Main menu

Rapid sequencing DNA - Viral metagenomics for respiratory samples and skin lesion swabs (SQK-RPB004) (VMM_9160_v1_revG_11Mar2026)


1. Overview of the protocol

This is a Legacy product.

This product has been discontinued. Should you require any assistance or have questions, please contact our Customer Support: support@nanoporetech.com.

Introduction to the protocol

This protocol has been developed by Adela Alcolea-Medina, Prof. Jonathan Edgeworth and colleagues, with support from Oxford Nanopore Technologies (Novel, rapid metagenomic method to detect emerging viral pathogens applied to human monkeypox infections by Alcolea-Medina *et al.,* 2022). It outlines a rapid method to perform metagenomic sequencing from extracted DNA and RNA from routine nasopharyngeal swab samples in viral transport media to identify viral pathogens. This method has also been used to sequence the virus currently known as mpox from skin lesion swabs (in viral transport media) of diagnosed patients, demonstrating an alternative sample site is compatible with this protocol. However, further work is required to assess and validate different sample sites and types.

While this protocol is available in the Nanopore Community, we kindly ask users to ensure they are citing the authors of the paper who have been behind the development of these methods.

This method uses random hexamers and oligo-dT primers to synthesis cDNA strands from RNA within the sample. Subsequently, the Rapid PCR Barcoding kit (SQK-RPB004) is used to amplify the DNA present from the sample alongside the cDNA strands. During development, typically three samples per patient were pooled together after the PCR and clean-up step before sequencing the sample on a single flow cell.

We recommend users follow their local health and safety recommendations when handling samples. Confirmed mpox samples were used for the development of this method and were handled in a Containment Level 3 (CL3) facility.

Steps in the sequencing workflow:

Prepare for your experiment You will need to:

  • Extract your DNA/RNA. An example extraction method is provided in this protocol but other options are available if preferred
  • Ensure you have your sequencing kit, the correct equipment and third-party reagents required
  • Download the software for acquiring and analysing your data
  • Check your flow cell to ensure it has enough pores for a good sequencing run

Library preparation You will need to:

  • Prepare full-length cDNAs via reverse transcription and 2nd strand synthesis
  • Tagment your DNA using the Fragmentation Mix in the kit
  • Amplify the sample by PCR using the barcoded primers supplied in the kit
  • Attach the sequencing adapters supplied in the kit to the DNA ends
  • Prime the flow cell, and load your DNA library into the flow cell

Sequencing and analysis You will need to:

  • Start a sequencing run of 48 hours using the MinKNOW software, which will collect raw data from the device and convert it into basecalled reads.
  • For samples positive for mpox using the wf-mpx, after removing human/host reads, users should expect a significant part of all their reads to be the mpox virus and the remainder of reads typically being the flora found at the sample sites.

Compatibility of this protocol

This protocol should only be used in combination with:

  • Rapid PCR Barcoding Kit (SQK-RPB004)
  • R9.4.1 flow cells (FLO-MIN106)
  • Flow Cell Wash Kit (EXP-WSH004)
  • RAP Top-Up Kit (EXP-RAP001)
  • Sequencing Auxiliary Vials (EXP-AUX001)

2. Equipment and consumables

Material
  • Nasopharyngeal or skin lesion swab in viral transport media
  • Rapid PCR Barcoding Kit (SQK-RPB004)

Consumibles
  • Lysing Matrix D, 2 ml tube (MP Biomedical, cat # 116913050-CF)
  • HL-SAN nuclease (ArcticZymes Technologies, cat #70910-202)
  • MagNA Pure Bacteria Lysis Buffer (Roche, cat # 04659180001)
  • Microesferas Agencourt AMPure XP (Beckman Coulter™, A63881)
  • Etanol al 70 % recién preparado en agua sin nucleasas
  • LunaScript™ RT SuperMix Kit (NEB, cat # E3010)
  • Applied Biosystems™ Sequenase Version 2.0 DNA Polymerase (Thermo Fisher, cat # 15809896)
  • Agua sin nucleasas (p. ej., ThermoFisher, AM9937)
  • Kit Qubit dsDNA HS (Invitrogen Q32851)
  • Tubos Qubit™ Assay (Invitrogen, Q32856)
  • LongAmp Taq 2X Master Mix (e.g. NEB, cat # M0287)
  • 10 mM Tris-HCl pH 8.0 with 50 mM NaCl
  • 0.2 ml PCR tubes
  • Tubos Eppendorf DNA LoBind de 1,5 ml

Instrumental
  • TissueLyser LT (QIAGEN, cat # 85600)
  • Hula mixer (mezclador de rotación suave)
  • Thermomixer (Eppendorf, Cat# 5382000031)
  • Gradilla magnética
  • Microcentrífuga
  • Pipeta y puntas P1000
  • Pipeta y puntas P200
  • Pipeta y puntas P100
  • Pipeta y puntas P20
  • Pipeta y puntas P10
  • Pipeta y puntas P2
  • Cubeta con hielo
  • Temporizador
  • Fluorímetro Qubit™ (o equivalente)

For this metagenomic protocol, you will need to extract your RNA/DNA from the clinical sample in viral transport media and take forward 1–5 ng high molecular weight genomic DNA into the library preparation step.

Clinical sample swabs should be collected in viral transport media to maintain the viral sample for extraction.

During development of this method, primarily nasopharyngeal swabs were tested. However, swabs from skin lesions were also found to yield virus in patients diagnosed with mpox, suggesting swabs from multiple sites can be used with this method to detect for presence of a virus.

Input RNA and DNA

How to QC your input DNA/RNA

It is important that the input meets the quantity and quality requirements. Using too little or too much DNA/RNA, or DNA/RNA of poor quality (e.g. highly fragmented or containing chemical contaminants) can affect your library preparation.

For instructions on how to perform quality control of your DNA sample, please read the Input DNA/RNA QC protocol.

Chemical contaminants


DNA input

Depending on how the DNA is extracted from the raw sample, certain chemical contaminants may remain in the purified DNA, which can effect library preparation efficiency and sequencing quality.

For further information on using DNA as input, please read the links below:


RNA input

It is important that the input RNA meets the quantity and quality requirements for highest library preparation efficiency and sequencing quality.

For further information on using RNA as input, please read the links below.

These documents can also be found in the DNA/RNA Handling page.

Third-party reagents

We have validated and recommend the use of all the third-party reagents used in this protocol. Alternatives have not been tested by Oxford Nanopore Technologies.

For all third-party reagents, we recommend following the manufacturer's instructions to prepare the reagents for use.

Rapid PCR Barcoding Kit (SQK-RPB004) contents

rpb004 v1

Name Acronym Cap colour No. of vials Fill volume per vial (µl)
Fragmentation Mix FRM Brown 3 30
Rapid Adapter RAP Green 1 10
Sequencing Buffer SBQ Red 1 300
Loading Beads LB Pink 1 360
Rapid Barcode Primer 1-12 RLB 01-12 Clear 12 10

Please note that the Sequencing Tether (SQT) tube will NOT be used in this protocol.

Flow Cell Priming Kit (EXP-FLP002) contents

FLP

Name Acronym Cap colour No. of vial Fill volume per vial (μl)
Flush Buffer FB Blue 6 1,170
Flush Tether FLT Purple 1 200

Rapid Barcode Primer sequences

Component Sequence
RLB01 AAGAAAGTTGTCGGTGTCTTTGTG
RLB02 TCGATTCCGTTTGTAGTCGTCTGT
RLB03 GAGTCTTGTGTCCCAGTTACCAGG
RLB04 TTCGGATTCTATCGTGTTTCCCTA
RLB05 CTTGTCCAGGGTTTGTGTAACCTT
RLB06 TTCTCGCAAAGGCAGAAAGTAGTC
RLB07 GTGTTACCGTGGGAATGAATCCTT
RLB08 TTCAGGGAACAAACCAAGTTACGT
RLB09 AACTAGGCACAGCGAGTCTTGGTT
RLB10 AAGCGTTGAAACCTTTGTCCTCTC
RLB11 GTTTCATCTATCGGAGGGAATGGA
RLB12A GTTGAGTTACAAAGCACCGATCAG

The RAP Top-Up Kit (EXP-RAP001) is available to provide enough reagents for another six reactions depending on how the barcodes are used.

This kit contains reagents to be used with any remaining barcodes to load another six sequencing libraries.

EXP-RAP001 tubes

Reagent Acronym Cap colour No. of vials Fill volume per vial (µl)
Rapid Adapter RAP Green 1 10
Sequencing Tether SQT Purple 1 10
Loading Beads LB Pink 1 360
Sequencing Buffer SQB Red 1 300

3. Computer requirements and software

MinION Mk1B IT requirements

Sequencing on a MinION Mk1B requires a high-spec computer or laptop to keep up with the rate of data acquisition. For more information, refer to the MinION Mk1B IT requirements document.

MinION Mk1C IT requirements

The MinION Mk1C contains fully-integrated compute and screen, removing the need for any accessories to generate and analyse nanopore data. For more information refer to the MinION Mk1C IT requirements document.

MinION Mk1D IT requirements

Sequencing on a MinION Mk1D requires a high-spec computer or laptop to keep up with the rate of data acquisition. For more information, refer to the MinION Mk1D IT requirements document.

Software for nanopore sequencing

MinKNOW

The MinKNOW software controls the nanopore sequencing device, collects sequencing data and basecalls in real time. You will be using MinKNOW for every sequencing experiment to sequence, basecall and demultiplex if your samples were barcoded.

For instructions on how to run the MinKNOW software, please refer to the MinKNOW protocol.

EPI2ME (optional)

The EPI2ME cloud-based platform performs further analysis of basecalled data, for example alignment to the Lambda genome, barcoding, or taxonomic classification. You will use the EPI2ME platform only if you would like further analysis of your data post-basecalling.

For instructions on how to create an EPI2ME account and install the EPI2ME Desktop Agent, please refer to this link.

Check your flow cell

We highly recommend that you check the number of pores in your flow cell prior to starting a sequencing experiment. This should be done within 12 weeks of purchasing for MinION/GridION/PromethION or within four weeks of purchasing Flongle Flow Cells. Oxford Nanopore Technologies will replace any flow cell with fewer than the number of pores in the table below, when the result is reported within two days of performing the flow cell check, and when the storage recommendations have been followed. To do the flow cell check, please follow the instructions in the Flow Cell Check document.

Flow cell Minimum number of active pores covered by warranty
Flongle Flow Cell 50
MinION/GridION Flow Cell 800
PromethION Flow Cell 5000

4. RNA/DNA extraction

Material
  • Nasopharyngeal or skin lesion swab in viral transport media

Consumibles
  • Lysing Matrix D, 2 ml tube (MP Biomedical, cat # 116913050-CF)
  • HL-SAN nuclease (ArcticZymes Technologies, cat #70910-202)
  • MagNA Pure Bacteria Lysis Buffer (Roche, cat # 04659180001)
  • Microesferas Agencourt AMPure XP (Beckman Coulter™, A63881)
  • Etanol al 70 % recién preparado en agua sin nucleasas
  • Tubos Eppendorf DNA LoBind de 1,5 ml

Instrumental
  • TissueLyser LT (QIAGEN, cat # 85600)
  • Hula mixer (mezclador de rotación suave)
  • Gradilla magnética
  • Thermomixer (Eppendorf, Cat# 5382000031)
  • Microcentrífuga
  • Pipeta y puntas P1000
  • Pipeta y puntas P200
  • Pipeta y puntas P100
  • Pipeta y puntas P20
  • Pipeta y puntas P10
  • Pipeta y puntas P2

The sample extraction step must be carried out at the contaminant level of the local health and safety recommendations.

Prepare the HL-SAN nuclease and MagNA Pure Bacteria Lysis Buffer according to the manufacturer's recommendations.

Transfer 500 µl of the clinical sample in viral transport medium into a Lysing Matrix D 2 ml tube to bead-beat for 3 minutes at 50 oscillations/second in the TissueLyser LT.

Transfer 200 µl of the sample to a clean 1.5 ml Eppendorf DNA LoBind tube.

Add 10 µl of HL-SAN nuclease to the sample.

Mix well by pipetting and spin down.

Incubate at 37°C for 10 minutes at 1000 rpm in a thermomixer.

Add 200 µl of MagNA Pure Bacterial Lysis Buffer to the reaction.

Mix well by pipetting and spin down.

Incubate at room temperature for 10 minutes.

Resuspend the AMPure XP beads by vortexing.

Add 400 µl of resuspended AMPure XP beads to the reaction and mix by pipetting.

Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.

Prepare 500 μl of fresh 70% ethanol in nuclease-free water.

Spin down the sample and pellet on a magnet until supernatant is clear and colourless. Keep the tube on the magnet, and pipette off the supernatant.

Keep the tube on the magnet and wash the beads with 200 µl of freshly prepared 70% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.

Repeat the previous step.

Spin down and place the tube back on the magnet. Pipette off any residual ethanol. Allow to dry for ~30 seconds, but do not dry the pellet to the point of cracking.

Remove the tube from the magnetic rack and resuspend the pellet in 60 µl of nuclease-free water. Incubate for 2 minutes at room temperature.

Pellet the beads on the magnet until the eluate is clear and colourless.

Remove and retain 50 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.

Dispose of the pelleted beads.

Inactivate the sample by heat-treating for 1 hour at 60°C, depending on local health and safety recommendations.

Take the extracted RNA/DNA sample forward into the cDNA synthesis step.

From this point, we recommend to keep the sample on ice as much as possible to prevent nucleolytic degradation.

5. cDNA synthesis

Material
  • 16 µl of extracted sample

Consumibles
  • LunaScript™ RT SuperMix Kit (NEB, cat # E3010)
  • Applied Biosystems™ Sequenase Version 2.0 DNA Polymerase (Thermo Fisher, cat # 15809896)
  • Agua sin nucleasas (p. ej., ThermoFisher, AM9937)
  • Microesferas Agencourt AMPure XP (Beckman Coulter™, A63881)
  • Etanol al 70 % recién preparado en agua sin nucleasas
  • Kit Qubit dsDNA HS (Invitrogen Q32851)
  • Tubos Eppendorf DNA LoBind de 1,5 ml
  • Tubos de PCR de pared fina, 0,2 ml
  • Tubos Qubit™ Assay (Invitrogen, Q32856)

Instrumental
  • Microcentrífuga
  • Termociclador
  • Hula mixer (mezclador de rotación suave)
  • Gradilla magnética
  • Pipeta y puntas P1000
  • Pipeta y puntas P200
  • Pipeta y puntas P100
  • Pipeta y puntas P20
  • Pipeta y puntas P10
  • Pipeta y puntas P2
  • Fluorímetro Qubit™ (o equivalente)

Keep the RNA sample on ice as much as possible to prevent nucleolytic degradation.

For further information on how to handle RNA, please see the DNA/RNA Handling tab for best practices.

Prepare the LunaScript™ RT SuperMix Kit and Sequenase Version 2.0 DNA Polymerase according to the manufacturer's recommendations.

In a clean 0.2 ml thin-walled PCR tube, combine the reagents in the following order:

Reagent Volume
Extracted sample 16 µl
LunaScript™ RT SuperMix 4 µl
Total 20 µl

Gently pipette mix and spin down the reaction.

Incubate the sample(s) in the thermal cycler using the following program:

Step Temperature Time Cycles
Primer annealing 25°C 2 minutes 1
cDNA synthesis 55°C 10 minutes 1
Heat inactivation 95°C 1 minute 1
Hold 4°C -

In a clean 1.5 ml Eppendorf DNA LoBind tube, prepare the first Sequenase master mix by combining the reagents as follows:

Reagent Volume per sample
5X Sequenase reaction buffer 2 µl
Nuclease-free water 7.7 µl
Sequenase Version 2.0 DNA Polymerase 0.3 µl
Total 10 µl

Mix well by pipette mixing and spin down.

Add 10 µl of Sequenase master mix to the sample.

Mix well by pipette mixing and spin down.

Incubate the reaction at 37°C for 8 minutes.

In a clean 1.5 ml Eppendorf DNA LoBind tube, prepare the second Sequenase master mix as follows:

Reagent Volume
Sequenase Dilution Buffer 0.9 µl
Sequenase Version 2.0 DNA Polymerase 0.3 µl
Total 1.2 µl

Mix well by pipette mixing and spin down.

Add 1.2 µl of the second Sequenase master mix to the sample.

Mix well by pipette mixing and spin down.

Incubate the reaction at 37°C for 8 minutes.

Transfer the sample to a clean 1.5 ml Eppendorf DNA LoBind tube.

Resuspend the AMPure XP beads by vortexing.

Add 45 µl of resuspended AMPure XP beads to the reaction and mix by gently pipetting.

Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.

Prepare 500 μl of fresh 70% ethanol in nuclease-free water.

Spin down the sample and pellet on a magnet until supernatant is clear and colourless. Keep the tube on the magnet, and pipette off the supernatant.

Keep the tubes on the magnet and wash the beads in each well with 200 µl of freshly prepared 70% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.

Repeat the previous step.

Spin down and place the tubes back on the magnet. Pipette off any residual ethanol. Allow to dry for ~30 seconds, but do not dry the pellet to the point of cracking.

Remove the tube from the magnetic rack and resuspend the pellet in 15 µl nuclease-free water. Incubate for 2 minutes at room temperature.

Pellet the beads on a magnet until the eluate is clear and colourless.

Remove and retain 10 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.

Dispose of the pelleted beads.

Quantify 1 µl of each eluted sample using a Qubit fluorometer.

Take forward 3 μl of 1–5 ng DNA forward into the tagmentation step.

Library storage recommendations

We recommend storing libraries in Eppendorf DNA LoBind tubes at -20°C for short term storage or repeated use, for example, re-loading flow cells between washes. For single use and long term storage of more than 3 months, we recommend storing libraries at -80°C in Eppendorf DNA LoBind tubes.

6. Library preparation

Material
  • Rapid Barcode Primers (RLB01-12A, at 10 µM)
  • Fragmentation Mix (FRM)
  • Rapid Adapter (RAP)

Consumibles
  • LongAmp Taq 2X Master Mix (e.g. NEB, cat # M0287)
  • 10 mM Tris-HCl pH 8.0 with 50 mM NaCl (e.g. Fisher Scientific, Cat# NC1877767)
  • Microesferas Agencourt AMPure XP (Beckman Coulter™, A63881)
  • Agua sin nucleasas (p. ej., ThermoFisher, AM9937)
  • Etanol al 70 % recién preparado en agua sin nucleasas
  • Kit Qubit dsDNA HS (Invitrogen Q32851)
  • Tubos Eppendorf DNA LoBind de 1,5 ml
  • Tubos de PCR de pared fina, 0,2 ml
  • Tubos Qubit™ Assay (Invitrogen, Q32856)

Instrumental
  • Microcentrífuga
  • Termociclador
  • Cubeta con hielo
  • Pipeta y puntas P1000
  • Pipeta y puntas P200
  • Pipeta y puntas P100
  • Pipeta y puntas P20
  • Pipeta y puntas P2
  • Fluorímetro Qubit™ (o equivalente)

DNA tagmentation

Thaw the following reagents, then spin down briefly using a microfuge and mix as indicated in the table below. Then place the reagents on ice.

| Reagent | 1. Thaw | 2. Mix well by pipetting | 3. Briefly spin down | | --- | --- | --- | --- | --- | | Rapid Barcode Primers (RBL 01-12A) | At room temperature | ✓ | ✓ | | Fragmentation Mix (FRM) | Not frozen | ✓ | ✓ | | Rapid Adapter | Not frozen | ✓ | ✓ |

Prepare the LongAmp Taq 2X Master Mix according to the manufacturer's recommendations and prepare at least 20 µl of 10 mM Tris-HCl pH 8.0 with 50 mM NaCl.

In a 0.2 ml thin-walled PCR tube, mix the following:

Reagent Volume
1-5 ng template DNA 3 μl
Fragmentation Mix (FRM) 1 μl
Total 4 μl

Mix gently by flicking the tube, and spin down.

In a thermal cycler, incubate the tube at 30° C for 1 minute and then at 80° C for 1 minute. Briefly put the tube on ice to cool it down.

PCR and clean-up

Set up a PCR reaction as follows in a 0.2 ml thin-walled PCR tube:

Reagent Volume
Nuclease-free water 20 µl
Tagmented DNA 4 µl
RLB (01-12A, at 10 µM) 1 µl
LongAmp Taq 2X master mix
25 µl
Total 50 µl

If the amount of input material is altered, the number of PCR cycles may need to be adjusted to produce the same yield.

Mix gently by pipetting and spin down.

Amplify using the following cycling conditions:

Cycle step Temperature Time No. of cycles
Initial denaturation 95°C 3 mins 1
Denaturation 95°C 15 secs 30
Annealing 56°C 15 secs 30
Extension 65°C 4 mins 30
Final extension 65°C 4 mins 1
Hold 4°C

Transfer the sample to a clean 1.5 ml Eppendorf DNA LoBind tube.

Resuspend the AMPure XP beads by vortexing.

Add 30 µl of resuspended AMPure XP beads to the reaction and mix by pipetting.

Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.

Prepare 500 μl of fresh 70% ethanol in nuclease-free water.

Spin down the sample and pellet on a magnet. Keep the tube on the magnet, and pipette off the supernatant when clear and colourless.

Keep the tube on the magnet and wash the beads with 200 µl of freshly prepared 70% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.

Repeat the previous step.

Spin down and place the tube back on the magnet. Pipette off any residual ethanol. Allow to dry for ~30 seconds, but do not dry the pellet to the point of cracking.

Remove the tube from the magnetic rack and resuspend pellet in 10 µl of 10 mM Tris-HCl pH 8.0 with 50 mM NaCl. Incubate for 2 minutes at room temperature.

Pellet the beads on a magnet until the eluate is clear and colourless.

Remove and retain 10 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.

  • Dispose of the pelleted beads

Quantify 1 µl of eluted sample using a Qubit fluorometer.

Pool all barcoded libraries in the desired ratios to a total of 50-100 fmoles in 10 μl of 10 mM Tris-HCl pH 8.0 with 50 mM NaCl.

Adapter attachment

Add 1 μl of RAP to the barcoded DNA.

Mix gently by flicking the tube, and spin down.

Incubate the reaction for 5 minutes at room temperature.

The prepared library is used for loading into the flow cell. Store the library on ice until ready to load.

7. Priming and loading the SpotON Flow Cell

Material
  • Flow Cell Priming Kit (EXP-FLP002)
  • Sequencing Buffer (SQB)
  • Loading Beads (LB)

Consumibles
  • Tubos Eppendorf DNA LoBind de 1,5 ml
  • Agua sin nucleasas (p.ej. Thermo Scientific, AM9937)

Instrumental
  • MinION device
  • SpotON Flow Cell
  • MinION/GridION Flow Cell Light Shield
  • Pipeta y puntas P1000
  • Pipeta y puntas P100
  • Pipeta y puntas P20
  • Pipeta y puntas P10

Priming and loading a MinION flow cell

We recommend all new users watch the 'Priming and loading your flow cell' video before your first run.

Thaw the Sequencing Buffer (SQB), Loading Beads (LB), Flush Tether (FLT) and one tube of Flush Buffer (FB) at room temperature before mixing the reagents by vortexing, and spin down at room temperature.

To prepare the flow cell priming mix, add 30 µl of thawed and mixed Flush Tether (FLT) directly to the tube of thawed and mixed Flush Buffer (FB), and mix by vortexing at room temperature.

Open the MinION device lid and slide the flow cell under the clip. Press down firmly on the priming port cover to ensure correct thermal and electrical contact.

Press down firmly on the flow cell to ensure correct thermal and electrical contact.

Flow Cell Loading Diagrams Step 1a

Flow Cell Loading Diagrams Step 1b

Complete a flow cell check to assess the number of pores available before loading the library.

This step can be omitted if the flow cell has been checked previously.

See the flow cell check instructions in the MinKNOW protocol for more information.

Slide the priming port cover clockwise to open the priming port.

Flow Cell Loading Diagrams Step 2

Take care when drawing back buffer from the flow cell. Do not remove more than 20-30 µl, and make sure that the array of pores are covered by buffer at all times. Introducing air bubbles into the array can irreversibly damage pores.

After opening the priming port, check for a small air bubble under the cover. Draw back a small volume to remove any bubbles:

  1. Set a P1000 pipette to 200 µl
  2. Insert the tip into the priming port
  3. Turn the wheel until the dial shows 220-230 µl, to draw back 20-30 µl, or until you can see a small volume of buffer entering the pipette tip

Note: Visually check that there is continuous buffer from the priming port across the sensor array.

Flow Cell Loading Diagrams Step 03 V5

Load 800 µl of the priming mix into the flow cell via the priming port, avoiding the introduction of air bubbles. Wait for five minutes. During this time, prepare the library for loading by following the steps below.

Flow Cell Loading Diagrams Step 04 V5

Thoroughly mix the contents of the Loading Beads (LB) tubes by vortexing.

Using the Loading Beads

Demo of how to use the Loading Beads.

In a new tube, prepare the library for loading as follows:

Reagent Volume per flow cell
Sequencing Buffer (SQB) 34 µl
Loading Beads (LB), mixed immediately before use 25.5 µl
Nuclease-free water 4.5 µl
DNA library 11 µl
Total 75 µl

The Loading Beads (LB) tube contains a suspension of beads. These beads settle very quickly. It is vital that they are mixed immediately before use.

Complete the flow cell priming:

  1. Gently lift the SpotON sample port cover to make the SpotON sample port accessible.
  2. Load 200 µl of the priming mix into the flow cell priming port (not the SpotON sample port), avoiding the introduction of air bubbles.

Flow Cell Loading Diagrams Step 5

Flow Cell Loading Diagrams Step 06 V5

Mix the prepared library gently by pipetting up and down just prior to loading.

Add 75 μl of the prepared library to the flow cell via the SpotON sample port in a dropwise fashion. Ensure each drop flows into the port before adding the next.

Flow Cell Loading Diagrams Step 07 V5

Gently replace the SpotON sample port cover, making sure the bung enters the SpotON port and close the priming port.

Step 8 update

Flow Cell Loading Diagrams Step 9

Install the light shield on your flow cell as soon as library has been loaded for optimal sequencing output.

We recommend leaving the light shield on the flow cell when library is loaded, including during any washing and reloading steps. The shield can be removed when the library has been removed from the flow cell.

Place the light shield onto the flow cell, as follows:

  1. Carefully place the leading edge of the light shield against the clip. Note: Do not force the light shield underneath the clip.

  2. Gently lower the light shield onto the flow cell. The light shield should sit around the SpotON cover, covering the entire top section of the flow cell.

J2264 - Light shield animation Flow Cell FAW optimised

The MinION Flow Cell Light Shield is not secured to the flow cell and careful handling is required after installation.

Close the device lid and set up a sequencing run on MinKNOW.

8. Data acquisition and basecalling

Overview of nanopore data analysis

For a full overview of nanopore data analysis, which includes options for basecalling and post-basecalling analysis, please refer to the Data Analysis document.

How to start sequencing

The sequencing device control, data acquisition and real-time basecalling are carried out by the MinKNOW software. Please ensure MinKNOW is installed on your computer or device before starting.

Data acquisition and basecalling in real-time using MinKNOW on a computer

For references, please refer to the MinKNOW protocol.

Instructions on how to carry out sequencing:

  1. Double-click the MinKNOW icon on the desktop to open the MinKNOW GUI and log in with your nanopore community credentials
  2. With the MinION connected to the computer select the sequencing device connected
  3. On the Start homepage, select 'Start Sequencing' and complete the run parameters for the experiment
  4. Provide an experiment name: we recommend using the date for the run
  5. Provide a Sample ID for the run
  6. Select the type of flow cell being used from the drop-down menu and continue to kit selection
  7. Select the kit used to prepare the libraries: SQK-RPB004
  8. Set the run time to 48 hours. However, samples positive for mpox will likely show a positive result after ~8 hours
  9. Select 'Continue to Basecalling'
  10. Select 'High accuracy basecalling' (HAC)
  11. Check 'Barcoding' on
  12. Select the output data location, format and filtering options. Output data is typically saved as FAST5 and/or FASTQ
  13. Continue to 'Run Setup'
  14. Start run
  15. Navigate to 'Sequencing Overview' to monitor the run

9. Downstream analysis

Post-basecalling analysis for the mpox virus

The wf-mpx workflow provides a basic analysis of mpox sequencing data whether targeted or metagenomics.

This workflow can be performed on commandline or through EPI2ME Labs, giving users basic QC tools, a draft consensus sequence for review, a draft assembly and SNP context.

Please note, the workflow does not perform adapter or primer trimming. This means if targeted protocols are used, there could be artefacts at these sites.

Post-basecalling analysis for viral metagenomics

Please note that Oxford Nanopore Technologies does not currently offer a dedicated workflow for viral metagenomics analysis, meaning users will need to use or adapt third-party tools suitable for this application. However, we do offer a wf-metagenomics workflow but requires users to specify a custom database e.g. Kraken2 Metagenomic Virus Database.

For general post-basecalling data analysis options, please see the list below:

1. EPI2ME platform

The EPI2ME platform is a cloud-based data analysis service developed by Metrichor Ltd., a subsidiary of Oxford Nanopore Technologies. The EPI2ME platform offers a range of analysis workflows, e.g. for metagenomic identification, barcoding, alignment, and structural variant calling. The FastQ WIMP (Human + Viral) workflow compares sequence reads against a comprehensive corpus of virus genome sequences. This can be used to assign sequence reads to known viruses or to provide taxonomic hints for novel virus sequences that may be detected from metagenomics samples. The analysis requires no additional equipment or compute power, and provides an easy-to-interpret report with the results. For instructions on how to run an analysis workflow in EPI2ME, please follow the instructions in the EPI2ME protocol, beginning at the "Starting data analysis" step.

2. EPI2ME Labs tutorials and workflows

For more in-depth data analysis, Oxford Nanopore Technologies offers a range of bioinformatics tutorials and workflows available in EPI2ME Labs, which are available in the EPI2ME Labs section of the Community. The platform provides a vehicle where workflows deposited in GitHub by our Research and Applications teams can be showcased with descriptive texts, functional bioinformatics code and example data.

For identifying viral sequence reads from metagenomic samples, we would recommend our wf-metagenomics workflow. This nextflow-based analysis pipeline uses the kraken2 software to assign sequence reads to an organism (or virus) of origin. The bracken software considers the kraken2 results and prepares a quantitative view of the species observed within a metagenomic sample. A few different databases suitable for this workflow are maintained by the author and are publicly available at the Kraken 2 and Bracken indexes page.

3. Research analysis tools

Oxford Nanopore Technologies' Research division has created a number of analysis tools, which are available in the Oxford Nanopore GitHub repository. The tools are aimed at advanced users, and contain instructions for how to install and run the software. They are provided as-is, with minimal support.

The marine phage scripts repository includes a collection of python scripts that have been used in the recovery, identification and annotation of marine virus genomes from metagenomic samples. The scripts available here could be further adapted for more general viral metagenomic requirements.

4. Community-developed analysis tools

If a data analysis method for your research question is not provided in any of the resources above, please refer to the Bioinformatics section of the Resource centre. Numerous members of the Nanopore Community have developed their own tools and pipelines for analysing nanopore sequencing data, most of which are available on GitHub. Please be aware that these tools are not supported by Oxford Nanopore Technologies, and are not guaranteed to be compatible with the latest chemistry/software configuration.

10. Ending the experiment

Alternatively, follow the returns procedure to send the flow cell back to Oxford Nanopore.

Instructions for returning flow cells can be found here.

If you encounter issues or have questions about your sequencing experiment, please refer to the Troubleshooting Guide that can be found in the online version of this protocol.

11. Issues during DNA/RNA extraction and library preparation

Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

We also have an FAQ section available on the Nanopore Community Support section.

If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

Low sample quality

Observation Possible cause Comments and actions
Low DNA purity (Nanodrop reading for DNA OD 260/280 is <1.8 and OD 260/230 is <2.0–2.2) The DNA extraction method does not provide the required purity The effects of contaminants are shown in the Contaminants document. Please try an alternative extraction method that does not result in contaminant carryover.

Consider performing an additional SPRI clean-up step.
Low RNA integrity (RNA integrity number <9.5 RIN, or the rRNA band is shown as a smear on the gel) The RNA degraded during extraction Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page.
RNA has a shorter than expected fragment length The RNA degraded during extraction Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page.

We recommend working in an RNase-free environment, and to keep your lab equipment RNase-free when working with RNA.

Low DNA recovery after AMPure bead clean-up

Observation Possible cause Comments and actions
Low recovery DNA loss due to a lower than intended AMPure beads-to-sample ratio 1. AMPure beads settle quickly, so ensure they are well resuspended before adding them to the sample.

2. When the AMPure beads-to-sample ratio is lower than 0.4:1, DNA fragments of any size will be lost during the clean-up.
Low recovery DNA fragments are shorter than expected The lower the AMPure beads-to-sample ratio, the more stringent the selection against short fragments. Please always determine the input DNA length on an agarose gel (or other gel electrophoresis methods) and then calculate the appropriate amount of AMPure beads to use. SPRI cleanup
Low recovery after end-prep The wash step used ethanol <70% DNA will be eluted from the beads when using ethanol <70%. Make sure to use the correct percentage.

12. Issues during the sequencing run

Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

We also have an FAQ section available on the Nanopore Community Support section.

If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

Fewer pores at the start of sequencing than after Flow Cell Check

Observation Possible cause Comments and actions
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check An air bubble was introduced into the nanopore array After the Flow Cell Check it is essential to remove any air bubbles near the priming port before priming the flow cell. If not removed, the air bubble can travel to the nanopore array and irreversibly damage the nanopores that have been exposed to air. The best practice to prevent this from happening is demonstrated in this video.
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check The flow cell is not correctly inserted into the device Stop the sequencing run, remove the flow cell from the sequencing device and insert it again, checking that the flow cell is firmly seated in the device and that it has reached the target temperature. If applicable, try a different position on the device (GridION/PromethION).
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check Contaminations in the library damaged or blocked the pores The pore count during the Flow Cell Check is performed using the QC DNA molecules present in the flow cell storage buffer. At the start of sequencing, the library itself is used to estimate the number of active pores. Because of this, variability of about 10% in the number of pores is expected. A significantly lower pore count reported at the start of sequencing can be due to contaminants in the library that have damaged the membranes or blocked the pores. Alternative DNA/RNA extraction or purification methods may be needed to improve the purity of the input material. The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

MinKNOW script failed

Observation Possible cause Comments and actions
MinKNOW shows "Script failed"
Restart the computer and then restart MinKNOW. If the issue persists, please collect the MinKNOW log files and contact Technical Support. If you do not have another sequencing device available, we recommend storing the flow cell and the loaded library at 4°C and contact Technical Support for further storage guidance.

Pore occupancy below 40%

Observation Possible cause Comments and actions
Pore occupancy <40% Not enough library was loaded on the flow cell Ensure you load the recommended amount of good quality library in the relevant library prep protocol onto your flow cell. Please quantify the library before loading and calculate mols using tools like the Promega Biomath Calculator, choosing "dsDNA: µg to pmol"
Pore occupancy close to 0 The Ligation Sequencing Kit was used, and sequencing adapters did not ligate to the DNA Make sure to use the NEBNext Quick Ligation Module (E6056) and Oxford Nanopore Technologies Ligation Buffer (LNB, provided in the sequencing kit) at the sequencing adapter ligation step, and use the correct amount of each reagent. A Lambda control library can be prepared to test the integrity of the third-party reagents.
Pore occupancy close to 0 The Ligation Sequencing Kit was used, and ethanol was used instead of LFB or SFB at the wash step after sequencing adapter ligation Ethanol can denature the motor protein on the sequencing adapters. Make sure the LFB or SFB buffer was used after ligation of sequencing adapters.
Pore occupancy close to 0 No tether on the flow cell Tethers are adding during flow cell priming (FLT/FCT tube). Make sure FLT/FCT was added to FB/FCF before priming.

Shorter than expected read length

Observation Possible cause Comments and actions
Shorter than expected read length Unwanted fragmentation of DNA sample Read length reflects input DNA fragment length. Input DNA can be fragmented during extraction and library prep.

1. Please review the Extraction Methods in the Nanopore Community for best practice for extraction.

2. Visualise the input DNA fragment length distribution on an agarose gel before proceeding to the library prep. DNA gel2 In the image above, Sample 1 is of high molecular weight, whereas Sample 2 has been fragmented.

3. During library prep, avoid pipetting and vortexing when mixing reagents. Flicking or inverting the tube is sufficient.

Large proportion of unavailable pores

Observation Possible cause Comments and actions
Large proportion of unavailable pores (shown as blue in the channels panel and pore activity plot)

image2022-3-25 10-43-25 The pore activity plot above shows an increasing proportion of "unavailable" pores over time.
Contaminants are present in the sample Some contaminants can be cleared from the pores by the unblocking function built into MinKNOW. If this is successful, the pore status will change to "sequencing pore". If the portion of unavailable pores stays large or increases:

1. A nuclease flush using the Flow Cell Wash Kit (EXP-WSH004) can be performed, or
2. Run several cycles of PCR to try and dilute any contaminants that may be causing problems.

Large proportion of inactive pores

Observation Possible cause Comments and actions
Large proportion of inactive/unavailable pores (shown as light blue in the channels panel and pore activity plot. Pores or membranes are irreversibly damaged) Air bubbles have been introduced into the flow cell Air bubbles introduced through flow cell priming and library loading can irreversibly damage the pores. Watch the Priming and loading your flow cell video for best practice
Large proportion of inactive/unavailable pores Certain compounds co-purified with DNA Known compounds, include polysaccharides, typically associate with plant genomic DNA.

1. Please refer to the Plant leaf DNA extraction method.
2. Clean-up using the QIAGEN PowerClean Pro kit.
3. Perform a whole genome amplification with the original gDNA sample using the QIAGEN REPLI-g kit.
Large proportion of inactive/unavailable pores Contaminants are present in the sample The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

Reduction in sequencing speed and q-score later into the run

Observation Possible cause Comments and actions
Reduction in sequencing speed and q-score later into the run For Kit 9 chemistry (e.g. SQK-LSK109), fast fuel consumption is typically seen when the flow cell is overloaded with library (please see the appropriate protocol for your DNA library to see the recommendation). Add more fuel to the flow cell by following the instructions in the MinKNOW protocol. In future experiments, load lower amounts of library to the flow cell.

Temperature fluctuation

Observation Possible cause Comments and actions
Temperature fluctuation The flow cell has lost contact with the device Check that there is a heat pad covering the metal plate on the back of the flow cell. Re-insert the flow cell and press it down to make sure the connector pins are firmly in contact with the device. If the problem persists, please contact Technical Services.

Failed to reach target temperature

Observation Possible cause Comments and actions
MinKNOW shows "Failed to reach target temperature" The instrument was placed in a location that is colder than normal room temperature, or a location with poor ventilation (which leads to the flow cells overheating) MinKNOW has a default timeframe for the flow cell to reach the target temperature. Once the timeframe is exceeded, an error message will appear and the sequencing experiment will continue. However, sequencing at an incorrect temperature may lead to a decrease in throughput and lower q-scores. Please adjust the location of the sequencing device to ensure that it is placed at room temperature with good ventilation, then re-start the process in MinKNOW. Please refer to this link for more information on MinION temperature control.

Guppy – no input .fast5 was found or basecalled

Observation Possible cause Comments and actions
No input .fast5 was found or basecalled input_path did not point to the .fast5 file location The --input_path has to be followed by the full file path to the .fast5 files to be basecalled, and the location has to be accessible either locally or remotely through SSH.
No input .fast5 was found or basecalled The .fast5 files were in a subfolder at the input_path location To allow Guppy to look into subfolders, add the --recursive flag to the command

Guppy – no Pass or Fail folders were generated after basecalling

Observation Possible cause Comments and actions
No Pass or Fail folders were generated after basecalling The --qscore_filtering flag was not included in the command The --qscore_filtering flag enables filtering of reads into Pass and Fail folders inside the output folder, based on their strand q-score. When performing live basecalling in MinKNOW, a q-score of 7 (corresponding to a basecall accuracy of ~80%) is used to separate reads into Pass and Fail folders.

Guppy – unusually slow processing on a GPU computer

Observation Possible cause Comments and actions
Unusually slow processing on a GPU computer The --device flag wasn't included in the command The --device flag specifies a GPU device to use for accelerate basecalling. If not included in the command, GPU will not be used. GPUs are counted from zero. An example is --device cuda:0 cuda:1, when 2 GPUs are specified to use by the Guppy command.
Oxford Nanopore Technologies, the Wheel icon, AmPORE-TB, EPI2ME, GridION, MinION, MinKNOW, PromethION, P2 Solo, and P2 are registered trademarks or the subject of trademark applications of Oxford Nanopore Technologies plc in various countries. Information contained herein may be protected by copyright, patents or patents pending of Oxford Nanopore Technologies plc. All other brands and names contained are the property of their respective owners. Oxford Nanopore Technologies products are RUO. Products labelled/branded as Oxford Nanopore Diagnostics may be RUO or may be regulated as in‐vitro diagnostic devices in some jurisdictions, please check individual product labelling. ONT plc is a member of the producer compliance scheme run by ERP UK Ltd, who manage the submission of documentation in support of WEEE compliance for ONT plc’s manufacture and supply of Electrical and Electronic equipment in the UK. ONT’s WEEE PRN is WEE/MM3828AA.

Last updated: 5/7/2026

Opciones de documento

MinION
Idioma:

Getting started

Buy a MinION starter pack Nanopore store Sequencing service providers Channel partners

Quick links

Intellectual property Cookie policy Corporate reporting Privacy policy Terms, conditions and policies Modern slavery policy Accessibility

About Oxford Nanopore

Contact us News Media resources & contacts Investor centre Careers BSI 27001 accreditationBSI 90001 accreditation
Spanish flag