Secuenciación de ADN por ligación V14 (SQK-LSK114) (1) (T2T_9222_v114_revB_02Dec2025)
PromethION: Protocol
Secuenciación de ADN por ligación V14 (SQK-LSK114) (1) V T2T_9222_v114_revB_02Dec2025
- Recomendamos a todos los clientes que lean y tengan en cuenta la información contenida en la hoja informativa Kit sequencing and duplex basecalling.
- Este protocolo utiliza ADN genómico o amplicón de ADN
- Tiempo de preparación de la biblioteca: 60 min
- Fragmentación optativa
- Sin PCR
- Compatible con las celdas de flujo R10.4.1
Para uso exclusivo en investigación
FOR RESEARCH USE ONLY.
Contents
Introduction to the protocol
Library preparation
- 3. Reconstituting oligos
- 4. Pre-hybridisation of the telo-adapters and splint, and preparation of the telo-splint mix
- 5. Telomere adapter ligation
- 6. Digestion and dA-tailing of non-telomeric gDNA
- 7. Splint annealing and clean-up
- 8. Adapter ligation and clean-up
- 9. Priming and loading the PromethION Flow Cell
Sequencing and data analysis
- 10. Data acquisition
- 11. Downstream analysis
- 12. Example performance for Telo-Seq
- 13. Flow cell reuse and returns
Troubleshooting
Descripción general
- Recomendamos a todos los clientes que lean y tengan en cuenta la información contenida en la hoja informativa Kit sequencing and duplex basecalling.
- Este protocolo utiliza ADN genómico o amplicón de ADN
- Tiempo de preparación de la biblioteca: 60 min
- Fragmentación optativa
- Sin PCR
- Compatible con las celdas de flujo R10.4.1
Para uso exclusivo en investigación
1. Overview of the protocol
Introduction to the Telo-Seq protocol
This protocol describes how to carry out native telomere sequencing using the platform developed by Oxford Nanopore Technologies. Telo-Seq delivers single-telomere resolution at high throughput, enabling the multiplexing from 4 to up to 12 samples in a single run. The method captures the telomeric ends (including the sub-telomeric regions) as long fragments, allowing for chromosome arm placement.
It is designed to be used with custom-ordered telomere sequence adapters and custom-ordered telomere splints. The protocol leverages the Native Barcoding Auxiliary Kit V14 (EXP-NBA114), the Sequencing Auxiliary Vials V14 (EXP-AUX003), and the Ultra-Long Auxiliary Vials (EXP-ULA001).
For more information on telomere sequencing and the method described in this protocol, please see our Telo-Seq know-how document.
Steps in the sequencing workflow
Prepare for your experiment
You will need to:
- Extract your DNA, and check its length, quantity and purity. Performing quality checks on your DNA prior to its use in Telo-Seq is essential in ensuring experimental success.
- Ensure you have your sequencing kit, the correct equipment and third-party reagents.
- Ensure you have ordered the required custom-ordered oligos for telomere adapters and splints.
- Download the software for acquiring and analysing your data.
- Check your flow cell to ensure it has enough pores for a good sequencing run.
Library preparation
The Table below is an overview of the steps required in the library preparation, including timings and optional stopping points.
| Library preparation | Process | Time | Stop option |
|---|---|---|---|
| Pre-hybridisation of telomere adapters and splints | Pre-hybridise each of your telomere adapters and their corresponding splint, in preparation for use with your samples. This improves Telo-Seq performance. | Hands on time: 15 minutes Incubation time: 75 minutes | Store at -20°C when not being used |
| Telo-splint mix preparation | Prepare your mixture of telo-splints for use during splint annealing. | 10 minutes | Store at -20°C when not being used |
| Telomere adapter ligation | Ligate the intermediate telomere adapter to the 3' telomeric overhang. | Hands on time: 15 minutes Incubation time: 16 hours 10 minutes | 4°C overnight |
| Digestion of non-telomeric gDNA | Use the restriction enzyme to digest most of the chromosome, leaving the telomere and sub-telomere intact. | Hands on time: 10 minutes Incubation time: 50 minutes | 4°C overnight |
| 3'dA tailing of non-telomeric gDNA | Non-telomeric gDNA are 3'dA tailed to prevent ligation in subsequent steps. | Hands on time: 10 minutes Incubation time: 30 minutes | 4°C overnight |
| Sample pooling and splint annealing | Pool your samples together and perform splint annealing. Note: During the previous steps, the pre-hybridised splint may dissociate. Re-annealing the splint strands helps maximise library performance and consistency. | Hands on time: 10 minutes Incubation time: 60 minutes | 4°C overnight |
| Adapter ligation and clean-up | Attach the sequencing adapters to the telomeric DNA ends. | 60 minutes | We recommend sequencing your library as soon as it is adapted. DNA library can be stored at 4°C for short-term storage or for repeated use (such as re-loading your flow cell). DNA library can be stored at -80°C for long-term storage. |
| Priming and loading the flow cell | Prime the flow cell and load the prepared library for sequencing. | 10 minutes |
Sequencing and analysis
You will need to:
- Start a sequencing run using the MinKNOW software which will collect raw data from the device.
- Basecall and demultiplex your sequencing data using Dorado and command line.
- Analyse your Telo-Seq data using the wf-teloseq workflow via EPI2ME or command line to count telomere reads and estimate telomere length.
Compatibility of this protocol
This protocol should only be used in combination with:
- Native Barcoding Auxiliary Kit V14 (EXP-NBA114)
- Sequencing Auxiliary Vials V14 (EXP-AUX003)
- Ultra-Long Auxiliary Vials (EXP-ULA001)
- Long fragment buffer expansion (EXP-LFB001)
- R10.4.1 PromethION Flow Cells (FLO-PRO114M)
- PromethION 24/48 device - PromethION IT requirements document
2. Equipment and consumables
Material
- At least 60 µg high molecular weight genomic DNA between all your samples (this will equate to 5 µg – 15 µg per sample, depending on number of sample inputs)
- Custom-ordered telo-adapter oligos (TA01-TA12)
- Custom-ordered telo-splint oligos (TS01-TS12)
- Native Barcoding Expansion V14 (EXP-NBA114)
- Ultra-Long Auxiliary Vials (EXP-ULA001)
- LFB Expansion (EXP-LFB001)
- Material complementario Sequencing Auxiliary Vials V14 (EXP-AUX003)
Consumibles
- Celdas de flujo PromethION
- Agua sin nucleasas (p.ej. Thermo Scientific, AM9937)
- NaCl 5 M (Sigma, 71386)
- 1M Tris-HCl, pH 7.5 (Thermo scientific 15567027)
- EDTA 0,5 M, pH 8 (Thermo Scientific, R1021)
- 1X TE buffer (Fisher Scientific, 12090015)
- 10X rCutSmart™ Buffer (NEB, B6004S)
- 10 mM rATP solution, 10 mM (NEB P0756S)
- Ligasa de ADN Salt-T4® (NEB, M0467)
- EcoRV-HF® 20,000 units/ml (NEB, R3195 S/L)
- NEBNext® dA-Tailing Module (NEB, E6053)
- 1M NaCl (from Salt-T4 DNA ligase NEB M0467L)
- NEBNext® Quick Ligation Reaction Buffer (NEB, B6058)
- Microesferas Agencourt AMPure XP (Beckman Coulter™, A63881)
- Tubos Qubit™ Assay (Invitrogen, Q32856)
- Kit Qubit dsDNA BR (Invitrogen, Q32850)
- Tubos Eppendorf DNA LoBind de 1,5 ml
- Tubos de PCR de pared fina, 0,2 ml
Instrumental
- Dispositivo PromethION
- Pantalla protectora celdas de flujo PromethION
- Hula mixer (mezclador de rotación suave)
- Gradilla magnética, apta para tubos Eppendorf de 1,5 ml
- Microcentrífuga
- Mezclador vórtex
- Termociclador
- Thermomixer or heat block
- Pipeta y puntas P1000
- Pipeta y puntas P200
- Pipeta y puntas P100
- Pipeta y puntas P20
- Pipeta y puntas P10
- Pipeta y puntas P2
- Cubeta con hielo
- Temporizador
- Fluorímetro Qubit™ (o equivalente)
- Centrifugadora Eppendorf 5424 (o equivalente)
Equipo opcional
- Bioanalizador Agilent (o equivalente)
For this protocol, you will need a total input of at least 60 µg of high molecular weight genomic DNA (HMW gDNA). This can be spread across all of your samples/barcodes.
For example:
| Number of samples/barcodes used | Input requirement per sample/barcode |
|---|---|
| 4 | 15 µg |
| 6 | 10 µg |
| 12 | 5 µg |
Note: Please note that an input of less than 60 µg into the library preparation will not yield sufficient DNA library to fill your flow cell, resulting in reduced telomeric output.
Additionally, we recommend performing at least a 4-plex even if the DNA is from the same origin. If you are only running one sample, or subsets smaller than 4 samples, we recommend splitting these across at least 4 barcodes with 15 µg input into each.
Please refer to the input mass and multiplexing section of the Telo-Seq know-how document for more details.
Input DNA
Input DNA fragment distribution
Optimal performance is observed in samples with longer mean fragment size.
We have found that the presence of fragments <10 kb is detrimental to performance, while samples with a mean fragment size >20 kb will perform well.
If there is a high proportion (>10%) of fragments <10 kb in your sample(s), we recommend performing a size selection of HMW DNA using Short Fragment Eliminator (EXP-SFE001) method. Please refer to the correcting sub-optimal fragment distribution section of the Telo-Seq know-how document for more details.
We recommend using the following methods for DNA extraction for use in with the telo-seq protocol:
- Qiagen® Puregene Cell Kit (Qiagen, 158043)
- Monarch® HMW DNA Extraction Kit for Cells & Blood (NEB, T3050) using an agitation speed of 300 rpm to preserve longer DNA fragments.
We do not recommend the following extraction methods for use with the Telo-seq protocol, as they yield DNA with a high proportion of fragments smaller than 10 kb, leading to reduced performance:
- Qiagen DNeasy Blood & Tissue Kit (Qiagen, 69504)
- Qiagen Genomic-tip (Qiagen, 10243)
Please note, alternative methods are available but have not been tested by Oxford Nanopore Technologies.
Please refer to the achieving optimal fragment distribution section of the Telo-Seq know-how document for more details.
How to QC your input DNA It is important that the input DNA meets the quantity and quality requirements. Using too little or too much DNA, or DNA of poor quality (e.g. highly fragmented or containing RNA or chemical contaminants) can affect your library preparation.
For instructions on how to perform quality control of your DNA sample, please read the Input DNA/RNA QC protocol.
Chemical contaminants Depending on how the DNA is extracted from the raw sample, certain chemical contaminants may remain in the purified DNA, which can affect library preparation efficiency and sequencing quality. Read more about contaminants on the Contaminants page of the Community.
Agencourt AMPure XP beads
Additional Agencourt AMPure XP beads are required alongside the AMPure XP Beads (AXP) provided in the Native Barcoding Auxiliary Kit V14 (EXP-NBA114) for the digestion and dA-tailing of non-telomeric gDNA and the splint annealing and clean-up steps of the protocol.
Third-party reagents
We have validated and recommend the use of all the third-party reagents used in this protocol. Alternatives have not been tested by Oxford Nanopore Technologies.
For all third-party reagents, we recommend following the manufacturer's instructions to prepare the reagents for use.
Custom-ordered oligo sequences
Order the following HPLC-purified oligos. Resuspend to 100 μM in TE buffer for use in the protocol:
Note: The barcoded telo-adapters and telo-splints are only compatible with their corresponding numbered counterpart (e.g. TA01 with TS01, TA02 with TS02, etc). Please ensure you are using the correct barcoded pairs during the pre-hybridisation steps.
Telo-adapters (TA01 - TA12)
| Oligo name | Sequence |
|---|---|
| Telo-adapter 1 (TA01) | /5Phos/AAGGTTAACACAAAGACACCGACAACTTTCTTCCCTAACC |
| Telo-adapter 2 (TA02) | /5Phos/AAGGTTAAAAGGTTACACAAACCCTGGACAAGCCCTAACC |
| Telo-adapter 3 (TA03) | /5Phos/AAGGTTAAAAGGATTCATTCCCACGGTAACACCCCTAACC |
| Telo-adapter 4 (TA04) | /5Phos/AAGGTTAAGAGAGGACAAAGGTTTCAACGCTTCCCTAACC |
| Telo-adapter 5 (TA05) | /5Phos/AAGGTTAATCCGATTCTGCTTCTTTCTACCTGCCCTAACC |
| Telo-adapter 6 (TA06) | /5Phos/AAGGTTAAAGAACGACTTCCATACTCGTGTGACCCTAACC |
| Telo-adapter 7 (TA07) | /5Phos/AAGGTTAACGTCAACTGACAGTGGTTCGTACTCCCTAACC |
| Telo-adapter 8 (TA08) | /5Phos/AAGGTTAACCAAACCCAACAACCTAGATAGGCCCCTAACC |
| Telo-adapter 9 (TA09) | /5Phos/AAGGTTAACCAGTAGAAGTCCGACAACGTCATCCCTAACC |
| Telo-adapter 10 (TA10) | /5Phos/AAGGTTAAGGAGTTCGTCCAGAGAAGTACACGCCCTAACC |
| Telo-adapter 11 (TA11) | /5Phos/AAGGTTAACTTTCGTTGTTGACTCGACGGTAGCCCTAACC |
| Telo-adapter 12 (TA12) | /5Phos/AAGGTTAACATCTGGAACGTGGTACACCTGTACCCTAACC |
Telo-splints (TS01 - TS12)
| Oligo name | Sequence |
|---|---|
| Telo-splint 1 (TS01) | GAAGAAAGTTGTCGGTGTCTTTGTGTTAACCTTAGCAAT |
| Telo-splint 2 (TS02) | GCTTGTCCAGGGTTTGTGTAACCTTTTAACCTTAGCAAT |
| Telo-splint 3 (TS03) | GGTGTTACCGTGGGAATGAATCCTTTTAACCTTAGCAAT |
| Telo-splint 4 (TS04) | GAAGCGTTGAAACCTTTGTCCTCTCTTAACCTTAGCAAT |
| Telo-splint 5 (TS05) | GCAGGTAGAAAGAAGCAGAATCGGATTAACCTTAGCAAT |
| Telo-splint 6 (TS06) | GTCACACGAGTATGGAAGTCGTTCTTTAACCTTAGCAAT |
| Telo-splint 7 (TS07) | GAGTACGAACCACTGTCAGTTGACGTTAACCTTAGCAAT |
| Telo-splint 8 (TS08) | GGCCTATCTAGGTTGTTGGGTTTGGTTAACCTTAGCAAT |
| Telo-splint 9 (TS09) | GATGACGTTGTCGGACTTCTACTGGTTAACCTTAGCAAT |
| Telo-splint 10 (TS10) | GCGTGTACTTCTCTGGACGAACTCCTTAACCTTAGCAAT |
| Telo-splint 11 (TS11) | GCTACCGTCGAGTCAACAACGAAAGTTAACCTTAGCAAT |
| Telo-splint 12 (TS12) | GTACAGGTGTACCACGTTCCAGATGTTAACCTTAGCAAT |
Check your flow cell
We highly recommend that you check the number of pores in your flow cell prior to starting a sequencing experiment. This should be done within 12 weeks of purchasing your MinION/GridION/PromethION Flow Cells. Oxford Nanopore Technologies will replace any unused flow cell with fewer than the number of pores listed in the Table below, when the result is reported within two days of performing the flow cell check, and when the storage recommendations have been followed. To do the flow cell check, please follow the instructions in the Flow Cell Check document.
| Flow cell | Minimum number of active pores covered by warranty |
|---|---|
| MinION/GridION Flow Cell | 800 |
| PromethION Flow Cell | 5,000 |
The Native Adapter (NA) from the Native Barcoding Auxiliary Kit V14 (EXP-NBA114) used in this protocol is not interchangeable with other sequencing adapters.
Required Oxford Nanopore Technologies kits for Telo-Seq: kit components
This protocol uses the Native Barcoding Auxiliary Kit V14 (EXP-NBA114), Long Fragment Buffer Expansion (EXP-LFB001), Ultra-Long Auxiliary Vials (EXP-ULA001), and Sequencing Auxiliary Vials V14 (EXP-AUX003) for library preparation and flow cell priming.
Native Barcoding Auxiliary Kit V14 (EXP-NBA114)
| Name | Acronym | Cap colour | No. of vials | Fill volume per vial (µl) |
|---|---|---|---|---|
| Native Adapter | NA | Green | 2 | 40 |
| AMPure XP Beads | AXP | Amber | 1 | 400 |
| Long Fragment Buffer | LFB | Orange | 2 | 1,800 |
| Short Fragment Buffer | SFB | Clear | 2 | 1,800 |
Note: This product contains AMPure XP reagent manufactured by Beckman Coulter, Inc. and can be stored at -20°C with the kit without detriment to reagent stability.
Note: For the Telo-Seq method you will not require the Short Fragment Buffer (SFB) from the Native Barcoding Auxiliary Kit V14 (EXP-NBA114). If you do not use this component for other methods, it can be disposed of.
LFB Expansion (EXP-LFB001)
| Name | Acronym | No. of vials | Cap colour | Fill volume per vial |
|---|---|---|---|---|
| Long Fragment Buffer | LFB | 1 | Brown cap, orange label | 7.5 ml |
Ultra-Long Auxiliary Vials (EXP-ULA001)
| Name | Acronym | Cap colour | No. of vials | Fill volume per vial (μl) |
|---|---|---|---|---|
| Elution Buffer | EB | Black | 1 | 1,500 |
| Sequencing Buffer UL | SBU | Red | 2 | 1,000 |
| Loading Solution UL | LSU | White cap, pink label | 1 | 200 |
| Flush Tether UL | FTU | Purple | 1 | 600 |
| Flow Cell Flush | FCF | Clear cap, light blue label | 1 | 15,500 |
Note: For the Telo-Seq method you will not require the Sequencing Buffer UL (SBU) or the Loading Solution UL (LSU) from the Ultra-Long Auxiliary Vials (EXP-ULA001). If you do not use these components for other methods, they can be disposed of.
Sequencing Auxiliary Vials V14 (EXP-AUX003)
| Name | Acronym | Cap colour | No. of vials | Fill volume per vial (μl) |
|---|---|---|---|---|
| Elution Buffer | EB | Black | 2 | 500 |
| Sequencing Buffer | SB | Red | 2 | 700 |
| Library Solution | LIS | White cap, pink label | 2 | 600 |
| Library Beads | LIB | Pink | 2 | 600 |
| Flow Cell Flush | FCF | Light blue label | 2 | 8,000 |
| Flow Cell Tether | FCT | Purple | 2 | 200 |
Note: For the Telo-Seq method you will not require the Library Solution (LIS) or the Flow Cell Tether (FCT) from the Sequencing Auxiliary Vials V14 (EXP-AUX003). If you do not use these components for other methods, they can be disposed of.
3. Reconstituting oligos
Material
- Custom-ordered telo-adapter oligos (TA01-TA12)
- Custom-ordered telo-splint oligos (TS01-TS12)
Consumibles
- 1X TE buffer (Fisher Scientific, 12090015)
Instrumental
- Microcentrífuga
- Mezclador vórtex
- Pipeta y puntas P1000
- Pipeta y puntas P200
- Pipeta y puntas P100
- Pipeta y puntas P20
- Pipeta y puntas P10
- Pipeta y puntas P2
Spin down the lyophilised oligo(s).
Reconstitute the oligo(s) to a concentration of 100 µM using TE Buffer.
Note: Instructions and volume requirements for reconstitution will be found on the order spec sheet provided by the supplier.
Ensure the oligo sample(s) is fully reconstituted by vortexing thoroughly until the lyophilised oligo is fully resuspended.
Spin down the reconstituted oligo(s).
Reconstituted oligos can be stored at 4°C for short-term storage or repeated use. For long-term storage of more than 3 months, we recommend storing your reconstituted oligos at -20°C.
Please ensure you fully thaw and mix your reconstituted oligos thoroughly by vortexing to ensure they are homogenised prior to each use.
4. Pre-hybridisation of the telo-adapters and splint, and preparation of the telo-splint mix
Material
- Resuspended telo-adapters 100 μM (TA01-TA12)
- Resuspended telo-splints 100 μM (TS01-TS12)
Consumibles
- Agua sin nucleasas (p.ej. Thermo Scientific, AM9937)
- NaCl 5 M (Sigma, 71386)
- 1M Tris-HCl, pH 7.5 (Thermo scientific 15567027)
- EDTA 0,5 M, pH 8 (Thermo Scientific, R1021)
- 1X TE buffer (Fisher Scientific, 12090015)
- Tubos de PCR de pared fina, 0,2 ml
- Tubos Eppendorf DNA LoBind de 1,5 ml
Instrumental
- Pipeta y puntas P1000
- Pipeta y puntas P100
- Pipeta y puntas P10
- Pipeta y puntas P2
- Microcentrífuga
- Termociclador
- Mezclador vórtex
- Cubeta con hielo
If necessary, thaw the resuspended telo-adapters (TA01-TA12) and the resuspended telo-splints (TS01-TS12) on ice. Ensure the reagents are homogeneous by thoroughly pipette mixing and briefly spin down. Place on ice until ready to use.
In a clean 1.5 ml Eppendorf DNA LoBind tube, prepare 100 μl of 5x annealing buffer as follows:
| Reagent | Stock concentration | Final concentration in mix | Volume |
|---|---|---|---|
| Nuclease-free water | - | - | 93 µl |
| NaCl | 5 M | 250 mM | 5 µl |
| Tris HCl pH 7.5 | 1 M | 50 mM | 5 µl |
| EDTA | 0.5 M | 5 mM | 1 µl |
| Total | - | - | 100 µl |
Mix thoroughly by vortexing and centrifuge briefly.
The barcoded telo-adapters and telo-splints are only compatible with their corresponding numbered counterpart (e.g. TA01 with TS01, TA02 with TS02, etc).
Please ensure you are using the correct barcoded pairs during the pre-hybridisation steps.
For each of the barcoded telo-adapters (TA01-TA12) and complementary telo-splint (TS01-TS12), assemble the following reaction in separate 0.2 ml thin-walled PCR tube:
| Reagent | Stock concentration | Final concentration in mix | Volume |
|---|---|---|---|
| 5x Annealing buffer (from previous step) | 5x | 1x | 2 µl |
| Resuspended telo-adapter (TA01-TA12) | 100 µM | 40 µM | 4 µl |
| Resuspended telo-splint (TS01-TS12) | 100 µM | 40 µM | 4 µl |
| Total | - | - | 10 µl |
Note: Ensure you have a separate reaction for each of your barcoded telo-adapter and corresponding telo-splint, and label your tubes accordingly for subsequent use.
Mix by pipetting and spin down.
Using a thermal cycler, incubate the reactions to 95°C and slowly cool ~1°C per minute to 10°C by using the following program:
| Step | Temperature | Ramp rate | Time | Cycles |
|---|---|---|---|---|
| Initial denaturation | 95°C | Max | 5 minutes | 1 |
| Annealing | -0.1°C / cycle | Max | 5 seconds | 850 |
| Hold | 4°C | - | ∞ | - |
This reaction will slowly anneal the telomere adapters and telo-splints.
Dilute each of your bardoded hybridised products in a separate clean 1.5 ml Eppendorf DNA LoBind tube:
| Reagent | Stock concentration | Final concentration in mix | Volume |
|---|---|---|---|
| TE buffer | 1x | 1x | 261 µl |
| Adapter-splint hybrid product 01-12 (TATS01-TATS12) | 40 µM | 1.33 µM | 9 µl |
| Total | - | - | 270 µl |
Note: Ensure you have a separate tube for each of your barcoded hybridised products, and label your tubes accordingly for subsequent use.
Thoroughly mix the reaction by gently pipetting and briefly spinning down.
The hybridised telo-adapter and telo-splints (TATS01-TATS12) can be stored at -20°C until use.
Ensure the reagents are mixed thoroughly before use to ensure the content is homogeneous.
In a clean 1.5 ml Eppendorf DNA LoBind tube, prepare the telo-splint mix (TSM) by combining the following:
| Reagent | Stock concentration | Final concentration | Volume |
|---|---|---|---|
| TE buffer | 1X | 1X | 456 µl |
| Telo-splint 1 (TS01) | 100 µM | 2 µM | 12 µl |
| Telo-splint 2 (TS02) | 100 µM | 2 µM | 12 µl |
| Telo-splint 3 (TS03) | 100 µM | 2 µM | 12 µl |
| Telo-splint 4 (TS04) | 100 µM | 2 µM | 12 µl |
| Telo-splint 5 (TS05) | 100 µM | 2 µM | 12 µl |
| Telo-splint 6 (TS06) | 100 µM | 2 µM | 12 µl |
| Telo-splint 7 (TS07) | 100 µM | 2 µM | 12 µl |
| Telo-splint 8 (TS08) | 100 µM | 2 µM | 12 µl |
| Telo-splint 9 (TS09) | 100 µM | 2 µM | 12 µl |
| Telo-splint 10 (TS10) | 100 µM | 2 µM | 12 µl |
| Telo-splint 11 (TS11) | 100 µM | 2 µM | 12 µl |
| Telo-splint 12 (TS12) | 100 µM | 2 µM | 12 µl |
| Total | - | - | 600 µl |
The telo-splint mix (TSM) can be stored at -20°C until use.
Ensure the telo-splint mix (TSM) is mixed thoroughly before use to ensure the content is homogeneous.
5. Telomere adapter ligation
Material
- At least 60 µg high molecular weight genomic DNA between all your samples (this will equate to 5 µg – 15 µg per sample, depending on number of sample inputs)
- Pre-hybridised telo-adapter and telo-splint (TATS01 - TATS12) from previous step
Consumibles
- 10X rCutSmart™ Buffer (NEB, B6004S)
- 10 mM rATP solution, 10 mM (NEB P0756S)
- Ligasa de ADN Salt-T4® (NEB, M0467)
- Agua sin nucleasas (p.ej. Thermo Scientific, AM9937)
- Tubos de PCR de pared fina, 0,2 ml
- Tubos Eppendorf DNA LoBind de 1,5 ml
Instrumental
- Pipeta y puntas P1000
- Pipeta y puntas P100
- Pipeta y puntas P10
- Microcentrífuga
- Termociclador
- Hula mixer (mezclador de rotación suave)
- Gradilla magnética
- Cubeta con hielo
Thaw the following reagents, then spin down briefly using a microfuge and mix as indicated in the table below. Then place the reagents on ice.
| Reagent | 1. Thaw at room temperature | 2. Briefly spin down | 3. Mix well by pipetting |
|---|---|---|---|
| rCutsmart buffer | ✓ | ✓ | ✓ |
| rATP Solution | ✓ | ✓ | ✓ |
| Pre-hybridised telo-adapter and telo-splint (TATS01 - TATS12) | ✓ | ✓ | ✓ |
| Salt-T4 DNA ligase | Not frozen, keep on ice | ✓ | ✓ |
For this protocol, you will need a total input of at least 60 µg of high molecular weight genomic DNA (HMW gDNA). This can be spread across all of your samples/barcodes.
For example:
| Number of samples/barcodes used | Input requirement per sample/barcode |
|---|---|
| 4 | 15 µg |
| 6 | 10 µg |
| 12 | 5 µg |
Note: Please note that an input of less than 60 µg into the library preparation will not yield sufficient DNA library to fill your flow cell, resulting in reduced telomeric output.
Additionally, we recommend performing at least a 4-plex even if the DNA of from the same origin. If you are only running one sample, or subsets smaller than 4 samples, we recommend splitting these across at least 4 barcodes with 15 µg input into each.
Please refer to the input mass and multiplexing section of the Telo-Seq know-how document for more details.
For each sample, prepare the DNA in nuclease-free water:
- Depending on the number of samples being multiplexed, transfer 5-15 μg input HMW gDNA into a separate clean 0.2 ml thin-walled PCR tube.
| Number of samples/barcodes used | Input requirement per sample/barcode |
|---|---|
| 4 | 15 µg |
| 6 | 10 µg |
| 12 | 5 µg |
Adjust the volume of each sample to 150 μl with nuclease-free water.
Mix gently by pipetting up and down, or by flicking the tube.
Spin down briefly in a microfuge.
Into each 0.2 ml thin-walled PCR tube containing a HMW gDNA sample, mix the following:
| Reagent | Stock concentration | Final concentration in mix | Volume |
|---|---|---|---|
| 5-15 µg HMW gDNA (from previous step) | - | - | 150 µl |
| rCutsmart Buffer | 10x | 1x | 20 µl |
| rATP solution | 10 mM | 1 mM | 20 µl |
| Pre-hybridised telo-adapter and telo-splint (TATS01 - TATS12) | 1.33 µM | 33.25 nM | 5 µl |
| Salt-T4 DNA ligase | 400 U/µl | 10 U/µl | 5 µl |
| Total | - | - | 200 µl |
Mix by gently flicking the tube, ensuring the reaction is homogeneous, then briefly spin down in a microfuge.
Split each reaction into two separate 0.2 ml thin-walled PCR tubes, each containing 100 μl each.
Note: Ensure your tubes are adequately labelled to keep track of your samples split across different tubes, and to not mix up your different samples.
Using a thermal cycler, incubate the 0.2 ml PCR tubes at 35°C for 16 hours, followed by heat inactivation at 65°C for 10 minutes.
Note: Ensure you are incubating all of your sample tubes. You should have two tubes of 100 μl for each sample.
Take forward the all the tubes containing the telomere-adapted DNA sample into the digestion and dA-tailing of non-telomeric gDNA step. However, at this point it is also possible to store the sample at 4°C overnight.
6. Digestion and dA-tailing of non-telomeric gDNA
Material
- Telomere-adapted DNA samples, each split across two 0.2 ml thin-walled PCR tubes (from previous step)
- Long Fragment Buffer (LFB)
Consumibles
- EcoRV-HF® 20,000 units/ml (NEB, R3195 S/L)
- NEBNext® dA-Tailing Module (NEB, E6053)
- Microesferas Agencourt AMPure XP (Beckman Coulter™, A63881)
- Agua sin nucleasas (p.ej. Thermo Scientific, AM9937)
- Tubos Eppendorf DNA LoBind de 1,5 ml
- Kit Qubit dsDNA BR (Invitrogen, Q32850)
- Tubos Qubit™ Assay (Invitrogen, Q32856)
Instrumental
- Pipeta y puntas P1000
- Pipeta y puntas P100
- Pipeta y puntas P10
- Microcentrífuga
- Termociclador
- Thermomixer or heat block
- Hula mixer (mezclador de rotación suave)
- Gradilla magnética
- Cubeta con hielo
- Fluorímetro Qubit™ (o equivalente)
Thaw the following reagents where required, then spin down briefly using a microfuge and mix as indicated in the table below. Keep the reagents on ice where possible.
| Reagent | 1. Thaw at room temperature | 2. Briefly spin down | 3. Mix well by pipetting |
|---|---|---|---|
| EcoRV-HF | Not frozen, keep on ice | ✓ | ✓ |
| NEBNext dA-tailing reaction buffer | ✓ | ✓ | ✓ |
| Klenow fragment (3'– 5' exo) | Not frozen, keep on ice | ✓ | ✓ |
| Long Fragment Buffer (LFB) | ✓ | ✓ | ✓ |
In each of the 0.2 ml thin-walled PCR tubes containing the telomere-adapted DNA sample(s), prepare the following reaction:
| Reagent | Volume per tube |
|---|---|
| Telomere-adapted sample (from previous step) | 100 µl |
| EcoRV-HF | 2 µl |
| Total | 102 µl |
Mix by inverting the tube, ensuring the reaction is homogeneous, and briefly spin down.
Using a thermal cycler, incubate the reation tubes at 37°C for 30 minutes, followed by heat inactivation at 65°C for 20 minutes.
For each sample, pool the two digestion reaction tubes (102 μl each) into a clean 1.5 ml Eppendorf DNA LoBind tube, for a total volume of 204 μl per sample.
Note: Ensure you label the new 1.5 ml Eppendorf DNA LoBind tubes accordingly for sample tracking, and make sure you are pooling your samples correctly.
In each of the 1.5 ml Eppendorf tube containing the pooled digestion reactions, prepare the dA-tailing reaction as follows:
| Reagent | Stock concentration | Final concentration in mix | Volume |
|---|---|---|---|
| Digested DNA sample (from previous step) | - | - | 204 µl |
| Nuclease-free water | - | - | 12 µl |
| NEBNext dA-tailing reaction buffer | 10x | 1x | 25 µl |
| Klenow fragment (3'– 5' exo) | - | - | 9 µl |
| Total | - | - | 250 µl |
Mix by inverting the tube, ensuring the reaction is homogeneous, and briefly spin down.
Incubate the sample at 37°C for 30 minutes in a thermomixer or heat block.
Resuspend the AMPure XP Beads by vortexing.
Add 0.5X of resuspended the AMPure XP Beads (125 µl) to each of the dA-tailing reactions. Mix by inverting the tube, ensuring the reaction is homogeneous.
Incubate at room temperature for 5 minutes.
Note: If available, incubate on a Hula mixer (rotator mixer).
Spin down the tube and pellet on a magnet for 5 minutes. Ensure the supernatant is clear and colourless then, keeping the tube on the magnet, pipette off the supernatant.
Clean the samples as follows:
- Add 250 µl of Long Fragment Buffer (LFB) to the sample tube.
- Remove the tube from the magnet and mix by gentle inversion until homogeneous.
- Spin down the tube and pellet on a magnet for 5 minutes.
- Ensure the supernatant is clear and colourless.
- Keeping the tube on the magnet, pipette off the supernatant without disturbing the pellet.
Repeat the previous step.
Spin down and place the tube back on the magnet. Pipette off any residual Long Fragment Buffer (LFB). Allow to dry for ~30 seconds, but do not dry the pellet to the point of cracking.
For each sample, remove the tube from the magnetic rack and resuspend the pellet in 55 µl nuclease-free water. Incubate for 15 minutes at 37°C in a thermomixer or heat block.
Spin down the tube and pellet on a magnet for at least 1 minutes. Ensure the supernatant is clear and colourless.
For each sample, remove and retain 55 µl of eluate into a separate clean 1.5 ml Eppendorf DNA LoBind tube.
Quantify 1 µl of eluted sample using a Qubit fluorometer.
Record the concentration and subsequent mass recovered for reference.
Take forward the digested and dA-tailed DNA sample into the splint annealing step. However, at this point it is also possible to store the sample at 4°C overnight.
7. Splint annealing and clean-up
Material
- Digested and dA-tailed DNA sample (from previous step)
- Telo-splint mix (TSM) (from previous step)
- Long Fragment Buffer (LFB)
Consumibles
- 1 M NaCl (from Salt-T4 DNA ligase)
- Microesferas Agencourt AMPure XP (Beckman Coulter™, A63881)
- Agua sin nucleasas (p.ej. Thermo Scientific, AM9937)
- Tubos Eppendorf DNA LoBind de 1,5 ml
- Kit Qubit dsDNA BR (Invitrogen, Q32850)
- Tubos Qubit™ Assay (Invitrogen, Q32856)
Instrumental
- Pipeta y puntas P1000
- Pipeta y puntas P100
- Pipeta y puntas P10
- Microcentrífuga
- Termociclador
- Thermomixer or heat block
- Mezclador vórtex
- Hula mixer (mezclador de rotación suave)
- Gradilla magnética
- Cubeta con hielo
- Fluorímetro Qubit™ (o equivalente)
Thaw the following reagents where required, then spin down briefly using a microfuge and mix as indicated in the Table below. Keep the reagents on ice where possible.
| Reagent | 1. Thaw at room temperature | 2. Briefly spin down | 3. Mix well by pipetting |
|---|---|---|---|
| NaCl (from Salt-T4 DNA ligase) | ✓ | ✓ | ✓ |
| Telo-splint mix (TSM) from previous step | ✓ | ✓ | ✓ |
In a clean 1.5 ml Eppendorf DNA LoBind tube, pool your barcoded and telo-adapted sample elutes together:
| Component | Volume per sample | Volume for 4 samples | Volume for 6 samples | Volume for 12 samples |
|---|---|---|---|---|
| Digested and dA-tailed DNA samples (from previous step) | 54 µl | 216 µl | 324 µl | 648 µl |
In the 1.5 ml Eppendorf tube containing the pooled digested and dA-tailed DNA samples, prepare the splinting reaction as follows:
Adjust the volumes depending on your number of samples.
| Reagent | Stock concentration | Final concentration in mix | Volume per sample | Volume for n samples | Volume for 12 samples |
|---|---|---|---|---|---|
| Pooled digested and dA-tailed DNA sample (from previous step) | - | - | 54 µl | n x 54 µl | 648 µl |
| NaCl (from the Salt-T4 ligase) | 1 M | 50 mM | 3 µl | n x 3 µl | 36 µl |
| Telo-splint Mix (TSM) (from previous step) | 2 µM | 100 nM | 3 µl | n x 3 µl | 36 µl |
| Total | - | - | 60 µl | n x 60 µl | 720 µl |
Mix by inverting the tube, ensuring the reaction is homogeneous, and briefly spin down.
Incubate the sample at 50°C for 60 minutes in a themomixer or heat block.
Resuspend the AMPure XP Beads by vortexing.
Add 0.5X of resuspended the AMPure XP Beads (n x 30 µl) to the splinting reaction. Mix by inverting the tube, ensuring the reaction is homogeneous.
Incubate at room temperature for 5 minutes.
Note: If available, incubate on a Hula mixer (rotator mixer).
Spin down the tube and pellet on a magnet for 5 minutes. Ensure the supernatant is clear and colourless then, keeping the tube on the magnet, pipette off the supernatant.
Clean the sample tube content as follows:
- Add 250 µl of Long Fragment Buffer (LFB) to the sample tube.
- Remove the tube from the magnet and mix by gentle inversion until homogeneous.
- Spin down the tube and pellet on a magnet for 5 minutes.
- Ensure the supernatant is clear and colourless.
- Keeping the tube on the magnet, pipette off the supernatant without disturbing the pellet.
Repeat the previous step.
Spin down and place the tube back on the magnet. Pipette off any residual Long Fragment Buffer (LFB). Allow to dry for ~30 seconds, but do not dry the pellet to the point of cracking.
Remove the tube from the magnetic rack and resuspend the pellet in 66 µl nuclease-free water. Briefly spin down and incubate for 15 minutes at 37°C.
Spin down the tube and pellet on a magnet for at least 1 minute. Ensure the supernatant is clear and colourless.
Remove and retain 65 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.
Take forward the splint-annealed DNA sample into the adapter ligation and clean-up step. However, at this point it is also possible to store the sample at 4°C overnight.
8. Adapter ligation and clean-up
Material
- Native Adapter (NA)
- Long Fragment Buffer (LFB)
- Microesferas AMPure XP (AXP)
- Elution Buffer (EB)
Consumibles
- Ligasa de ADN Salt-T4® (NEB, M0467)
- NEBNext® Quick Ligation Reaction Buffer (NEB, B6058)
- Tubos Eppendorf DNA LoBind de 1,5 ml
- Tubos Qubit™ Assay (Invitrogen, Q32856)
- Kit Qubit dsDNA BR (Invitrogen, Q32850)
Instrumental
- Gradilla magnética
- Microcentrífuga
- Mezclador vórtex
- Pipeta y puntas P1000
- Pipeta y puntas P100
- Pipeta y puntas P20
- Pipeta y puntas P10
- Fluorímetro Qubit™ (o equivalente)
- Ice bucket with wet ice
- Hula mixer (rotator mixer)
Check your flow cell
We recommend performing a flow cell check before starting your adapter ligation and clean-up steps to ensure you have a flow cell with sufficient pores for a good sequencing run.
See the flow cell check document for more information.
Thaw the following reagents where required, then spin down briefly using a microfuge and mix as indicated in the Table below. Keep the reagents on ice where possible.
| Reagent | 1. Thaw at room temperature | 2. Briefly spin down | 3. Mix well by pipetting |
|---|---|---|---|
| Native adapter (NA) | Not frozen, keep on ice | ✓ | ✓ |
| Salt-T4 DNA Ligase | Not frozen, keep on ice | ✓ | ✓ |
| NEBNext Quick Ligation buffer | ✓ | ✓ | ✓ |
| Elution buffer (EB) | ✓ | ✓ | ✓ |
| Long Fragment Buffer (LFB) | ✓ | ✓ | ✓ |
In a 1.5 ml Eppendorf DNA LoBind tube, prepare the adapter ligation reaction by mixing the reagents in the following order:
| Reagent | Volume |
|---|---|
| Pooled DNA sample from the previous step | 65 µl |
| Native Adapter (NA) | 5 µl |
| NEBNext Quick Ligation buffer | 20 µl |
| Salt-T4 DNA Ligase | 10 µl |
| Total | 100 µl |
Mix by inverting the tube, ensuring the reaction is homogeneous, and briefly spin down.
Incubate the reaction for 20 minutes at room temperature.
Resuspend the AMPure XP Beads (AXP) by vortexing.
Add 0.5X of resuspended the AMPure XP Beads (AXP) (50 µl) to the sample. Mix by inverting the tube, ensuring the reaction is homogeneous.
Incubate at room temperature for 5 minutes.
We recommend using a Hula mixer (rotator mixer), if available.
Spin down the tube and pellet on a magnet for 5 minutes. Ensure the supernatant is clear and colourless then, keeping the tube on the magnet, pipette off the supernatant.
Clean the sample tube content as follows:
- Add 250 µl of Long Fragment Buffer (LFB) to the sample tube.
- Remove the tube from the magnet and mix by gentle inversion until homogeneous.
- Spin down the tube and pellet on a magnet for 5 minutes.
- Ensure the supernatant is clear and colourless.
- Keeping the tube on the magnet, pipette off the supernatant without disturbing the pellet.
Repeat the previous step two more times, for a total of three cleans-ups using Long Fragment Buffer (LFB).
Spin down and place the tube back on the magnet. Pipette off any residual supernatant. Allow to dry for ~30 seconds, but do not dry the pellet to the point of cracking.
Remove the tube from the magnetic rack and resuspend the pellet in 33 µl Elution Buffer (EB). Spin down and incubate for 10 minutes at 37°C.
Pellet the beads on a magnet for at least 1 minute, until the eluate is clear and colourless.
Remove and retain 33 µl of eluate containing the DNA library into a clean 1.5 ml Eppendorf DNA LoBind tube.
Dispose of the pelleted beads
Quantify 1 µl of eluted sample using a Qubit fluorometer.
Record the concentration for reference.
Take forward 32 µl of your eluted DNA library to flow cell loading.
The prepared library is used for loading into the flow cell. Store the library on ice or at 4°C until ready to load.
Library storage recommendations
We recommend storing libraries in Eppendorf DNA LoBind tubes at 4°C for short-term storage. For long-term storage of more than 3 months, we recommend storing libraries at -80°C in Eppendorf DNA LoBind tubes.
9. Priming and loading the PromethION Flow Cell
Material
- Sequencing Buffer (SB)
- Library Beads (LIB)
- Flush Tether UL (FTU)
- Flow Cell Flush (FCF)
Consumibles
- Celdas de flujo PromethION
- Tubos Eppendorf DNA LoBind de 1,5 ml
Instrumental
- Dispositivo PromethION
- Pantalla protectora celdas de flujo PromethION
- Pipeta y puntas P1000
- Pipeta y puntas P200
- Pipeta y puntas P20
- Mezclador vórtex
This kit is only compatible with R10.4.1 flow cells (FLO-PRO114M).
After taking the flow cells out of the fridge, wait 20 minutes for the flow cells to reach room temperature, before inserting them into the PromethION. Condensation can form on the flow cell in humid environments. Inspect the gold connector pins on the top and underside of the flow cell for condensation and wipe off with a lint-free wipe if any is observed. Ensure the heat pad (black pad) is present on the underside of the flow cell.
This method uses the Flush Tether UL (FTU).
Please note, this method uses the Flush Tether UL (FTU) from the Ultra-Long Auxiliary Vials (EXP-ULA001) when priming your flow cell. Using Flow Cell Tether (FCT) will result in lower number of telomeric reads.
Please see the Telo-Seq know-how document for more information.
Thaw the Sequencing Buffer (SB), Library Beads (LIB), Flush Tether UL (FTU) and Flow Cell Flush (FCF) at room temperature before mixing by vortexing. Then spin down and store on ice.
To prepare the flow cell priming mix, combine Flow Cell Flush (FCF) and Flush Tether UL (FTU), as directed below. Mix by pipetting at room temperature.
In a suitable tube for the number of flow cells, combine the following reagents:
| Reagent | Volume per flow cell |
|---|---|
| Flow Cell Flush (FCF) | 1,170 µl |
| Flush Tether UL (FTU) | 30 µl |
| Total volume | 1,200 µl |
For PromethION 2 Solo, load the flow cell(s) as follows:
Place the flow cell flat on the metal plate.
Slide the flow cell into the docking port until the gold pins or green board cannot be seen.

For the PromethION 24/48, load the flow cell(s) into the docking ports:
- Line up the flow cell with the connector horizontally and vertically before smoothly inserting into position.
- Press down firmly onto the flow cell and ensure the latch engages and clicks into place.


Insertion of the flow cells at the wrong angle can cause damage to the pins on the PromethION and affect your sequencing results. If you find the pins on a PromethION position are damaged, please contact support@nanoporetech.com for assistance.

Complete a flow cell check to assess the number of pores available before loading the library.
This step can be omitted if the flow cell has been checked previously.
See the flow cell check document for more information.
Slide the inlet port cover clockwise to open.

Take care when drawing back buffer from the flow cell. Do not remove more than 20-30 µl, and make sure that the array of pores are covered by buffer at all times. Introducing air bubbles into the array can irreversibly damage pores.
After opening the inlet port, draw back a small volume to remove any air bubbles:
- Set a P1000 pipette tip to 200 µl.
- Insert the tip into the inlet port.
- Turn the wheel until the dial shows 220-230 µl, or until you see a small volume of buffer entering the pipette tip.

Load 500 µl of the priming mix into the flow cell via the inlet port, avoiding the introduction of air bubbles. Wait five minutes. During this time, prepare the library for loading using the next steps in the protocol.

Thoroughly mix the contents of the Library Beads (LIB) by pipetting.
The Library Beads (LIB) tube contains a suspension of beads. These beads settle very quickly. It is vital that they are mixed immediately before use.
In a new 1.5 ml Eppendorf DNA LoBind tube, prepare the library for loading as follows:
| Reagent | Volume per flow cell |
|---|---|
| Sequencing Buffer (SB) | 100 µl |
| Library Beads (LIB) thoroughly mixed before use | 68 µl |
| DNA library | 32 µl |
| Total | 200 µl |
Note: Library loading volume has been increased to improve array coverage.
Complete the flow cell priming by slowly loading 500 µl of the priming mix into the inlet port.

Mix the prepared library gently by pipetting up and down just prior to loading.
Load 200 µl of library into the inlet port using a P1000 pipette.

Close the valve to seal the inlet port.
For optimal sequencing output, install the light shield on your flow cell as soon as the library has been loaded.
We recommend leaving the light shield on the flow cell when library is loaded, including during any washing and reloading steps. The shield can be removed when the library has been removed from the flow cell.
If the light shield has been removed from the flow cell, install the light shield as follows:
- Align the inlet port cut out of the light shield with the inlet port cover on the flow cell. The leading edge of the light shield should sit above the flow cell ID.
- Firmly press the light shield around the inlet port cover. The inlet port clip will click into place underneath the inlet port cover.


Close the PromethION lid when ready to start a sequencing run on MinKNOW.
Wait a minimum of 10 minutes after loading the flow cells onto the PromethION before initiating any experiments. This will help to increase the sequencing output.
10. Data acquisition
We do not recommend sequencing and performing data analysis simultaneously on your device.
To ensure the compute on your device can keep up with the requirements for sequencing and/or analysis, we strongly recommend against running both processes at the same time.
Ensure your sequencing run has completed before setting off data analysis. Data analysis will be performed post-sequencing.
Equally, we do not recommend starting a sequencing run if you are currently performing data analysis on your device.
Ensure you are using the most recent version of MinKNOW.
We strongly recommend updating MinKNOW to the latest version on your device prior to starting a sequencing run.
For more information on updating MinKNOW, please refer to our MinKNOW protocol.
How to start sequencing
The sequencing device control and data acquisition are carried out by the MinKNOW software. Please ensure MinKNOW is installed on your computer or device. Further instructions for setting up a sequencing run can be found in the MinKNOW protocol.
We recommend setting up your sequencing run using the recommendations outlined below. All other parameters can be left to their default settings.
Basecalling for Telo-Seq
Basecalling of sequencing data will be performed post-sequencing using the wf-teloseq pipeline.
To produce MinKNOW sequencing metrics during your sequencing run, you should use the Fast basecalling model. Please note, this is only used for the sequencing metrics and all data generated will need to be re-basecalled after sequencing.
MinKNOW settings for Telo-Seq
Below are the recommendations for MinKNOW settings:
Positions
Flow cell position: [user defined]
Experiment name: [user defined]
Flow cell type: FLO-PRO114M
Sample ID: [user defined]
Kit
Kit selection: Ligation Sequencing Kit (SQK-LSK114)
Run configuration
Sequencing and analysis
Basecalling: On
Modified bases: Off [default]
Model: Fast basecalling (for sequencing metrics)
Barcoding: Off [default]
Alignment: Off [default]
Adaptive sampling: Off [default]
Advanced options
Time between pore scans: 1.5 [default]
Reserve pores: On [default]
Data targets
Run limit: Stop run when sequencing reaches 48 hours
Output
Output format
.BAM: Off
.FASTQ: Off
Raw reads: On [default]
.POD5: On [default]
Filtering: On [default]
Qscore: 8 [default]
Minimum read length: 200 bp
11. Downstream analysis
Telo-Seq analysis
Telo-Seq data can be analysed using wf-teloseq, a bioinformatics workflow implemented in Nextflow that is part of Oxford Nanopore’s EPI2ME suite of analysis workflows. wf-teloseq can be run from the command line or within the EPI2ME Desktop App. Prior to analysis, the data must be basecalled and demultiplexed using a script available as part of wf-teloseq.
Note: To ensure the compute on your device can keep up with the requirements for sequencing and/or analysis, we strongly recommend against running both processes at the same time.
Basecalling and demultiplexing
The script outlined below runs Oxford Nanopore’s Dorado basecaller and demultiplexes the basecalled reads using the barcoded Telo-adapter sequences. The script requires Dorado to be installed and the location available in the command line path. For first time installation of Dorado please refer to the installing Dorado guidelines in the troubleshooting section of this protocol.
To basecall and correctly demultiplex your Telo-Seq data complete the following steps:
1. Download the wf-teloseq pipeline from the GitHub repository
2. Execute the following command in command line:
/path/to/wf-teloseq/bin/basecall.sh -m sup -i /path/to/pod5_files -o /path/to/output
- -m is the basecalling model to use (‘hac’ or ‘sup’)
- -i is path to folder with sequencing data (.pod5)
- -o is the folder where basecalling and demultiplexing results will be output.
- Relative or absolute paths to files can be used.
After successful execution, the output directory will contain a directory for each barcode (barcode01-barcode12, corresponding to the 12 Telo-adapter sequences) containing demultiplexed, basecalled reads (.bam). Any reads not assigned to a barcode will be output to the unclassified folder.
Option 1: Telomere analysis using the EPI2ME Desktop App
If not already installed on your device, you can download and install the EPI2ME Desktop App following these instructions. If you are running the wf-teloseq for the first time, you can import the workflow by selecting wf-teloseq under the Available Workflows tab within EPI2ME Desktop.
To run the workflow:
1. Launch the EPI2ME Desktop App.
2. Select wf-teloseq under the Installed workflows tab. Then select Run this workflow and Run on your computer.
3. Under Input options, provide individual bam file location in the BAM box. You may provide a single sample file, or a set of folders together with a sample sheet (Sample Options). You may also use the sample sheet to provide sample-specific references if not the same for all barcodes.
4. Optional: Under Teloseq Options, check Skip mapping for a reference-free approach to report global telomere length estimation only.
5. Optional: To adjust default values for minimum read length (default 100) and minimum read quality (default 9), change values under Advanced Options section.
6. Click Launch workflow.
You may adjust values under Teloseq Options and Nextflow configuration to optimise the workflow run according to the compute available to you.
Example wf-teloseq run configuration in the EPI2ME Desktop App:
Option 2: Telomere analysis from the command line
To execute wf-teloseq from the command line, run the following command:
nextflow run epi2me-labs/wf-teloseq \
--bam 'path/to/data' \
--reference 'path/to/reference.fasta.gz' \
-profile standard
Where --bam is a path to either a bam file or a directory of bam files and --reference is a path to the reference genome of the sequenced sample. If no reference is provided, the workflow will default to a human telomere reference extracted from the HG002 telomere-to-telomere assembly by the T2T Consortium (v1.0.1 release, available from GitHub). For a reference-free approach that analyses whole sample telomere length only, use --skip_mapping and omit the --reference parameter .
Nextflow and either Docker or Singularity must be installed on your system to run the workflow. See the EPI2ME Quick Start guide for additional information on how to install and run EPI2ME workflows from the command line. See the wf-teloseq GitHub page for more detailed information on input parameter options, including how to specify barcode specific reference files if multiplexing more than one sample type.
Telo-Seq analysis output files
wf-teloseq produces an interactive HTML report with information on data quality, filtering metrics, and tables and graphs on estimated telomere lengths (Figure 3). The workflow also outputs additional files that can be used for downstream analysis and exploration, including alignment files (.bam) for inspecting the data with a genome browser and chromosome arm resolution telomere read metrics (.tsv).
wf-teloseq output report. (a) Basic data quality metrics (b) Global telomere length estimation (c) Estimated telomere lengths per chromosome arm:
12. Example performance for Telo-Seq
Sequencing platform
For optimal performance we recommend using a PromethION device and flow cells to sequence your Telo-Seq libraries as this will maximise the output. However, sequencing can also be performed on MinION and GridION devices using minION flow cells.
The table below illustrates example yields from identical libraries sequenced on the two platforms:
| Method | Input mass per barcode | Device | Mean sequencing reads per barcode (K) ± SD | Mean telomeric reads per barcode (K) ± SD | % Mean reads on target per barcode ± SD |
|---|---|---|---|---|---|
| Telo-Seq | 5 µg | GridION | 42.4 ± 8.5 | 3.71 ± 0.50 | 8.9% ± 1.6% |
| Telo-Seq | 5 µg | PromethION | 461.6 ± 109.8 | 41.15 ± 3.81 | 9.28% ± 1.72% |
Example sequencing performance
Telo-Seq development and validation at Oxford Nanopore Technologies have primarily used high HMW genomic DNA extracted from GM24385 cell cultures. The below table shows typical expected performance of a 12-plex Telo-Seq run using 5 µg input DNA per barcode on mixed human and cow samples. This dataset is publicly available on Oxford Nanopore Technologies open data portal.
Representative outputs of a 12-plex Telo-Seq performed using HMW gDNA extracted from human and cow samples and sequended for 48 hours:
| Estimated bases (Gb) in MinKNOW | 52.06 |
| Estimated pass bases (Gb) in MinKNOW | 45.89 |
| Estimated failed bases (Gb) in MinKNOW | 2.6 |
| Estimated N50 (Kb) in MinKNOW | 10.33 |
A representative read length distribution on a MinKNOW report for a Telo-Seq run on a PromethION:
A representative Q score distribution over 48 hours of sequencing on a MinKNOW report for a Telo-Seq run on a PromethION:
Representative pore activity over 48 hours of sequencing on a MinKNOW report for a Telo-Seq run on a PromethION. It is expected that a proportion of pores will remain ‘Open’ (dark green) and available for sequencing for the duration of the run:
A representative pore scan graph on a MinKNOW report for a Telo-Seq run on a PromethION. It is not unusual for the health of the flow cell to deteriorate more rapidly than with non-Telo-Seq experiments:
Representative translocation speeds and temperature over 48 hours of sequencing on a MinKNOW report for a Telo-Seq run on a PromethION:
13. Flow cell reuse and returns
Material
- Kit Flow Cell Wash (EXP-WSH004)
We do not recommend washing and reusing your flow cells for this method.
Re-using these flow cells for subsequent sequencing experiments may result in insufficient data generation for analysis.
Follow the returns procedure to send the flow cell back to Oxford Nanopore.
Instructions for returning flow cells can be found here.
If you encounter issues or have questions about your sequencing experiment, please refer to the Troubleshooting Guide that can be found in this protocol.
14. Installing the Dorado basecaller
Installation of Dorado
1. Create and Navigate to Installation Directory.
First, open a command line terminal and create the installation directory, then navigate to it:
mkdir -p ~/software/dorado
cd ~/software/dorado
pwd # This shows your current directory to confirm you're in the right place.
Note: Replace ~/software/dorado with your preferred installation location.
2. Installation:
2.1. Option 1: Download via browser
Visit the Dorado releases page on GitHub and download the appropriate installer for your Linux system and transfer to your installation directory.
2.2. Option 2: Download via command line
For direct download using wget, use the following commands:
For Linux x86_64
wget https://cdn.oxfordnanoportal.com/software/analysis/dorado-x.x.x-linux-x64.tar.gz
For Linux ARM64
wget https://cdn.oxfordnanoportal.com/software/analysis/dorado-x.x.x-linux-arm64.tar.gz
Note: Replace x.x.x with the actual version number (e.g., 0.9.6). Check the releases page for the latest version.
3. Extract the Installation Package
Extract the tar.gz file in the current directory:
tar -xzf dorado-*-linux-*.tar.gz --strip-components=1
Note: Replace * with the actual version number and x64 or arm64 you downloaded (e.g., 0.9.6, x64).
4. Add Dorado to PATH
Add Dorado to your system PATH by editing your shell configuration file:
echo 'export PATH="~/software/dorado/bin:$PATH"' >> ~/.bashrc
source ~/.bashrc
5. Verify Installation
Check that Dorado is properly installed:
dorado --version
You should see the version information displayed.
Troubleshooting
• Permission denied: Use sudo or request permissions to install with your IT.
• Command not found: Ensure you've reloaded your shell configuration (source ~/.bashrc or restart terminal)
• GPU acceleration: For CUDA support, ensure NVIDIA drivers are installed
Cluster-Specific Notes
• Some clusters use module systems (e.g., module load cuda for GPU support)
• Check with your system administrator about preferred software installation locations
• Some clusters may have Dorado already installed as a module
15. Issues during DNA extraction and library preparation
Below is a list of the most commonly encountered issues, with some suggested causes and solutions.
We also have an FAQ section available on the Nanopore Community Support section.
If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.
Low sample quality
| Observation | Possible cause | Comments and actions |
|---|---|---|
| Low DNA purity (Nanodrop reading for DNA OD 260/280 is <1.8 and OD 260/230 is <2.0–2.2) | The DNA extraction method does not provide the required purity | The effects of contaminants are shown in the Contaminants document. Please try an alternative extraction method that does not result in contaminant carryover. Consider performing an additional SPRI clean-up step. |
Low DNA recovery after AMPure bead clean-up
| Observation | Possible cause | Comments and actions |
|---|---|---|
| Low recovery | DNA loss due to a lower than intended AMPure beads-to-sample ratio | 1. AMPure beads settle quickly, so ensure they are well resuspended before adding them to the sample. 2. When the AMPure beads-to-sample ratio is lower than 0.4:1, DNA fragments of any size will be lost during the clean-up. |
| Low recovery | DNA fragments are shorter than expected | The lower the AMPure beads-to-sample ratio, the more stringent the selection against short fragments. Please always determine the input DNA length on an agarose gel (or other gel electrophoresis methods) and then calculate the appropriate amount of AMPure beads to use. ![]() |
| Low recovery after end-prep | The wash step used ethanol <70% | DNA will be eluted from the beads when using ethanol <70%. Make sure to use the correct percentage. |
16. Issues during the sequencing run
Below is a list of the most commonly encountered issues, with some suggested causes and solutions.
We also have an FAQ section available on the Nanopore Community Support section.
If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.
Fewer pores at the start of sequencing than after Flow Cell Check
| Observation | Possible cause | Comments and actions |
|---|---|---|
| MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check | An air bubble was introduced into the nanopore array | After the Flow Cell Check it is essential to remove any air bubbles near the priming port before priming the flow cell. If not removed, the air bubble can travel to the nanopore array and irreversibly damage the nanopores that have been exposed to air. The best practice to prevent this from happening is demonstrated in videos for how to load a MinION Flow Cell and how to load a PromethION Flow Cell. |
| MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check | The flow cell is not correctly inserted into the device | Stop the sequencing run, remove the flow cell from the sequencing device and insert it again, checking that the flow cell is firmly seated in the device and that it has reached the target temperature. If applicable, try a different position on the device (GridION/PromethION). |
| MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check | Contaminations in the library damaged or blocked the pores | The pore count during the Flow Cell Check is performed using the QC DNA molecules present in the flow cell storage buffer. At the start of sequencing, the library itself is used to estimate the number of active pores. Because of this, variability of about 10% in the number of pores is expected. A significantly lower pore count reported at the start of sequencing can be due to contaminants in the library that have damaged the membranes or blocked the pores. Alternative DNA/RNA extraction or purification methods may be needed to improve the purity of the input material. The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover. |
MinKNOW script failed
| Observation | Possible cause | Comments and actions |
|---|---|---|
| MinKNOW shows "Script failed" | Restart the computer and then restart MinKNOW. If the issue persists, please collect the MinKNOW log files and contact Technical Support. If you do not have another sequencing device available, we recommend storing the flow cell and the loaded library at 4°C and contact Technical Support for further storage guidance. |
Pore occupancy below 40%
| Observation | Possible cause | Comments and actions |
|---|---|---|
| Pore occupancy <40% | Not enough library was loaded on the flow cell | Ensure the correct volume and concentration as stated on the appropriate protocol for your sequencing library is loaded onto the flow cell. Please quantify the library before loading and calculate fmols using tools like the Promega Biomath Calculator, choosing "dsDNA: µg to fmol" |
| Pore occupancy close to 0 | The Ligation Sequencing Kit was used, and sequencing adapters did not ligate to the DNA | Make sure to use the NEBNext Quick Ligation Module (E6056) and Oxford Nanopore Technologies Ligation Buffer (LNB, provided in the sequencing kit) at the sequencing adapter ligation step, and use the correct amount of each reagent. A Lambda control library can be prepared to test the integrity of the third-party reagents. |
| Pore occupancy close to 0 | The Ligation Sequencing Kit was used, and ethanol was used instead of LFB or SFB at the wash step after sequencing adapter ligation | Ethanol can denature the motor protein on the sequencing adapters. Make sure the LFB or SFB buffer was used after ligation of sequencing adapters. |
| Pore occupancy close to 0 | No tether on the flow cell | Tethers are adding during flow cell priming (FLT tube for Kit 9, 10, 11, FCT for Kit 14, and FTU for ultra-long DNA kits). Make sure FLT/FCT/FTU was added to the buffer (FB for Kit 9, 10, 11, and FCF for Kit 14) before priming. |
Shorter than expected read length
| Observation | Possible cause | Comments and actions |
|---|---|---|
| Shorter than expected read length | Unwanted fragmentation of DNA sample | Read length reflects input DNA fragment length. Input DNA can be fragmented during extraction and library prep. 1. Please review the Extraction Methods in the Nanopore Community for best practice for extraction. 2. Visualise the input DNA fragment length distribution on an agarose gel before proceeding to the library prep. In the image above, Sample 1 is of high molecular weight, whereas Sample 2 has been fragmented.3. During library prep, avoid pipetting and vortexing when mixing reagents. Flicking or inverting the tube is sufficient. |
Large proportion of unavailable pores
| Observation | Possible cause | Comments and actions |
|---|---|---|
Large proportion of unavailable pores (shown as blue in the channels panel and pore activity plot) The pore activity plot above shows an increasing proportion of "unavailable" pores over time. | Contaminants are present in the sample | Some contaminants can be cleared from the pores by the unblocking function built into MinKNOW. If this is successful, the pore status will change to "sequencing pore". If the portion of unavailable pores stays large or increases: 1. A nuclease flush using the Flow Cell Wash Kit (EXP-WSH004) can be performed, or 2. Run several cycles of PCR to try and dilute any contaminants that may be causing problems. |
Large proportion of inactive pores
| Observation | Possible cause | Comments and actions |
|---|---|---|
| Large proportion of inactive/unavailable pores (shown as light blue in the channels panel and pore activity plot. Pores or membranes are irreversibly damaged) | Air bubbles have been introduced into the flow cell | Air bubbles introduced through flow cell priming and library loading can irreversibly damage the pores. Watch the how to load a MinION Flow Cell or how to load a PromethION Flow Cell videos for best practice. |
| Large proportion of inactive/unavailable pores | Certain compounds co-purified with DNA | Known compounds, include polysaccharides, typically associate with plant genomic DNA. 1. Please refer to the Plant leaf DNA extraction method. 2. Clean-up using the QIAGEN PowerClean Pro kit. 3. Perform a whole genome amplification with the original gDNA sample using the QIAGEN REPLI-g kit. |
| Large proportion of inactive/unavailable pores | Contaminants are present in the sample | The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover. |
Temperature fluctuation
| Observation | Possible cause | Comments and actions |
|---|---|---|
| Temperature fluctuation | The flow cell has lost contact with the device | Check that there is a heat pad covering the metal plate on the back of the flow cell. Re-insert the flow cell and press it down to make sure the connector pins are firmly in contact with the device. If the problem persists, please contact Technical Services. |
Failed to reach target temperature
| Observation | Possible cause | Comments and actions |
|---|---|---|
| MinKNOW shows "Failed to reach target temperature" | The instrument was placed in a location that is colder than normal room temperature, or a location with poor ventilation (which leads to the flow cells overheating) | MinKNOW has a default timeframe for the flow cell to reach the target temperature. Once the timeframe is exceeded, an error message will appear and the sequencing experiment will continue. However, sequencing at an incorrect temperature may lead to a decrease in throughput and lower q-scores. Please adjust the location of the sequencing device to ensure that it is placed at room temperature with good ventilation, then re-start the process in MinKNOW. Please refer to this link for more information on MinION temperature control. |

In the image above, Sample 1 is of high molecular weight, whereas Sample 2 has been fragmented.
The pore activity plot above shows an increasing proportion of "unavailable" pores over time.