCR Expansion.
Pool A
| Primer name | Primer Sequence |
|---|---|
SARSCoV_1200_1_LEFT | ACCAACCAACTTTCGATCTCTTGT |
SARSCoV_1200_1_RIGHT | GGTTGCATTCATTTGGTGACGC |
SARSCoV_1200_3_LEFT | GGCTTGAAGAGAAGTTTAAGGAAGGT |
SARSCoV_1200_3_RIGHT | GATTGTCCTCACTGCCGTCTTG |
SARSCoV_1200_5_LEFT | ACCTACTAAAAAGGCTGGTGGC |
SARSCoV_1200_5_RIGHT | AGCATCTTGTAGAGCAGGTGGA |
SARSCoV_1200_7_LEFT | ACCTGGTGTATACGTTGTCTTTGG |
SARSCoV_1200_7_RIGHT | GCTGAAATCGGGGCCATTTGTA |
SARSCoV_1200_9_LEFT | AGAAGTTACTGGCGATAGTTGTAATAACT |
SARSCoV_1200_9_RIGHT | TGCTGATATGTCCAAAGCACCA |
SARSCoV_1200_11_LEFT | AGACACCTAAGTATAAGTTTGTTCGCA |
SARSCoV_1200_11_RIGHT | GCCCACATGGAAATGGCTTGAT |
SARSCoV_1200_13_LEFT | ACCTCTTACAACAGCAGCCAAAC |
SARSCoV_1200_13_RIGHT | CGTCCTTTTCTTGGAAGCGACA |
SARSCoV_1200_15_LEFT | TTTTAAGGAATTACTTGTGTATGCTGCT |
SARSCoV_1200_15_RIGHT | ACACACAACAGCATCGTCAGAG |
SARSCoV_1200_17_LEFT | TCAAGCTTTTTGCAGCAGAAACG |
SARSCoV_1200_17_RIGHT | CCAAGCAGGGTTACGTGTAAGG |
SARSCoV_1200_19_LEFT | GGCACATGGCTTTGAGTTGACA |
SARSCoV_1200_19_RIGHT | CCTGTTGTCCATCAAAGTGTCCC |
SARSCoV_1200_21_LEFT | TCTGTAGTTTCTAAGGTTGTCAAAGTGA |
SARSCoV_1200_21_RIGHT | GCAGGGGGTAATTGAGTTCTGG |
21_right_spike | GTGTATGATTGAGTTCTGGTTGTAAG |
SARSCoV_1200_23_LEFT | ACTTTAGAGTCCAACCAACAGAATCT |
23_left_spike | ACTTTAGAGTTCAACCAACAGAATCT |
SARSCoV_1200_23_RIGHT | TGACTAGCTACACTACGTGCCC |
SARSCoV_1200_25_LEFT | TGCTGCTACTAAAATGTCAGAGTGT |
SARSCoV_1200_25_RIGHT | CATTTCCAGCAAAGCCAAAGCC |
SARSCoV_1200_27_LEFT | TGGATCACCGGTGGAATTGCTA |
SARSCoV_1200_27_RIGHT | TGTTCGTTTAGGCGTGACAAGT |
SARSCoV_1200_29_LEFT | TGAGGGAGCCTTGAATACACCA |
SARSCoV_1200_29_RIGHT | TAGGCAGCTCTCCCTAGCATTG |
Pool B
| Primer name | Primer sequences |
|---|---|
SARSCoV_1200_2_LEFT | CCATAATCAAGACTATTCAACCAAGGGT |
SARSCoV_1200_2_RIGHT | ACAGGTGACAATTTGTCCACCG |
SARSCoV_1200_4_LEFT | GGAATTTGGTGCCACTTCTGCT |
SARSCoV_1200_4_RIGHT | CCTGACCCGGGTAAGTGGTTAT |
SARSCoV_1200_6_LEFT | ACTTCTATTAAATGGGCAGATAACAACTG |
SARSCoV_1200_6_RIGHT | GATTATCCATTCCCTGCGCGTC |
SARSCoV_1200_8_LEFT | CAATCATGCAATTGTTTTTCAGCTATTTTG |
SARSCoV_1200_8_RIGHT | TGACTTTTTGCTACCTGCGCAT |
SARSCoV_1200_10_LEFT | TTTACCAGGAGTTTTCTGTGGTGT |
SARSCoV_1200_10_RIGHT | TGGGCCTCATAGCACATTGGTA |
SARSCoV_1200_12_LEFT | ATGGTGCTAGGAGAGTGTGGAC |
SARSCoV_1200_12_RIGHT | GGATTTCCCACAATGCTGATGC |
SARSCoV_1200_14_LEFT | ACAGGCACTAGTACTGATGTCGT |
SARSCoV_1200_14_RIGHT | GTGCAGCTACTGAAAAGCACGT |
SARSCoV_1200_16_LEFT | ACAACACAGACTTTATGAGTGTCTCT |
SARSCoV_1200_16_RIGHT | CTCTGTCAGACAGCACTTCACG |
SARSCoV_1200_18_LEFT | GCACATAAAGACAAATCAGCTCAATGC |
SARSCoV_1200_18_RIGHT | TGTCTGAAGCAGTGGAAAAGCA |
SARSCoV_1200_20_LEFT | ACAATTTGATACTTATAACCTCTGGAACAC |
SARSCoV_1200_20_RIGHT | GATTAGGCATAGCAACACCCGG |
SARSCoV_1200_22_LEFT | GTGATGTTCTTGTTAACAACTAAACGAACA |
SARSCoV_1200_22_RIGHT | AACAGATGCAAATCTGGTGGCG |
22_right_spike | AACAGATGCAAATTTGGTGGCG |
SARSCoV_1200_24_LEFT | GCTGAACATGTCAACAACTCATATGA |
24_left_spike | GCTGAATATGTCAACAACTCATATGA |
SARSCoV_1200_24_RIGHT | ATGAGGTGCTGACTGAGGGAAG |
SARSCoV_1200_26_LEFT | GCCTTGAAGCCCCTTTTCTCTA |
SARSCoV_1200_26_RIGHT | AATGACCACATGGAACGCGTAC |
SARSCoV_1200_28_LEFT | TTTGTGCTTTTTAGCCTTTCTGCT |
SARSCoV_1200_28_RIGHT | GTTTGGCCTTGTTGTTGTTGGC |
SARSCoV_1200_28_LEFT_27837T | TTTGTGCTTTTTAGCCTTTCTGTT |
Rapid barcode sequences
| Component | Sequence |
|---|---|
| RB01 | AAGAAAGTTGTCGGTGTCTTTGTG |
| RB02 | TCGATTCCGTTTGTAGTCGTCTGT |
| RB03 | GAGTCTTGTGTCCCAGTTACCAGG |
| RB04 | TTCGGATTCTATCGTGTTTCCCTA |
| RB05 | CTTGTCCAGGGTTTGTGTAACCTT |
| RB06 | TTCTCGCAAAGGCAGAAAGTAGTC |
| RB07 | GTGTTACCGTGGGAATGAATCCTT |
| RB08 | TTCAGGGAACAAACCAAGTTACGT |
| RB09 | AACTAGGCACAGCGAGTCTTGGTT |
| RB10 | AAGCGTTGAAACCTTTGTCCTCTC |
| RB11 | GTTTCATCTATCGGAGGGAATGGA |
| RB12 | CAGGTAGAAAGAAGCAGAATCGGA |
| RB13 | AGAACGACTTCCATACTCGTGTGA |
| RB14 | AACGAGTCTCTTGGGACCCATAGA |
| RB15 | AGGTCTACCTCGCTAACACCACTG |
| RB16 | CGTCAACTGACAGTGGTTCGTACT |
| RB17 | ACCCTCCAGGAAAGTACCTCTGAT |
| RB18 | CCAAACCCAACAACCTAGATAGGC |
| RB19 | GTTCCTCGTGCAGTGTCAAGAGAT |
| RB20 | TTGCGTCCTGTTACGAGAACTCAT |
| RB21 | GAGCCTCTCATTGTCCGTTCTCTA |
| RB22 | ACCACTGCCATGTATCAAAGTACG |
| RB23 | CTTACTACCCAGTGAACCTCCTCG |
| RB24 | GCATAGTTCTGCATGATGGGTTAG |
| RB25 | GTAAGTTGGGTATGCAACGCAATG |
| RB26 | CATACAGCGACTACGCATTCTCAT |
| RB27 | CGACGGTTAGATTCACCTCTTACA |
| RB28 | TGAAACCTAAGAAGGCACCGTATC |
| RB29 | CTAGACACCTTGGGTTGACAGACC |
| RB30 | TCAGTGAGGATCTACTTCGACCCA |
| RB31 | TGCGTACAGCAATCAGTTACATTG |
| RB32 | CCAGTAGAAGTCCGACAACGTCAT |
| RB33 | CAGACTTGGTACGGTTGGGTAACT |
| RB34 | GGACGAAGAACTCAAGTCAAAGGC |
| RB35 | CTACTTACGAAGCTGAGGGACTGC |
| RB36 | ATGTCCCAGTTAGAGGAGGAAACA |
| RB37 | GCTTGCGATTGATGCTTAGTATCA |
| RB38 | ACCACAGGAGGACGATACAGAGAA |
| RB39 | CCACAGTGTCAACTAGAGCCTCTC |
| RB40 | TAGTTTGGATGACCAAGGATAGCC |
| RB41 | GGAGTTCGTCCAGAGAAGTACACG |
| RB42 | CTACGTGTAAGGCATACCTGCCAG |
| RB43 | CTTTCGTTGTTGACTCGACGGTAG |
| RB44 | AGTAGAAAGGGTTCCTTCCCACTC |
| RB45 | GATCCAACAGAGATGCCTTCAGTG |
| RB46 | GCTGTGTTCCACTTCATTCTCCTG |
| RB47 | GTGCAACTTTCCCACAGGTAGTTC |
| RB48 | CATCTGGAACGTGGTACACCTGTA |
| RB49 | ACTGGTGCAGCTTTGAACATCTAG |
| RB50 | ATGGACTTTGGTAACTTCCTGCGT |
| RB51 | GTTGAATGAGCCTACTGGGTCCTC |
| RB52 | TGAGAGACAAGATTGTTCGTGGAC |
| RB53 | AGATTCAGACCGTCTCATGCAAAG |
| RB54 | CAAGAGCTTTGACTAAGGAGCATG |
| RB55 | TGGAAGATGAGACCCTGATCTACG |
| RB56 | TCACTACTCAACAGGTGGCATGAA |
| RB57 | GCTAGGTCAATCTCCTTCGGAAGT |
| RB58 | CAGGTTACTCCTCCGTGAGTCTGA |
| RB59 | TCAATCAAGAAGGGAAAGCAAGGT |
| RB60 | CATGTTCAACCAAGGCTTCTATGG |
| RB61 | AGAGGGTACTATGTGCCTCAGCAC |
| RB62 | CACCCACACTTACTTCAGGACGTA |
| RB63 | TTCTGAAGTTCCTGGGTCTTGAAC |
| RB64 | GACAGACACCGTTCATCGACTTTC |
| RB65 | TTCTCAGTCTTCCTCCAGACAAGG |
| RB66 | CCGATCCTTGTGGCTTCTAACTTC |
| RB67 | GTTTGTCATACTCGTGTGCTCACC |
| RB68 | GAATCTAAGCAAACACGAAGGTGG |
| RB69 | TACAGTCCGAGCCTCATGTGATCT |
| RB70 | ACCGAGATCCTACGAATGGAGTGT |
| RB71 | CCTGGGAGCATCAGGTAGTAACAG |
| RB72 | TAGCTGACTGTCTTCCATACCGAC |
| RB73 | AAGAAACAGGATGACAGAACCCTC |
| RB74 | TACAAGCATCCCAACACTTCCACT |
| RB75 | GACCATTGTGATGAACCCTGTTGT |
| RB76 | ATGCTTGTTACATCAACCCTGGAC |
| RB77 | CGACCTGTTTCTCAGGGATACAAC |
| RB78 | AACAACCGAACCTTTGAATCAGAA |
| RB79 | TCTCGGAGATAGTTCTCACTGCTG |
| RB80 | CGGATGAACATAGGATAGCGATTC |
| RB81 | CCTCATCTTGTGAAGTTGTTTCGG |
| RB82 | ACGGTATGTCGAGTTCCAGGACTA |
| RB83 | TGGCTTGATCTAGGTAAGGTCGAA |
| RB84 | GTAGTGGACCTAGAACCTGTGCCA |
| RB85 | AACGGAGGAGTTAGTTGGATGATC |
| RB86 | AGGTGATCCCAACAAGCGTAAGTA |
| RB87 | TACATGCTCCTGTTGTTAGGGAGG |
| RB88 | TCTTCTACTACCGATCCGAAGCAG |
| RB89 | ACAGCATCAATGTTTGGCTAGTTG |
| RB90 | GATGTAGAGGGTACGGTTTGAGGC |
| RB91 | GGCTCCATAGGAACTCACGCTACT |
| RB92 | TTGTGAGTGGAAAGATACAGGACC |
| RB93 | AGTTTCCATCACTTCAGACTTGGG |
| RB94 | GATTGTCCTCAAACTGCCACCTAC |
| RB95 | CCTGTCTGGAAGAAGAATGGACTT |
| RB96 | CTGAACGGTCATAGAGTCCACCAT |
3. Computer requirements and software
MinION Mk1B IT requirements
Sequencing on a MinION Mk1B requires a high-spec computer or laptop to keep up with the rate of data acquisition. For more information, refer to the MinION Mk1B IT requirements document.
MinION Mk1C IT requirements
The MinION Mk1C contains fully-integrated compute and screen, removing the need for any accessories to generate and analyse nanopore data. For more information refer to the MinION Mk1C IT requirements document.
MinION Mk1D IT requirements
Sequencing on a MinION Mk1D requires a high-spec computer or laptop to keep up with the rate of data acquisition. For more information, refer to the MinION Mk1D IT requirements document.
Software for nanopore sequencing
MinKNOW
The MinKNOW software controls the nanopore sequencing device, collects sequencing data and basecalls in real time. You will be using MinKNOW for every sequencing experiment to sequence, basecall and demultiplex if your samples were barcoded.
For instructions on how to run the MinKNOW software, please refer to the MinKNOW protocol.
EPI2ME (optional)
The EPI2ME cloud-based platform performs further analysis of basecalled data, for example alignment to the Lambda genome, barcoding, or taxonomic classification. You will use the EPI2ME platform only if you would like further analysis of your data post-basecalling.
For instructions on how to create an EPI2ME account and install the EPI2ME Desktop Agent, please refer to this link.
Check your flow cell
We highly recommend that you check the number of pores in your flow cell prior to starting a sequencing experiment. This should be done within 12 weeks of purchasing for MinION/GridION/PromethION or within four weeks of purchasing Flongle Flow Cells. Oxford Nanopore Technologies will replace any flow cell with fewer than the number of pores in the table below, when the result is reported within two days of performing the flow cell check, and when the storage recommendations have been followed. To do the flow cell check, please follow the instructions in the Flow Cell Check document.
| Flow cell | Minimum number of active pores covered by warranty |
|---|---|
| Flongle Flow Cell | 50 |
| MinION/GridION Flow Cell | 800 |
| PromethION Flow Cell | 5000 |
4. Library preparation
材料
- Input RNA in 10 mM Tris-HCl, pH 8.0
- LunaScript RT SuperMix (LS RT)
- Midnight Primer Pool A (MP A)
- Midnight Primer Pool B (MP B)
- Rapid Barcode Plate (RB96)
- AMPure XP Beads (AXP, or SPRI)
耗材
- Q5 HS Master Mix (Q5)
- Hard-Shell® 96-Well PCR Plates, low profile, thin-walled, skirted, white/clear (Bio-Rad, Cat # HSP9601)
- 96-well 0.8 ml MIDI plate (we recommend Abgene™ 96 Well 0.8 ml Polypropylene Deepwell Storage Plate: ThermoFisher, Cat # AB0859)
- Hamilton 50 µl CO-RE tips with filter (Cat# 235948)
- Hamilton 300 µl CO-RE tips with filter (Cat# 235903)
- Hamilton 1000 µl CO-RE tips with filter (Cat# 235905)
- Hamilton 60 ml Reagent Reservoir, Self-Standing with Lid (Cat# 56694-01)
- Hamilton PCR ComfortLid (Cat# 814300)
- 1.5 ml Eppendorf DNA LoBind 离心管
仪器
- Hamilton NGS STAR liquid handling robot
- Hamilton On-Deck Thermal Cycler (ODTC)
- P1000 移液枪和枪头
- P200 移液枪和枪头
- P20 移液枪和枪头
- P2 移液枪和枪头
We recommend performing a UV clean of the Hamilton NGS Star 96 between each run for optimal results and to minimise risk of contamination.
If running multiple plates, Pre-PCR runs can be staggered while PCR amplification is taking place in the thermal cycler.
Consumables and equipment quantities:
| Consumable/equipment | X24 samples | X48 samples | X96 samples |
|---|---|---|---|
| Hamilton 50 µl CO-RE tips with filter | 274 | 491 | 925 |
| Hamilton 3000 µl CO-RE tips with filter | 30 | 60 | 120 |
| Hamilton 1000 µl CO-RE tips with filter | 3 | 6 | 12 |
| Hamilton PCR ComfortLid | 1 | 1 | 1 |
| Hamilton 60 ml Reagent Reservoir, Self-Standing with Lid | 2 | 2 | 2 |
| MIDI plate | 1 | 1 | 1 |
| Bio-Rad Hard-Shell® 96-Well PCR Plate | 2 | 2 | 3 |
Reagents quantities:
| Reagent | Volume X24 samples | Volume X48 samples | Volume X96 samples |
|---|---|---|---|
| LunaScript RT SuperMix | 62.8 µl | 123.6 µl | 251.2 µl |
| Q5 Hot-start Master Mix | 350 µl | 700 µl | 1400 µl |
| Midnight Primer Pool A (MP A) | 1.6 µl | 3.2 µl | 6.4 µl |
| Midnight Primer Pool B (MP B) | 1.6 µl | 3.2 µl | 6.4 µl |
| Nuclease-free water | 3,235 µl | 3,570 µl | 4,191 µl |
| Elution Buffer | 45.5 µl | 57.6 µl | 57.7 µl |
| Rap F | 4.2 µl | 5.3 µl | 5.3 µl |
| SPRI beads | 294 µl | 588 µl | 1176 µl |
| 80% ethanol | 8,400 µl | 8,400 µl | 8,400 µl |
Switch on the Hamilton NGS STAR 96 robot and open 'Hamilton Run Control' on the computer by clicking the icon:
![]()
Click 'File' and 'Open' to choose the method to run on the liquid handling robot.
Click 'Process01: cDNA Synthesis - Pre-PCR' for the first process selection.

Click 'Process04: Pool cDNA Amplicons and Cleanup - Post PCR' as the last process selection.

It is mandatory for users to have an MPH module installed and we recommend the use of an ODTC module.
Select whether an ODTC module is available to use in the run and select Yes to use the MPH (96 Head) module.

Click 'Browse' to choose the Input File Worklist for the specific number of samples in the run and click 'OK'.

This will be a file provided with the script that passes information to the method including sample number and which wells of the rapid barcode plate to use during the rapid barcoding step.
Select 'Yes' for the on-deck thermal cycler (ODTC) use:

If selecting 'No', all steps using a thermal cycler will need to be performed manually off-deck.
Specify what well of the MIDI plate the final elution pool will result in by entering a number into the dialog:

Important: The number introduced will correspond to the well of the plate when ordered by columns:

In a template-free pre-PCR hood, prepare the reagents according to the Hamilton user interface in 1.5 ml Eppendorf tubes and mix thoroughly. Click 'Ok' to continue.
Note: It is user preference whether to print and save the instructions.
The Midnight Primer Pool A (MP A) and Midnight Primer Pool B (MP B) are diluted in nuclease-free water prior to loading into the Hamilton deck. Similarly, the Elution Buffer and Rap F will be combined prior to loading.
Midnight primer mix preparation
For x24 samples:
| Reagent | Midnight Primer Mix 1 | Midnight Primer Mix 1 |
|---|---|---|
| Nuclease-free water | 117.5 µl | 117.5 µl |
| Midnight Primer Pool A (MP A) | 1.6 µl | - |
| Midnight Primer Pool B (MP B) | - | 1.6 µl |
| Total | 119.1 µl | 119.1 µl |
For x48 samples:
| Reagent | Midnight Primer Mix 1 | Midnight Primer Mix 1 |
|---|---|---|
| Nuclease-free water | 234.9 µl | 234.9 µl |
| Midnight Primer Pool A (MP A) | 3.2 µl | - |
| Midnight Primer Pool B (MP B) | - | 3.2 µl |
| Total | 238.1 µl | 238.1 µl |
For x96 samples:
| Reagent | Midnight Primer Mix 1 | Midnight Primer Mix 1 |
|---|---|---|
| Nuclease-free water | 469.7 µl | 469.7 µl |
| Midnight Primer Pool A (MP A) | 6.4 µl | - |
| Midnight Primer Pool B (MP B) | - | 6.4 µl |
| Total | 476.1 µl | 476.1 µl |
EBRAP master mix preparation
| Reagent | Volume X24 samples | Volume X48 samples | Volume X96 samples |
|---|---|---|---|
| Elution Buffer | 45.5 µl | 57.6 µl | 57.7 µl |
| Rap F | 4.2 µl | 5.3 µl | 5.3 µl |
| Total | 49.7 µl | 62.9 µl | 63 µl |
Hamilton display:

Insert the ComfortLid position as displayed on screen. Click 'Ok' to continue.

Load the microplates and the MIDI plates into the corresponding positions. Click 'Ok' to continue.

Acknowledge the pre-tip loading message to ensure you load all of the tips required the your run. Click 'Ok' to continue.

Load the LVF 50 µl tips into the positions on screen. Click 'Ok' to continue.

Highlight the 50 µl tips available to use on the 'Edit Tip Count' window and click 'Ok' to continue.

Load the SVF 300 µl tips into the positions on screen. Click 'Ok' to continue.

Highlight the 300 µl tips available to use on the 'Edit Tip Count' window and click 'Ok' to continue.

Freshly prepare 8.4 ml of 80% ethanol in nuclease-free water in a trough.
Load the reagent containers with the indicated fill volume for each trough.

Load the HFV 1000 µl tips and insert the input plate of samples into the position on screen. Click 'Ok' to continue.

Highlight the 1000 µl tips available to use on the 'Edit Tip Count' window and click 'Ok' to continue.

Load the CPAC chilled position and following the prompts on screen, load the required volume of reagents into their designated tube positions.

Tube layout in CPAC chilled position:

Note: It is important to throughly pipette mix all the reagents before aliquoting. Take care not to introduce air bubbles as this can cause errors during the automated process.
Once loading has been completed, click 'Ok' to being the run.

If processing more than X48 samples, the PCR amplification step will require two thermal cycler positions. For this reason, the PCR amplification step will need to be carried out on an external thermal cycler.
When reaching the cDNA Amplification PCR step, the Hamilton will display the following message:

- Follow the prompts on-screen.
- Seal the plates and spin them down.
- Place the plates in the thermal cycler and incubate using the following program, with the heated lid set to 105°C:
| Step | Temperature | Time | Cycles |
|---|---|---|---|
| Initial denaturation | 98°C | 30 sec | 1 |
| Denaturation Annealing and extension | 98°C 61°C 65°C | 15 sec 2 min 3 min | 35 |
| Hold | 4°C | ∞ |
- Remove the plates from the thermal cycler and spin down.
Once the cDNA Amplification PCR has been completed (on or off-deck), load the RBK plate (and the PCR plates if required) following the on-screen instructions. Click 'Ok' to continue the run.

Upon successful run completion, the following message is shown. Click 'Ok' to continue.

Select and complete the required post-run steps. Click 'Ok' to continue.

Perform the final checks and select 'OK' to complete the run.

After the run ends, the final library can be collected from the designated position in the MIDI plate. Remove and retain the final elution into a clean 1.5 ml Eppendorf DNA LoBind tube.
Quantify DNA concentration of the final elution by using the Qubit dsDNA HS Assay Kit.
The quantified library is used for loading into the MinION flow cell. Store the library on ice until ready to load.
5. Priming and loading the SpotON Flow Cell
材料
- Flush Buffer (FB)
- Flush Tether (FLT)
- Loading Beads II (LBII)
- Sequencing Buffer II (SBII)
- Loading Solution (LS)
耗材
- 1.5 ml Eppendorf DNA LoBind 离心管
仪器
- MinION device
- SpotON Flow Cell
- MinION/GridION 测序芯片遮光片
- P1000 移液枪和枪头
- P100 移液枪和枪头
- P20 移液枪和枪头
- P10 移液枪和枪头
Priming and loading a flow cell
We recommend all new users watch the 'Priming and loading your flow cell' video before your first run.
Using the Loading Solution
We recommend using the Loading Beads II (LBII) for loading your library onto the flow cell for most sequencing experiments. However, if you have previously used water to load your library, you must use Loading Solution (LS) instead of water. Note: some customers have noticed that viscous libraries can be loaded more easily when not using Loading Beads II.
Thaw the Sequencing Buffer II (SBII), Loading Beads II (LBII) or Loading Solution (LS, if using), Flush Tether (FLT) and Flush Buffer (FB) at room temperature before mixing the reagents by vortexing, and spin down the SBII and FLT at room temperature.
Prepare the flow cell priming mix in a suitable vial for the number of flow cells to flush. Once combined, mix well by briefly vortexing.
| Reagent | Volume per flow cell |
|---|---|
| Flush Tether (FLT) | 30 µl |
| Flush Buffer (FB) | 1,170 µl |
Open the MinION device lid and slide the flow cell under the clip. Press down firmly on the priming port cover to ensure correct thermal and electrical contact.
Press down firmly on the flow cell to ensure correct thermal and electrical contact.
Complete a flow cell check to assess the number of pores available before loading the library.
This step can be omitted if the flow cell has been checked previously.
See the flow cell check instructions in the MinKNOW protocol for more information.
Slide the priming port cover clockwise to open the priming port.
Take care when drawing back buffer from the flow cell. Do not remove more than 20-30 µl, and make sure that the array of pores are covered by buffer at all times. Introducing air bubbles into the array can irreversibly damage pores.
After opening the priming port, check for a small air bubble under the cover. Draw back a small volume to remove any bubbles:
- Set a P1000 pipette to 200 µl
- Insert the tip into the priming port
- Turn the wheel until the dial shows 220-230 µl, to draw back 20-30 µl, or until you can see a small volume of buffer entering the pipette tip
Note: Visually check that there is continuous buffer from the priming port across the sensor array.

Load 800 µl of the priming mix into the flow cell via the priming port, avoiding the introduction of air bubbles. Wait for five minutes. During this time, prepare the library for loading by following the steps below.

Thoroughly mix the contents of the Loading Beads II (LBII) by pipetting.
The Loading Beads II (LBII) tube contains a suspension of beads. These beads settle very quickly. It is vital that they are mixed immediately before use.
In a new tube, prepare the library for loading as follows:
| Reagent | Volume per flow cell |
|---|---|
| Sequencing Buffer II (SBII) | 37.5 µl |
| Loading Beads II (LBII) mixed immediately before use, or Loading Solution (LS), if using | 25.5 µl |
| DNA library | 12 µl |
| Total | 75 µl |
Note: Load the library onto the flow cell immediately after adding the Sequencing Buffer II (SBII) and Loading Beads II (LBII) because the fuel in the buffer will start to be consumed by the adapter.
Complete the flow cell priming:
- Gently lift the SpotON sample port cover to make the SpotON sample port accessible.
- Load 200 µl of the priming mix into the flow cell priming port (not the SpotON sample port), avoiding the introduction of air bubbles.

Mix the prepared library gently by pipetting up and down just prior to loading.
Add 75 μl of the prepared library to the flow cell via the SpotON sample port in a dropwise fashion. Ensure each drop flows into the port before adding the next.

Gently replace the SpotON sample port cover, making sure the bung enters the SpotON port and close the priming port.

Install the light shield on your flow cell as soon as library has been loaded for optimal sequencing output.
We recommend leaving the light shield on the flow cell when library is loaded, including during any washing and reloading steps. The shield can be removed when the library has been removed from the flow cell.
Place the light shield onto the flow cell, as follows:
Carefully place the leading edge of the light shield against the clip. Note: Do not force the light shield underneath the clip.
Gently lower the light shield onto the flow cell. The light shield should sit around the SpotON cover, covering the entire top section of the flow cell.

The MinION Flow Cell Light Shield is not secured to the flow cell and careful handling is required after installation.
Close the device lid and set up a sequencing run on MinKNOW.
6. Data acquisition and basecalling
Overview of nanopore data analysis
For a full overview of nanopore data analysis, which includes options for basecalling and post-basecalling analysis, please refer to the Data Analysis document.
Required settings in MinKNOW
The correct barcoding parameters must be set up on MinKNOW prior to the sequencing run. During the run setup, in the Analysis tab:
- Enable Barcoding.
- Select Edit options.
- Enable Mid-read barcode filtering.
- Enable Override minimum barcoding score and set the value to 60.
- Enable Override minimum mid-read barcoding score and set the value to 50.


How to start sequencing
The sequencing device control, data acquisition and real-time basecalling are carried out by the MinKNOW software. Please ensure MinKNOW is installed on your computer or device. There are multiple options for how to carry out sequencing:
1. Data acquisition and basecalling in real-time using MinKNOW on a computer
Follow the instructions in the MinKNOW protocol beginning from the "Starting a sequencing run" section until the end of the "Completing a MinKNOW run" section.
2. Data acquisition and basecalling in real-time using the MinION Mk1B/Mk1D device
Follow the instructions in the MinION Mk1B user manual or the MinION Mk1D user manual.
3. Data acquisition and basecalling in real-time using the MinION Mk1C device
Follow the instructions in the MinION Mk1C user manual.
4. Data acquisition and basecalling in real-time using the GridION device
Follow the instructions in the GridION user manual.
5. Data acquisition and basecalling in real-time using the PromethION device
Follow the instructions in the PromethION user manual or the PromethION 2 Solo user manual.
6. Data acquisition using MinKNOW on a computer and basecalling at a later time using MinKNOW
Follow the instructions in the MinKNOW protocol beginning from the "Starting a sequencing run" section until the end of the "Completing a MinKNOW run" section. When setting your experiment parameters, set the Basecalling tab to OFF. After the sequencing experiment has completed, follow the instructions in the Post-run analysis section of the MinKNOW protocol.
7. Downstream analysis
Recommended pipeline analysis
The wf-artic is a bioinformatics workflow for the analysis of ARTIC sequencing data prepared using the Midnight protocol. The bioinformatics workflow is orchestrated by the Nextflow software. Nextflow is a publicly available and open-source project that enables the execution of scientific workflows in a scalable and reproducible way. The software is natively supported on the GridION device and can be simply installed on most Linux computers and servers. The installation is outlined later in the document.
The Midnight analysis uses the ARTIC bioinformatics workflow.
Demultiplexed sequence reads are processed using the ARTIC FieldBioinformatics software that has been subtly modified for the analysis of FASTQ sequences prepared using Oxford Nanopore rapid sequencing kits. The other modification to the ARTIC workflow is the use of a primer scheme that defines the sequencing primers used by the Midnight protocol and their genomic locations on the SARS-CoV-2 genome.
The wf-artic workflow includes other analytical steps that include cladistic analysis using Nextclade and strain assignment using Pangolin. The data facets included in the report are parameterised and additional information such as plots of depth-of-coverage across the reference genome is optional.
The complete source for wf-artic is linked and the Nextflow software will download the scripts and logic flow from this location.
On GridION devices, the wf-artic workflow will start automatically after sequencing. However, on other devices, this will have to be started manually as outlined further on this page under 'Running a Midnight analysis'.
Software set up and installation
The wf-artic workflow requires the Nextflow and Docker software to have been installed. The EPI2ME quickstart guide provides instructions for the installation of these requirements for GridION, PromethION and general Ubuntu Linux users and provides a little more introduction to the Nextflow software.
Automatic start on GridION:
To set up the Midnight analysis to start automatically after sequencing on GridION, select the Rapid Barcoding Kit 96 (SQK-RBK110.96) kit with the Midnight RT PCR Expansion (EXP-MRT001) pack on MinKNOW when setting up a sequencing run.
When the workflow has finished, the relevant analysis files will be available in the following output folder:
processing/artic/artic_DATE_TIME_67195e17
Post-run analysis on GridION:
The Midnight analysis can also be started post-run on GridION:
- On the start page, click 'Analysis'
- Click 'Workflow'
- From the dropdown menu, select 'post_processing/artic/artic'
- Select your input folder with the sequencing data and the location for the output folder

Using Linux command line:
The wf-artic workflow can be run from the Linux command line. The workflow can be installed or updated with the command:
$ nextflow pull epi2me-labs/wf-artic
Demultiplexing of multiple barcoded samples
The wf-artic requires FASTQ format sequence data that has already been demultiplexed. Sequences can either be demultiplexed directly in the MinKNOW software or as a post-sequencing step by the guppy_barcoder software provided by the Guppy software.
The Midnight protocol uses a rapid barcoding kit; it is therefore important to note that the demultiplexing step must not require barcodes at both ends of the sequence.
The expected input for wf-artic is a folder of folders as shown below. Each of the barcode folders should contain the FASTQ sequence data and files may either be uncompressed or gzipped.
$ tree -d MidnightFastq/
MidnightFastq/
├── barcode01
├── barcode02
├── barcode03
├── barcode04
├── barcode05
├── barcode06
└── unclassified
Running a Midnight analysis
The reference command for running a Midnight analysis is as follows. The parameters are explained further on in the document.
nextflow run epi2me-labs/wf-artic \
--scheme_name SARS-CoV-2 \
--scheme_version V1200 \
--min_len 200 \
--max_len 1100 \
--out_dir PATH_TO_OUTPUT \
--fastq PATH_TO_FASTQ_PASS \
-work-dir PATH_TO_INTERMEDIATE_FILES
Type the command into you linux terminal and press enter.

Nextflow will describe the analysis as it progresses; the figure above shows an example run from a 48-plex analysis. We can see which processes have completed and the processes that are still running and or queued.
Parameter definitions
nextflow run epi2me-labs/wf-articAn instruction to use the Nextflow software to run a workflow, which is further explained here.--scheme_name SARS-CoV-2An instruction for the ARTIC software to use the primer scheme that corresponds to the amplicons tiled across the whole SARS-CoV-2 genome.--scheme_version V1200This defines the version of the ARTIC primers to use. The Midnight protocol uses the primer set refered to as V1200.–-min_len 200This sets the minimum allowed sequence length as 200 nucleotides.–-max_len 1100This sets the maximum allowed sequence length as 1100 nucleotides.--out_dir PATH_TO_OUTPUTThis instructs the Nextflow software where the results should be stored; please change PATH_TO_OUTPUT to the location on your computer where files should be stored.--fastq PATH_TO_FASTQ_PASSThis instructs Nextflow which sequences should be used in the analysis. Please changePATH_TO_FASTQ_PASSto an existingfastq_passfolder from a Midnight run.-work_dir PATH TO WORK DIRECTORYPlease note the single hyphen; this is a Nextflow parameter. This defines where the intermediate files are stored. This folder may contain a significant amount of information; please see the section on housekeeping.
Other command line parameters
Other commands and options can be provided to the Nextflow command:
--samplesThis describes a sample file that links barcode identifier with sample names. These sample names will be reported in the HTML format report and in the CSV file of genotypes. The sample file should be a comma-delimited file and must contain the column names barcode andsample_name.--helpThis will display the help-file which describes the available parameters and other information on default values and their meanings.--medaka_modelThis defines the model that should be used by the Medaka software for variant calling (and thus consensus preparation).
Basecalling model
If you are basecalling using a FAST model, then this should be changed to reflect the appropriate model and version of Guppy used.
- Default model used: r941_min_hac_variant_g507.
- If you have used FAST basecalling, please use: r941_min_fast_variant_g507.
- If HAC basecalling was performed using an earlier version of MinKNOW, please use: r941_min_high_g360.
Result files
Results will be written to the location specified by the --out_dir parameter. These output results include:
all_consensus.fastaA multi-FASTA format sequence file containing the consensus sequence for each of the samples investigated. This consensus sequence has been prepared for the whole SARS-CoV-2 genome, not just the spike protein region. The consensus sequence masks the non-spike regions and regions of low sequence coverage with N residues.all_variants.vcf.gzA gzipped VCF file that describes all high-quality genetic variants called by medaka from the sequenced samples.all_variants.vcf.gz.tbiAn index file for the gzipped VCF file.consensus_status.txtA tab delimited file that reports whether a consensus sequence has been successfully prepared for a sample, or not.wf-artic-report.htmlA report summarising these data. This HTML format report also includes the output of the Nextclade software that can be used for a visual inspection of, for example, primer drop out or other qualitative consensus sequence aspects.
Other files are included in the work-directory. This includes per sample VCF files of all genetic variants prior to filtering and other sequences.
Housekeeping and disk usage
The nextflow parameter, -work-dir, was introduced as a parameter to define where the workflow intermediate files are stored. This folder will accumulate a significant number of files that correspond to raw BAM files and other larger intermediates. We recommend this folder to be routinely cleared.
Updating the wf-artic software
Updated versions of the wf-artic software may be released and an alert to the availability of newer workflow versions will be noted by the Nextflow software at run-time.
To update the software:
nextflow pull epi2me-labs/wf-artic
It may be necessary to first delete the cached workflow files. This can be achieved with the command:
nextflow drop -f epi2me-labs/wf-artic
8. Flow cell reuse and returns
材料
- 测序芯片清洗剂盒(EXP-WSH004)
After your sequencing experiment is complete, if you would like to reuse the flow cell, please follow the Flow Cell Wash Kit protocol and store the washed flow cell at +2°C to +8°C.
The Flow Cell Wash Kit protocol is available on the Nanopore Community.
We recommend you to wash the flow cell as soon as possible after you stop the run. However, if this is not possible, leave the flow cell on the device and wash it the next day.
Alternatively, follow the returns procedure to send the flow cell back to Oxford Nanopore.
Instructions for returning flow cells can be found here.
If you encounter issues or have questions about your sequencing experiment, please refer to the Troubleshooting Guide that can be found in the online version of this protocol.
9. Issues during DNA/RNA extraction and library preparation
Below is a list of the most commonly encountered issues, with some suggested causes and solutions.
We also have an FAQ section available on the Nanopore Community Support section.
If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.
Low sample quality
| Observation | Possible cause | Comments and actions |
|---|---|---|
| Low DNA purity (Nanodrop reading for DNA OD 260/280 is <1.8 and OD 260/230 is <2.0–2.2) | The DNA extraction method does not provide the required purity | The effects of contaminants are shown in the Contaminants document. Please try an alternative extraction method that does not result in contaminant carryover. Consider performing an additional SPRI clean-up step. |
| Low RNA integrity (RNA integrity number <9.5 RIN, or the rRNA band is shown as a smear on the gel) | The RNA degraded during extraction | Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page. |
| RNA has a shorter than expected fragment length | The RNA degraded during extraction | Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page. We recommend working in an RNase-free environment, and to keep your lab equipment RNase-free when working with RNA. |
Low DNA recovery after AMPure bead clean-up
| Observation | Possible cause | Comments and actions |
|---|---|---|
| Low recovery | DNA loss due to a lower than intended AMPure beads-to-sample ratio | 1. AMPure beads settle quickly, so ensure they are well resuspended before adding them to the sample. 2. When the AMPure beads-to-sample ratio is lower than 0.4:1, DNA fragments of any size will be lost during the clean-up. |
| Low recovery | DNA fragments are shorter than expected | The lower the AMPure beads-to-sample ratio, the more stringent the selection against short fragments. Please always determine the input DNA length on an agarose gel (or other gel electrophoresis methods) and then calculate the appropriate amount of AMPure beads to use. ![]() |
| Low recovery after end-prep | The wash step used ethanol <70% | DNA will be eluted from the beads when using ethanol <70%. Make sure to use the correct percentage. |
10. Issues during the sequencing run
Below is a list of the most commonly encountered issues, with some suggested causes and solutions.
We also have an FAQ section available on the Nanopore Community Support section.
If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.
Fewer pores at the start of sequencing than after Flow Cell Check
| Observation | Possible cause | Comments and actions |
|---|---|---|
| MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check | An air bubble was introduced into the nanopore array | After the Flow Cell Check it is essential to remove any air bubbles near the priming port before priming the flow cell. If not removed, the air bubble can travel to the nanopore array and irreversibly damage the nanopores that have been exposed to air. The best practice to prevent this from happening is demonstrated in this video. |
| MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check | The flow cell is not correctly inserted into the device | Stop the sequencing run, remove the flow cell from the sequencing device and insert it again, checking that the flow cell is firmly seated in the device and that it has reached the target temperature. If applicable, try a different position on the device (GridION/PromethION). |
| MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check | Contaminations in the library damaged or blocked the pores | The pore count during the Flow Cell Check is performed using the QC DNA molecules present in the flow cell storage buffer. At the start of sequencing, the library itself is used to estimate the number of active pores. Because of this, variability of about 10% in the number of pores is expected. A significantly lower pore count reported at the start of sequencing can be due to contaminants in the library that have damaged the membranes or blocked the pores. Alternative DNA/RNA extraction or purification methods may be needed to improve the purity of the input material. The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover. |
MinKNOW script failed
| Observation | Possible cause | Comments and actions |
|---|---|---|
| MinKNOW shows "Script failed" | Restart the computer and then restart MinKNOW. If the issue persists, please collect the MinKNOW log files and contact Technical Support. If you do not have another sequencing device available, we recommend storing the flow cell and the loaded library at 4°C and contact Technical Support for further storage guidance. |
Pore occupancy below 40%
| Observation | Possible cause | Comments and actions |
|---|---|---|
| Pore occupancy <40% | Not enough library was loaded on the flow cell | Ensure you load the recommended amount of good quality library in the relevant library prep protocol onto your flow cell. Please quantify the library before loading and calculate mols using tools like the Promega Biomath Calculator, choosing "dsDNA: µg to pmol" |
| Pore occupancy close to 0 | The Ligation Sequencing Kit was used, and sequencing adapters did not ligate to the DNA | Make sure to use the NEBNext Quick Ligation Module (E6056) and Oxford Nanopore Technologies Ligation Buffer (LNB, provided in the sequencing kit) at the sequencing adapter ligation step, and use the correct amount of each reagent. A Lambda control library can be prepared to test the integrity of the third-party reagents. |
| Pore occupancy close to 0 | The Ligation Sequencing Kit was used, and ethanol was used instead of LFB or SFB at the wash step after sequencing adapter ligation | Ethanol can denature the motor protein on the sequencing adapters. Make sure the LFB or SFB buffer was used after ligation of sequencing adapters. |
| Pore occupancy close to 0 | No tether on the flow cell | Tethers are adding during flow cell priming (FLT/FCT tube). Make sure FLT/FCT was added to FB/FCF before priming. |
Shorter than expected read length
| Observation | Possible cause | Comments and actions |
|---|---|---|
| Shorter than expected read length | Unwanted fragmentation of DNA sample | Read length reflects input DNA fragment length. Input DNA can be fragmented during extraction and library prep. 1. Please review the Extraction Methods in the Nanopore Community for best practice for extraction. 2. Visualise the input DNA fragment length distribution on an agarose gel before proceeding to the library prep. In the image above, Sample 1 is of high molecular weight, whereas Sample 2 has been fragmented.3. During library prep, avoid pipetting and vortexing when mixing reagents. Flicking or inverting the tube is sufficient. |
Large proportion of unavailable pores
| Observation | Possible cause | Comments and actions |
|---|---|---|
Large proportion of unavailable pores (shown as blue in the channels panel and pore activity plot) The pore activity plot above shows an increasing proportion of "unavailable" pores over time. | Contaminants are present in the sample | Some contaminants can be cleared from the pores by the unblocking function built into MinKNOW. If this is successful, the pore status will change to "sequencing pore". If the portion of unavailable pores stays large or increases: 1. A nuclease flush using the Flow Cell Wash Kit (EXP-WSH004) can be performed, or 2. Run several cycles of PCR to try and dilute any contaminants that may be causing problems. |
Large proportion of inactive pores
| Observation | Possible cause | Comments and actions |
|---|---|---|
| Large proportion of inactive/unavailable pores (shown as light blue in the channels panel and pore activity plot. Pores or membranes are irreversibly damaged) | Air bubbles have been introduced into the flow cell | Air bubbles introduced through flow cell priming and library loading can irreversibly damage the pores. Watch the Priming and loading your flow cell video for best practice |
| Large proportion of inactive/unavailable pores | Certain compounds co-purified with DNA | Known compounds, include polysaccharides, typically associate with plant genomic DNA. 1. Please refer to the Plant leaf DNA extraction method. 2. Clean-up using the QIAGEN PowerClean Pro kit. 3. Perform a whole genome amplification with the original gDNA sample using the QIAGEN REPLI-g kit. |
| Large proportion of inactive/unavailable pores | Contaminants are present in the sample | The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover. |
Reduction in sequencing speed and q-score later into the run
| Observation | Possible cause | Comments and actions |
|---|---|---|
| Reduction in sequencing speed and q-score later into the run | For Kit 9 chemistry (e.g. SQK-LSK109), fast fuel consumption is typically seen when the flow cell is overloaded with library (please see the appropriate protocol for your DNA library to see the recommendation). | Add more fuel to the flow cell by following the instructions in the MinKNOW protocol. In future experiments, load lower amounts of library to the flow cell. |
Temperature fluctuation
| Observation | Possible cause | Comments and actions |
|---|---|---|
| Temperature fluctuation | The flow cell has lost contact with the device | Check that there is a heat pad covering the metal plate on the back of the flow cell. Re-insert the flow cell and press it down to make sure the connector pins are firmly in contact with the device. If the problem persists, please contact Technical Services. |
Failed to reach target temperature
| Observation | Possible cause | Comments and actions |
|---|---|---|
| MinKNOW shows "Failed to reach target temperature" | The instrument was placed in a location that is colder than normal room temperature, or a location with poor ventilation (which leads to the flow cells overheating) | MinKNOW has a default timeframe for the flow cell to reach the target temperature. Once the timeframe is exceeded, an error message will appear and the sequencing experiment will continue. However, sequencing at an incorrect temperature may lead to a decrease in throughput and lower q-scores. Please adjust the location of the sequencing device to ensure that it is placed at room temperature with good ventilation, then re-start the process in MinKNOW. Please refer to this link for more information on MinION temperature control. |
Guppy – no input .fast5 was found or basecalled
| Observation | Possible cause | Comments and actions |
|---|---|---|
| No input .fast5 was found or basecalled | input_path did not point to the .fast5 file location | The --input_path has to be followed by the full file path to the .fast5 files to be basecalled, and the location has to be accessible either locally or remotely through SSH. |
| No input .fast5 was found or basecalled | The .fast5 files were in a subfolder at the input_path location | To allow Guppy to look into subfolders, add the --recursive flag to the command |
Guppy – no Pass or Fail folders were generated after basecalling
| Observation | Possible cause | Comments and actions |
|---|---|---|
| No Pass or Fail folders were generated after basecalling | The --qscore_filtering flag was not included in the command | The --qscore_filtering flag enables filtering of reads into Pass and Fail folders inside the output folder, based on their strand q-score. When performing live basecalling in MinKNOW, a q-score of 7 (corresponding to a basecall accuracy of ~80%) is used to separate reads into Pass and Fail folders. |
Guppy – unusually slow processing on a GPU computer
| Observation | Possible cause | Comments and actions |
|---|---|---|
| Unusually slow processing on a GPU computer | The --device flag wasn't included in the command | The --device flag specifies a GPU device to use for accelerate basecalling. If not included in the command, GPU will not be used. GPUs are counted from zero. An example is --device cuda:0 cuda:1, when 2 GPUs are specified to use by the Guppy command. |

In the image above, Sample 1 is of high molecular weight, whereas Sample 2 has been fragmented.
The pore activity plot above shows an increasing proportion of "unavailable" pores over time.