MinION: Protocol

PCR tiling of SARS-CoV-2 virus - automated Agilent (SQK-RBK110.96 with EXP-MRT001) V MRTA_9157_v110_revG_18May2022

For Research Use Only

This protocol uses extracted RNA samples in an automated library preparation using the Agilent Bravo to increase reproducibility and reduce human error. Multiple samples can be prepared simultaneously for high sequencing output.

FOR RESEARCH USE ONLY

Descripción general

For Research Use Only

Document version: MRTA_9157_v110_revG_18May2022

1. Overview of the protocol

IMPORTANTE

This protocol is a work in progress and some details are expected to change over time. Please make sure you always use the most recent version of the protocol and scripts.

The PCR tiling of SARS-CoV-2 virus - automated Agilent Bravo (SQK-RBK110.96 with EXP-MRT001) protocol is an automated version of the PCR tiling of SARS-CoV-2 virus with rapid barcoding and Midnight RT PCR Expansion (SQK-RBK110.96 and EXP-MRT001) using the Agilent Bravo liquid handling robot.

Introduction to the protocol

To enable support for the rapidly expanding user requests, the team at Oxford Nanopore Technologies have put together an updated workflow based on the ARTIC Network protocols and analysis methods. The protocol uses Oxford Nanopore Technologies' Rapid Barcoding Kit 96 (SQK-RBK110.96) and Midnight RT PCR Expansion (EXP-MRT001) for barcoding and library preparation.

We have developed this automated protocol on the Agilent Bravo liquid handling robot. The majority of the process is automated with minimal hands-on time which is required for sample quantification and deck re-loading.

While this protocol is available in the Nanopore Community, we kindly ask users to ensure they are citing the members of the ARTIC network who have been behind the development of these methods.

This protocol is similar to the ARTIC amplicon sequencing protocol for MinION for SARS-CoV-2 v3 (LoCost) by Josh Quick and the method used in Freed et al., 2020. The protocol generates amplicons in a tiled fashion across the whole SARS-CoV-2 genome.

To generate tiled PCR amplicons from the SARS-CoV-2 viral cDNA for use with the Rapid Barcoding Kit 96 (SQK-RBK110.96), primers were designed by Freed et al., 2020 using Primal Scheme. These primers are in the Midnight RT PCR Expansion (EXP-MRT001) and are designed to generate 1.2 kb amplicons. Primer sequences can be found here.

Steps in the sequencing workflow:

Prepare for your experiment

you will need to:

Before starting - Manual steps:

Extract your RNA
Ensure you have your sequencing kit, the correct equipment and reagents
Prepare your reagents, samples and labware to load on the Agilent Bravo
Download the software for acquiring and analysing your data
Check your flow cell to ensure it has enough pores for a good sequencing run

### Prepare your library You will need to:

Automated steps:

Reverse transcribe your RNA samples with random hexamers
Amplify the samples by tiled PCR using separate primer pools
Combine the primer pools
Attach Rapid Barcodes supplied in the kit to the DNA ends, pool the samples and SPRI purify

__Manual steps:__

Quantify your DNA library as a quality control
Prime the flow cell and load your DNA library into the flow cell

Overview of library preparation workflow:

The image below is representative of the steps that take place in the automated runs for X96 samples.

Note: Timings are dependent on number of samples and include hands on time, such as deck loading and sample quantification

Sequencing and analysis

You will need to:

Start a sequencing run using the MinKNOW software, selecting SQK-RBK110.96 and EXP-MRT001 in kit selection, which will collect raw data from the device and convert it into basecalled reads

Timings

Note: Timings are approximate and subject to change with updates.

Process	X24 samples	X48 samples	X96 samples	Hands-on time
Deck set-up				~30 minutes
Process 1: cDNA synthesis	8 minutes	16 minutes	24 minutes
Off-Deck thermocyler	17 minutes	17 minutes	17 minutes
Process 2: cDNA amplification	10 minutes	16 minutes	21 minutes
Off-Deck thermocyler	~3 hours 30 minutes	~3 hours 30 minutes	~3 hours 30 minutes
Process 3: Rapid Barcoding	5 minutes	8 minutes	10 minutes
Off-Deck thermocyler	8 minutes	8 minutes	8 minutes
Process 4: cDNA amplicon pooling/cleanup	40 minutes	50 minutes	60 minutes
Quantification				~10 minutes
Total	4 hours 58 minutes	5 hours 25 minutes	5 hours 50 minutes	~40 minutes

Nomenclature for automation protocol

Throughout this document, 'Protocol' is defined as the assay on the whole and 'Run' refers to the individual scripts for the automated liquid handling robot, which are specific to indicated protocol step(s).

Before starting

This protocol outlines how to carry out PCR tiling of SARS-CoV-2 viral RNA samples on a 96-well plate using the Rapid Barcoding Kit 96 (SQK-RBK110.96) with the Midnight RT PCR Expansion (EXP-MRT001) using the Agilent Bravo liquid handling robot.

When processing multiple samples at once, we recommend making master mixes following the indicated volumes to account for the necessary excess. We also recommend using a template-free pre-PCR hood for making up the master mixes, and a separate template pre-PCR hood for handling the samples. It is important to clean and/or UV irradiate these hoods between sample batches. Furthermore, to track and monitor cross-contamination events, it is important to run a negative control reaction at the reverse transcription stage using nuclease-free water instead of sample, and carrying this control through the rest of the prep.

All post-PCR procedures should be carried out in a separate area to the pre-PCR preparation, with dedicated equipment for liquid handling in each area to minimise risk of contamination.

If only one liquid handling robot is available, both pre-PCR and post-PCR sections of the assay can be performed in the same robot. In this scenario, cleaning the equipment thoroughly between runs is required and we recommend validating the process for your unique set-up.

IMPORTANTE

Compatibility of this protocol

This protocol should only be used in combination with:

Rapid Barcoding Kit 96 (SQK-RBK110.96)
Midnight RT PCR Expansion (EXP-MRT001)
R9.4.1 flow cells (FLO-MIN106)
Flow Cell Wash Kit (EXP-WSH004)

2. Equipment and consumables

Material

Input RNA in 10 mM Tris-HCl, pH 8.0
Rapid Barcoding Kit 96 (SQK-RBK110.96)
Midnight RT PCR Expansion (EXP-MRT001)

Consumibles

Nuclease-free water (e.g. ThermoFisher, AM9937)
Etanol al 80 % recién preparado con agua sin nucleasas
Qubit dsDNA HS Assay Kit (Invitrogen Q32851) (kit de ensayo ADNbc alta sensibilidad)
Tubos de ensayo Qubit™ (Invitrogen Q32856)
1.5 ml Eppendorf DNA LoBind tubes
2 ml Eppendorf DNA LoBind tubes
5 ml Eppendorf DNA LoBind tubes
Bravo Lab Disposable Pipette Tips 250 µl - compatible with Bravo 96LT head (19477-022)
Arvensis B-Frame BIOCOMPOSITE 96 Well PCR Plate Fully Skirted Low Profile 0.2 ml wells
Hard-Shell® 96-Well PCR Plates, low profile, thin-walled, skirted, white/clear (Bio-Rad, Cat # HSP9601)
96-well 0.8 ml MIDI plate (we recommend Abgene™ 96 Well 0.8 ml Polypropylene Deepwell Storage Plate: ThermoFisher, Cat # AB0859)
PCR plate seals

Instrumental

Agilent Bravo liquid handling robot
Centrifuge capable of taking 96-well plates
Microfuge
Mezclador vórtex
Termociclador
Pipeta y puntas P1000
Pipeta y puntas P200
Pipeta y puntas P100
Pipeta y puntas P20
Pipeta y puntas P10
Cubeta con hielo
Temporizador
Qubit fluorometer (or equivalent)

Equipo opcional

Centrifuga Eppendorf 5424 (o equivalente)
PCR hood with UV steriliser (optional but recommended to reduce cross-contamination)
PCR-Cooler (Eppendorf)
Stepper pipette and tips

Rapid Barcoding Kit 96 (SQK-RBK110.96) contents

Name	Acronym	Cap colour	No. of vials	Fill volume per vial (µl)
Rapid Barcode plate	RB96	-	3 plates	8 µl per well
AMPure XP Beads	AXP	Brown	3	1,200
Sequencing Buffer II	SBII	Red	1	500
Rapid Adapter F	RAP-F	Green	1	25
Elution Buffer	EB	Black	1	500
Loading Beads II	LBII	Pink	1	360
Loading Solution	LS	White cap, pink label	1	400
Flush Tether	FLT	Purple	1	400
Flush Buffer	FB	White	1 bottle	15,500

This product contains AMPure XP reagent manufactured by Beckman Coulter, Inc.

Midnight RT PCR Expansion (EXP-MRT001) contents

Name	Acronym	Cap colour	Number of vials	Fill volume per vial (µl)
LunaScript RT SuperMix	LS RT	Blue	3	500
Q5 HS Master Mix	Q5	Orange	6	1,500
Midnight Primer Pool A	MP A	White	3	15
Midnight Primer Pool B	MP B	Clear	3	15

Midnight Primer sequences

As mutations in SARS-CoV-2 variants emerge amplicon drop out may be observed; for users wishing to design their own primer spike-ins to address this we suggest adding to the appropriate primer pool at a final concentration between 3.33 µM and 6.66 µM.

Below are the sequences for the V3 primer scheme used in the Midnight RT PCR Expansion.

Pool A

Primer name	Primer Sequence
`SARSCoV_1200_1_LEFT`	ACCAACCAACTTTCGATCTCTTGT
`SARSCoV_1200_1_RIGHT`	GGTTGCATTCATTTGGTGACGC
`SARSCoV_1200_3_LEFT`	GGCTTGAAGAGAAGTTTAAGGAAGGT
`SARSCoV_1200_3_RIGHT`	GATTGTCCTCACTGCCGTCTTG
`SARSCoV_1200_5_LEFT`	ACCTACTAAAAAGGCTGGTGGC
`SARSCoV_1200_5_RIGHT`	AGCATCTTGTAGAGCAGGTGGA
`SARSCoV_1200_7_LEFT`	ACCTGGTGTATACGTTGTCTTTGG
`SARSCoV_1200_7_RIGHT`	GCTGAAATCGGGGCCATTTGTA
`SARSCoV_1200_9_LEFT`	AGAAGTTACTGGCGATAGTTGTAATAACT
`SARSCoV_1200_9_RIGHT`	TGCTGATATGTCCAAAGCACCA
`SARSCoV_1200_11_LEFT`	AGACACCTAAGTATAAGTTTGTTCGCA
`SARSCoV_1200_11_RIGHT`	GCCCACATGGAAATGGCTTGAT
`SARSCoV_1200_13_LEFT`	ACCTCTTACAACAGCAGCCAAAC
`SARSCoV_1200_13_RIGHT`	CGTCCTTTTCTTGGAAGCGACA
`SARSCoV_1200_15_LEFT`	TTTTAAGGAATTACTTGTGTATGCTGCT
`SARSCoV_1200_15_RIGHT`	ACACACAACAGCATCGTCAGAG
`SARSCoV_1200_17_LEFT`	TCAAGCTTTTTGCAGCAGAAACG
`SARSCoV_1200_17_RIGHT`	CCAAGCAGGGTTACGTGTAAGG
`SARSCoV_1200_19_LEFT`	GGCACATGGCTTTGAGTTGACA
`SARSCoV_1200_19_RIGHT`	CCTGTTGTCCATCAAAGTGTCCC
`SARSCoV_1200_21_LEFT`	TCTGTAGTTTCTAAGGTTGTCAAAGTGA
`SARSCoV_1200_21_RIGHT`	GCAGGGGGTAATTGAGTTCTGG
`21_right_spike`	GTGTATGATTGAGTTCTGGTTGTAAG
`SARSCoV_1200_23_LEFT`	ACTTTAGAGTCCAACCAACAGAATCT
`23_left_spike`	ACTTTAGAGTTCAACCAACAGAATCT
`SARSCoV_1200_23_RIGHT`	TGACTAGCTACACTACGTGCCC
`SARSCoV_1200_25_LEFT`	TGCTGCTACTAAAATGTCAGAGTGT
`SARSCoV_1200_25_RIGHT`	CATTTCCAGCAAAGCCAAAGCC
`SARSCoV_1200_27_LEFT`	TGGATCACCGGTGGAATTGCTA
`SARSCoV_1200_27_RIGHT`	TGTTCGTTTAGGCGTGACAAGT
`SARSCoV_1200_29_LEFT`	TGAGGGAGCCTTGAATACACCA
`SARSCoV_1200_29_RIGHT`	TAGGCAGCTCTCCCTAGCATTG

Pool B

Primer name	Primer sequences
`SARSCoV_1200_2_LEFT`	CCATAATCAAGACTATTCAACCAAGGGT
`SARSCoV_1200_2_RIGHT`	ACAGGTGACAATTTGTCCACCG
`SARSCoV_1200_4_LEFT`	GGAATTTGGTGCCACTTCTGCT
`SARSCoV_1200_4_RIGHT`	CCTGACCCGGGTAAGTGGTTAT
`SARSCoV_1200_6_LEFT`	ACTTCTATTAAATGGGCAGATAACAACTG
`SARSCoV_1200_6_RIGHT`	GATTATCCATTCCCTGCGCGTC
`SARSCoV_1200_8_LEFT`	CAATCATGCAATTGTTTTTCAGCTATTTTG
`SARSCoV_1200_8_RIGHT`	TGACTTTTTGCTACCTGCGCAT
`SARSCoV_1200_10_LEFT`	TTTACCAGGAGTTTTCTGTGGTGT
`SARSCoV_1200_10_RIGHT`	TGGGCCTCATAGCACATTGGTA
`SARSCoV_1200_12_LEFT`	ATGGTGCTAGGAGAGTGTGGAC
`SARSCoV_1200_12_RIGHT`	GGATTTCCCACAATGCTGATGC
`SARSCoV_1200_14_LEFT`	ACAGGCACTAGTACTGATGTCGT
`SARSCoV_1200_14_RIGHT`	GTGCAGCTACTGAAAAGCACGT
`SARSCoV_1200_16_LEFT`	ACAACACAGACTTTATGAGTGTCTCT
`SARSCoV_1200_16_RIGHT`	CTCTGTCAGACAGCACTTCACG
`SARSCoV_1200_18_LEFT`	GCACATAAAGACAAATCAGCTCAATGC
`SARSCoV_1200_18_RIGHT`	TGTCTGAAGCAGTGGAAAAGCA
`SARSCoV_1200_20_LEFT`	ACAATTTGATACTTATAACCTCTGGAACAC
`SARSCoV_1200_20_RIGHT`	GATTAGGCATAGCAACACCCGG
`SARSCoV_1200_22_LEFT`	GTGATGTTCTTGTTAACAACTAAACGAACA
`SARSCoV_1200_22_RIGHT`	AACAGATGCAAATCTGGTGGCG
`22_right_spike`	AACAGATGCAAATTTGGTGGCG
`SARSCoV_1200_24_LEFT`	GCTGAACATGTCAACAACTCATATGA
`24_left_spike`	GCTGAATATGTCAACAACTCATATGA
`SARSCoV_1200_24_RIGHT`	ATGAGGTGCTGACTGAGGGAAG
`SARSCoV_1200_26_LEFT`	GCCTTGAAGCCCCTTTTCTCTA
`SARSCoV_1200_26_RIGHT`	AATGACCACATGGAACGCGTAC
`SARSCoV_1200_28_LEFT`	TTTGTGCTTTTTAGCCTTTCTGCT
`SARSCoV_1200_28_RIGHT`	GTTTGGCCTTGTTGTTGTTGGC
`SARSCoV_1200_28_LEFT_27837T`	TTTGTGCTTTTTAGCCTTTCTGTT

Rapid barcode sequences

Component	Sequence
RB01	AAGAAAGTTGTCGGTGTCTTTGTG
RB02	TCGATTCCGTTTGTAGTCGTCTGT
RB03	GAGTCTTGTGTCCCAGTTACCAGG
RB04	TTCGGATTCTATCGTGTTTCCCTA
RB05	CTTGTCCAGGGTTTGTGTAACCTT
RB06	TTCTCGCAAAGGCAGAAAGTAGTC
RB07	GTGTTACCGTGGGAATGAATCCTT
RB08	TTCAGGGAACAAACCAAGTTACGT
RB09	AACTAGGCACAGCGAGTCTTGGTT
RB10	AAGCGTTGAAACCTTTGTCCTCTC
RB11	GTTTCATCTATCGGAGGGAATGGA
RB12	CAGGTAGAAAGAAGCAGAATCGGA
RB13	AGAACGACTTCCATACTCGTGTGA
RB14	AACGAGTCTCTTGGGACCCATAGA
RB15	AGGTCTACCTCGCTAACACCACTG
RB16	CGTCAACTGACAGTGGTTCGTACT
RB17	ACCCTCCAGGAAAGTACCTCTGAT
RB18	CCAAACCCAACAACCTAGATAGGC
RB19	GTTCCTCGTGCAGTGTCAAGAGAT
RB20	TTGCGTCCTGTTACGAGAACTCAT
RB21	GAGCCTCTCATTGTCCGTTCTCTA
RB22	ACCACTGCCATGTATCAAAGTACG
RB23	CTTACTACCCAGTGAACCTCCTCG
RB24	GCATAGTTCTGCATGATGGGTTAG
RB25	GTAAGTTGGGTATGCAACGCAATG
RB26	CATACAGCGACTACGCATTCTCAT
RB27	CGACGGTTAGATTCACCTCTTACA
RB28	TGAAACCTAAGAAGGCACCGTATC
RB29	CTAGACACCTTGGGTTGACAGACC
RB30	TCAGTGAGGATCTACTTCGACCCA
RB31	TGCGTACAGCAATCAGTTACATTG
RB32	CCAGTAGAAGTCCGACAACGTCAT
RB33	CAGACTTGGTACGGTTGGGTAACT
RB34	GGACGAAGAACTCAAGTCAAAGGC
RB35	CTACTTACGAAGCTGAGGGACTGC
RB36	ATGTCCCAGTTAGAGGAGGAAACA
RB37	GCTTGCGATTGATGCTTAGTATCA
RB38	ACCACAGGAGGACGATACAGAGAA
RB39	CCACAGTGTCAACTAGAGCCTCTC
RB40	TAGTTTGGATGACCAAGGATAGCC
RB41	GGAGTTCGTCCAGAGAAGTACACG
RB42	CTACGTGTAAGGCATACCTGCCAG
RB43	CTTTCGTTGTTGACTCGACGGTAG
RB44	AGTAGAAAGGGTTCCTTCCCACTC
RB45	GATCCAACAGAGATGCCTTCAGTG
RB46	GCTGTGTTCCACTTCATTCTCCTG
RB47	GTGCAACTTTCCCACAGGTAGTTC
RB48	CATCTGGAACGTGGTACACCTGTA
RB49	ACTGGTGCAGCTTTGAACATCTAG
RB50	ATGGACTTTGGTAACTTCCTGCGT
RB51	GTTGAATGAGCCTACTGGGTCCTC
RB52	TGAGAGACAAGATTGTTCGTGGAC
RB53	AGATTCAGACCGTCTCATGCAAAG
RB54	CAAGAGCTTTGACTAAGGAGCATG
RB55	TGGAAGATGAGACCCTGATCTACG
RB56	TCACTACTCAACAGGTGGCATGAA
RB57	GCTAGGTCAATCTCCTTCGGAAGT
RB58	CAGGTTACTCCTCCGTGAGTCTGA
RB59	TCAATCAAGAAGGGAAAGCAAGGT
RB60	CATGTTCAACCAAGGCTTCTATGG
RB61	AGAGGGTACTATGTGCCTCAGCAC
RB62	CACCCACACTTACTTCAGGACGTA
RB63	TTCTGAAGTTCCTGGGTCTTGAAC
RB64	GACAGACACCGTTCATCGACTTTC
RB65	TTCTCAGTCTTCCTCCAGACAAGG
RB66	CCGATCCTTGTGGCTTCTAACTTC
RB67	GTTTGTCATACTCGTGTGCTCACC
RB68	GAATCTAAGCAAACACGAAGGTGG
RB69	TACAGTCCGAGCCTCATGTGATCT
RB70	ACCGAGATCCTACGAATGGAGTGT
RB71	CCTGGGAGCATCAGGTAGTAACAG
RB72	TAGCTGACTGTCTTCCATACCGAC
RB73	AAGAAACAGGATGACAGAACCCTC
RB74	TACAAGCATCCCAACACTTCCACT
RB75	GACCATTGTGATGAACCCTGTTGT
RB76	ATGCTTGTTACATCAACCCTGGAC
RB77	CGACCTGTTTCTCAGGGATACAAC
RB78	AACAACCGAACCTTTGAATCAGAA
RB79	TCTCGGAGATAGTTCTCACTGCTG
RB80	CGGATGAACATAGGATAGCGATTC
RB81	CCTCATCTTGTGAAGTTGTTTCGG
RB82	ACGGTATGTCGAGTTCCAGGACTA
RB83	TGGCTTGATCTAGGTAAGGTCGAA
RB84	GTAGTGGACCTAGAACCTGTGCCA
RB85	AACGGAGGAGTTAGTTGGATGATC
RB86	AGGTGATCCCAACAAGCGTAAGTA
RB87	TACATGCTCCTGTTGTTAGGGAGG
RB88	TCTTCTACTACCGATCCGAAGCAG
RB89	ACAGCATCAATGTTTGGCTAGTTG
RB90	GATGTAGAGGGTACGGTTTGAGGC
RB91	GGCTCCATAGGAACTCACGCTACT
RB92	TTGTGAGTGGAAAGATACAGGACC
RB93	AGTTTCCATCACTTCAGACTTGGG
RB94	GATTGTCCTCAAACTGCCACCTAC
RB95	CCTGTCTGGAAGAAGAATGGACTT
RB96	CTGAACGGTCATAGAGTCCACCAT

3. Computer requirements and software

Requisitos informáticos para el MinION Mk1B

Para secuenciar con el MinION Mk1B es necesario tener un ordenador o portátil de alto rendimiento, que pueda soportar la velocidad de adquisición de datos. Encontrará más información en el documento MinION Mk1B IT Requirements.

Requisitos informáticos para el MinION Mk1C

El MinION Mk1C contiene ordenador y pantalla integrados, lo que elimina la dependencia de cualquier accesorio para generar y analizar datos de nanoporos. Encontrará más información en el documento MinION Mk1C IT Requirements.

Software for nanopore sequencing

MinKNOW

The MinKNOW software controls the nanopore sequencing device, collects sequencing data and basecalls in real time. You will be using MinKNOW for every sequencing experiment to sequence, basecall and demultiplex if your samples were barcoded.

For instructions on how to run the MinKNOW software, please refer to the MinKNOW protocol.

EPI2ME (optional)

The EPI2ME cloud-based platform performs further analysis of basecalled data, for example alignment to the Lambda genome, barcoding, or taxonomic classification. You will use the EPI2ME platform only if you would like further analysis of your data post-basecalling.

For instructions on how to create an EPI2ME account and install the EPI2ME Desktop Agent, please refer to this link.

Verificar la celda de flujo

Antes de empezar el experimento de secuenciación, recomendamos verificar el número de poros disponibles, presentes en la celda de flujo. La comprobación deberá realizarse en las primeras 12 semanas desde su adquisición, si se trata de celdas de flujo MinION, GridION o PromethION, y en las primeras cuatro semanas tras la compra de celdas de flujo Flongle. Oxford Nanopore Technologies sustituirá cualquier celda de flujo con un número de poros inferior al indicado en la tabla siguiente, siempre y cuando el resultado se notifique dentro de los dos días siguientes a la comprobación y se hayan seguido las instrucciones de almacenamiento. Para verificar la celda de flujo, siga las instrucciones del documento Flow Cell Check.

Celda de flujo	Número mínimo de poros activos cubierto por la garantía
Flongle	50
MinION/GridION	800
PromethION	5000

4. Pre-PCR

Material

Input RNA in 10 mM Tris-HCl, pH 8.0
Midnight Primer Pool A (MP A)
Midnight Primer Pool B (MP B)

Consumibles

Arvensis B-Frame BIOCOMPOSITE 96 Well PCR Plate Fully Skirted Low Profile 0.2 ml wells
Bravo Lab Disposable Pipette Tips 250 µl - compatible with Bravo 96LT head (19477-022)
PCR plate seals
Nuclease-free water (e.g. ThermoFisher, cat # AM9937)
LunaScript RT SuperMix (LS RT)
Tubos de 1,5 ml Eppendorf DNA LoBind
Q5 HS Master Mix (Q5)

Instrumental

Ice bucket with ice
PCR hood with UV steriliser (optional but recommended to reduce cross-contamination)
Agilent Bravo liquid handling robot
P1000 pipette and tips
P200 pipette and tips
Pipeta y puntas P20
P2 pipette and tips
Microfuge
Termociclador
Centrifuge capable of taking 96-well plates

Run setup:

To cool position 4 prior to the run: open the file, under the deck layout, and tick the box near the block you want to cool. Set up the temperature and hit 'Run' to execute.

IMPORTANTE

To minimise risk of contamination, we recommend handling the Lunascript and primers in a clean template-free PCR hood.

IMPORTANTE

Prior to use, ensure all reagents have been thoroughly mixed by performing 20-30 full-volume pipette mixes.

Note: This is especially important with the Q5 Hot start master mix as the contents can precipitate following freeze-thaw cylces.

Take care when mixing and vortexing as this will introduce air bubbles, resulting in loss of volume.

For x24 samples:

| Reagent | Pool A | Pool B | | --- | --- | --- | --- | --- | | Nuclease-free water | 172 µl | 172 µl | | Midnight Primer Pool A (MP A) | 2 µl | - | | Midnight Primer Pool B (MP B) | - | 2 µl | | Q5 HS Master Mix (Q5) | 102 µl | 102 µl | | Total | 276 µl | 276 µl |

For x48 samples:

| Reagent | Pool A | Pool B | | --- | --- | --- | --- | --- | | Nuclease-free water | 344 µl | 344 µl | | Midnight Primer Pool A (MP A) | 3 µl | - | | Midnight Primer Pool B (MP B) | - | 3 µl | | Q5 HS Master Mix (Q5) | 203 µl | 203 µl | | Total | 550 µl | 550 µl |

For x96 samples:

| Reagent | Pool A | Pool B | | --- | --- | --- | --- | --- | | Nuclease-free water | 687 µl | 687 µl | | Midnight Primer Pool A (MP A) | 6 µl | - | | Midnight Primer Pool B (MP B) | - | 6 µl | | Q5 HS Master Mix (Q5) | 407 µl | 407 µl | | Total | 1,100 µl | 1,100 µl |

Note: Taking care not to introduce air bubbles, pipette mix 10-15 times between each addition and perform a final full-volume pipette mix 10 times.

Keep on ice until use.

For x24 samples:

For x48 samples:

For x96 samples:

Note: Take care to not introduce air bubbles while aliquoting the reagents into the Arvensis plate.

Once complete seal the plate and keep on ice until ready to transfer over to the Agilent Bravo robot.

For x24 samples:

For x48 samples:

For x96 samples:

Note: Take care to not introduce air bubbles while aliquoting the samples into the Arvensis plate.

Once complete seal the plate and keep on ice until ready to transfer over to the Agilent Bravo robot.

For X24 samples, select 3
For X48 samples, select 6
For X96 samples, select 12

For X24 samples:

For X48 samples:

For X96 samples:

After the Agilent Bravo has added the 2 µl of LunaScript to the samples, the robot will stop with the the following message:

Step	Temperature	Time	Cycles
Primer annealing	25°C	2 min	1
cDNA synthesis	55°C	10 min	1
Heat inactivation	95°C	1 min	1
Hold	4°C	∞

After the Agilent Bravo has added the 2.5 µl of RT to the Primer master mix plate/plates, the robot will stop with the the following message:

Step	Temperature	Time	Cycles
Initial denaturation	98°C	30 sec	1
Denaturation Annealing and extension	98°C 61°C 65°C	15 sec 2 min 3 min	35
Hold	4°C	∞

FIN DEL PROCESO

Once the PCR amplification is complete, remove the plate(s) from the thermal cycler and spin down. The plate(s) will be taken forward to the Post-PCR section of the protocol.

If necessary, the protocol can be paused at this point. The samples should be kept at 4°C and can be stored overnight.

5. Post-PCR

Material

Rapid Barcode Plate (RB96)
AMPure XP Beads (AXP, or SPRI)
Elution Buffer from the Oxford Nanopore kit (EB)
Rapid Adapter F (RAP F)

Consumibles

Nuclease-free water (e.g. ThermoFisher, cat # AM9937)
Etanol al 80 % recién preparado con agua sin nucleasas
Bravo Lab Disposable Pipette Tips 250 µl - compatible with Bravo 96LT head (19477-022)
Arvensis B-Frame BIOCOMPOSITE 96 Well PCR Plate Fully Skirted Low Profile 0.2 ml wells
96-well 0.8 ml MIDI plate (we recommend Abgene™ 96 Well 0.8 ml Polypropylene Deepwell Storage Plate: ThermoFisher, Cat # AB0859)
PCR plate seals
Tubos de ensayo Qubit™ (Invitrogen Q32856)
Qubit dsDNA HS Assay Kit (Invitrogen Q32851) (kit de ensayo ADNbc alta sensibilidad)

Instrumental

Agilent Bravo liquid handling robot
Termociclador
Centrifuge capable of taking 96-well plates
Pipeta y puntas P1000
Pipeta y puntas P200
P20 pipette and tips
P2 pipette and tips
Fluorímetro Qubit (o equivalente para el control de calidad)

Rapid Barcoding:

For three columns of each primer pool (6 in total), select 3 columns.
For six columns of each primer pool (12 in total), select 6 columns.
For twelve columns of each primer pool (24 in total), select 12 columns.

MEDIDA OPCIONAL

For runs using X24 or X48 samples, you will need to enter the starting index plate column for the RBK plate when prompted.

For example: If your barcode starts at column 4, enter "4" as seen in the figure below.

After the Agilent Bravo has completed the Rapid Barcoding plate, the robot will stop with the following message:

Sample pooling and clean-up:

For X24 samples:

For X48 samples:

For X96 samples:

Note: Take care to not introduce air bubbles while aliquoting the reagents into the deep-well plate.

Ensure all reagents are properly mixed prior to use.

When preparing the plates, well A12 will be empty. This is where the final elution will be found at the end of the Agilent Bravo run.

For X24 or X48 samples:

For X96 samples:

Ensure all of the labware and reagent plates are in the correct positions, you have removed all of the lids and the plates are unsealed before continuing.

FIN DEL PROCESO

The quantified library is used for loading into the MinION flow cell. Store the library on ice until ready to load.

6. Priming and loading the SpotON Flow Cell

Material

Flush Buffer (FB)
Flush Tether (FLT)
Loading Beads II (LBII)
Sequencing Buffer II (SBII)
Loading Solution (LS)

Consumibles

Tubos de 1,5 ml Eppendorf DNA LoBind

Instrumental

MinION device
SpotON Flow Cell
Pantalla protectora celdas de flujo MinION/GridION
Pipeta y puntas P1000
Pipeta y puntas P100
Pipeta y puntas P20
Pipeta y puntas P10

CONSEJO

Cebado y carga de la celda de flujo

Se recomienda a los nuevos usuarios que miren el vídeo Priming and loading your flow cell antes de realizar su primer experimento.

Using the Loading Solution

We recommend using the Loading Beads II (LBII) for loading your library onto the flow cell for most sequencing experiments. However, if you have previously used water to load your library, you must use Loading Solution (LS) instead of water. Note: some customers have noticed that viscous libraries can be loaded more easily when not using Loading Beads II.

Reagent	Volume per flow cell
Flush Tether (FLT)	30 µl
Flush Buffer (FB)	1,170 µl

Press down firmly on the flow cell to ensure correct thermal and electrical contact.

MEDIDA OPCIONAL

Antes de cargar la biblioteca, verifique la celda de flujo para determinar el número de poros disponible.

Si se ha verificado con anterioridad la cantidad de poros presentes en la celda de flujo, este paso se puede omitir.

Dispone de más información en las instrucciones de comprobación de la celda de flujo, del protocolo de MinKNOW.

IMPORTANTE

Tenga cuidado a la hora de extraer el tampón de la celda de flujo. No retire más de 20-30 μl y asegúrese de que el tampón cubra la matriz de poros en todo momento. La introducción de burbujas de aire en la matriz puede dañar los poros de manera irreversible.

Ajustar una pipeta P1000 a 200 μl.
Introducir la punta de la pipeta en el puerto de cebado.
Girar la rueda hasta que el indicador de volumen marque 220-230 μl o hasta que se pueda ver una pequeña cantidad de tampón entrar en la punta de la pipeta.

Nota: Comprobar que haya un flujo continuo de tampón circulando desde el puerto de cebado a través de la matriz de poros.

IMPORTANTE

The Loading Beads II (LBII) tube contains a suspension of beads. These beads settle very quickly. It is vital that they are mixed immediately before use.

Reagent	Volume per flow cell
Sequencing Buffer II (SBII)	37.5 µl
Loading Beads II (LBII) mixed immediately before use, or Loading Solution (LS), if using	25.5 µl
DNA library	12 µl
Total	75 µl

Note: Load the library onto the flow cell immediately after adding the Sequencing Buffer II (SBII) and Loading Beads II (LBII) because the fuel in the buffer will start to be consumed by the adapter.

Levantar suavemente la tapa del puerto de carga SpotON.
Cargar 200 µl de solución en el puerto de cebado (no en el puerto de muestra SpotON), evitando introducir burbujas de aire.

IMPORTANTE

Para obtener resultados de secuenciación óptimos, coloque la pantalla protectora sobre la celda de flujo justo después de cargar la biblioteca.

Recomendamos colocar la pantalla protectora en la celda de flujo y dejarla puesta mientras la biblioteca esté cargada, incluyendo los lavados y pasos de recarga. Retirar la pantalla cuando se haya extraído la biblioteca de la celda de flujo.

Colocar con cuidado el borde delantero de la pantalla protectora contra el clip. Nota: No hacer fuerza sobre ella.
Colocar la pantalla protectora con suavidad sobre la celda de flujo. La pieza debe asentarse alrededor de la tapa SpotON y debe cubrir por completo la sección superior de la celda de flujo.

ATENCIÓN

La pantalla protectora no está fijada a la celda de flujo. Una vez colocada, es necesario manipularla con cuidado.

FIN DEL PROCESO

Cerrar la tapa del dispositivo y configurar un experimento de secuenciación en MinKNOW.

7. Data acquisition and basecalling

Aspectos generales del análisis de datos de nanoporos

Para obtener una descripción completa del análisis de datos de nanoporos, que incluya distintas posibilidades para el análisis de identificación y postidentificicación de bases, consultar el documento Data Analysis.

IMPORTANTE

Required settings in MinKNOW

The correct barcoding parameters must be set up on MinKNOW prior to the sequencing run. During the run setup, in the Analysis tab:

Enable Barcoding.
Select Edit options.
Enable Mid-read barcode filtering.
Enable Override minimum barcoding score and set the value to 60.
Enable Override minimum mid-read barcoding score and set the value to 50.

Cómo empezar a secuenciar

El programa MinKNOW realiza el control del dispositivo de secuenciación, la adquisición de datos y la identificación de bases en tiempo real. Una vez que el usuario ha instalado MinKNOW en su ordenador, hay diferentes maneras de llevar a cabo la secuenciación:

1. Adquisición de datos e identificación de bases en tiempo real con el programa MinKNOW.

Seguir las instrucciones del protocolo de MinKNOW, desde el apartado "Starting a sequencing run" hasta el final del apartado "Completing a MinKNOW run".

2. Adquisición de datos e identificación de bases en tiempo real con el dispositivo GridION.

Seguir las instrucciones del manual de usuario de GridION.

3. Adquisición de datos e identificación de bases en tiempo real con el dispositivo MinION Mk1C.

Seguir las instrucciones del manual de usuario de MinION Mk1C.

4. Adquisición de datos e identificación de bases en tiempo real con el dispositivo PromethION.

Seguir las instrucciones de los manuales de usuario de PromethION o PromethION 2 Solo.

5. Adquisición de datos e identificación de bases posterior mediante MinKNOW.

Seguir las instrucciones del protocolo de MinKNOW, desde el apartado "Starting a sequencing run" hasta el final del apartado "Completing a MinKNOW run". Al configurar los parámetros del experimento, ajustar la pestaña Basecalling (Identificación de bases) en posición de APAGADO. Al terminar el experimento de secuenciación, seguir las instrucciones del apartado "Post-run analysis" del protocolo de MinKNOW.

8. Downstream analysis

Recommended pipeline analysis

The wf-artic is a bioinformatics workflow for the analysis of ARTIC sequencing data prepared using the Midnight protocol. The bioinformatics workflow is orchestrated by the Nextflow software. Nextflow is a publicly available and open-source project that enables the execution of scientific workflows in a scalable and reproducible way. The software is natively supported on the GridION device and can be simply installed on most Linux computers and servers. The installation is outlined later in the document.

The Midnight analysis uses the ARTIC bioinformatics workflow.

Demultiplexed sequence reads are processed using the ARTIC FieldBioinformatics software that has been subtly modified for the analysis of FASTQ sequences prepared using Oxford Nanopore rapid sequencing kits. The other modification to the ARTIC workflow is the use of a primer scheme that defines the sequencing primers used by the Midnight protocol and their genomic locations on the SARS-CoV-2 genome.

The wf-artic workflow includes other analytical steps that include cladistic analysis using Nextclade and strain assignment using Pangolin. The data facets included in the report are parameterised and additional information such as plots of depth-of-coverage across the reference genome is optional.

The complete source for wf-artic is linked and the Nextflow software will download the scripts and logic flow from this location.

On GridION devices, the wf-artic workflow will start automatically after sequencing. However, on other devices, this will have to be started manually as outlined further on this page under 'Running a Midnight analysis'.

Software set up and installation

The wf-artic workflow requires the Nextflow and Docker software to have been installed. The EPI2ME quickstart guide provides instructions for the installation of these requirements for GridION, PromethION and general Ubuntu Linux users and provides a little more introduction to the Nextflow software.

Automatic start on GridION:

To set up the Midnight analysis to start automatically after sequencing on GridION, select the Rapid Barcoding Kit 96 (SQK-RBK110.96) kit with the Midnight RT PCR Expansion (EXP-MRT001) pack on MinKNOW when setting up a sequencing run.

When the workflow has finished, the relevant analysis files will be available in the following output folder:

processing/artic/artic_DATE_TIME_67195e17

Post-run analysis on GridION:

The Midnight analysis can also be started post-run on GridION:

On the start page, click 'Analysis'
Click 'Workflow'
From the dropdown menu, select 'post_processing/artic/artic'
Select your input folder with the sequencing data and the location for the output folder

Using Linux command line:

The wf-artic workflow can be run from the Linux command line. The workflow can be installed or updated with the command:

$ nextflow pull epi2me-labs/wf-artic

Demultiplexing of multiple barcoded samples

The wf-artic requires FASTQ format sequence data that has already been demultiplexed. Sequences can either be demultiplexed directly in the MinKNOW software or as a post-sequencing step by the guppy_barcoder software provided by the Guppy software.

The Midnight protocol uses a rapid barcoding kit; it is therefore important to note that the demultiplexing step must not require barcodes at both ends of the sequence.

The expected input for wf-artic is a folder of folders as shown below. Each of the barcode folders should contain the FASTQ sequence data and files may either be uncompressed or gzipped.

$ tree -d MidnightFastq/

MidnightFastq/

├── barcode01

├── barcode02

├── barcode03

├── barcode04

├── barcode05

├── barcode06

└── unclassified

Running a Midnight analysis

The reference command for running a Midnight analysis is as follows. The parameters are explained further on in the document.

nextflow run epi2me-labs/wf-artic \

--scheme_name SARS-CoV-2 \

--scheme_version V1200 \

--min_len 200 \

--max_len 1100 \

--out_dir PATH_TO_OUTPUT \

--fastq PATH_TO_FASTQ_PASS \

-work-dir PATH_TO_INTERMEDIATE_FILES

Type the command into you linux terminal and press enter.

Nextflow will describe the analysis as it progresses; the figure above shows an example run from a 48-plex analysis. We can see which processes have completed and the processes that are still running and or queued.

Parameter definitions

nextflow run epi2me-labs/wf-artic An instruction to use the Nextflow software to run a workflow, which is further explained here.
--scheme_name SARS-CoV-2 An instruction for the ARTIC software to use the primer scheme that corresponds to the amplicons tiled across the whole SARS-CoV-2 genome.
--scheme_version V1200 This defines the version of the ARTIC primers to use. The Midnight protocol uses the primer set refered to as V1200.
–-min_len 200 This sets the minimum allowed sequence length as 200 nucleotides.
–-max_len 1100 This sets the maximum allowed sequence length as 1100 nucleotides.
--out_dir PATH_TO_OUTPUT This instructs the Nextflow software where the results should be stored; please change PATH_TO_OUTPUT to the location on your computer where files should be stored.
--fastq PATH_TO_FASTQ_PASS This instructs Nextflow which sequences should be used in the analysis. Please change PATH_TO_FASTQ_PASS to an existing fastq_pass folder from a Midnight run.
-work_dir PATH TO WORK DIRECTORY Please note the single hyphen; this is a Nextflow parameter. This defines where the intermediate files are stored. This folder may contain a significant amount of information; please see the section on housekeeping.

Other command line parameters

Other commands and options can be provided to the Nextflow command:

--samples This describes a sample file that links barcode identifier with sample names. These sample names will be reported in the HTML format report and in the CSV file of genotypes. The sample file should be a comma-delimited file and must contain the column names barcode and sample_name.
--help This will display the help-file which describes the available parameters and other information on default values and their meanings.
--medaka_model This defines the model that should be used by the Medaka software for variant calling (and thus consensus preparation).

IMPORTANTE

Basecalling model

If you are basecalling using a FAST model, then this should be changed to reflect the appropriate model and version of Guppy used.

Default model used: r941_min_hac_variant_g507.
If you have used FAST basecalling, please use: r941_min_fast_variant_g507.
If HAC basecalling was performed using an earlier version of MinKNOW, please use: r941_min_high_g360.

Result files

Results will be written to the location specified by the --out_dir parameter. These output results include:

all_consensus.fasta A multi-FASTA format sequence file containing the consensus sequence for each of the samples investigated. This consensus sequence has been prepared for the whole SARS-CoV-2 genome, not just the spike protein region. The consensus sequence masks the non-spike regions and regions of low sequence coverage with N residues.
all_variants.vcf.gz A gzipped VCF file that describes all high-quality genetic variants called by medaka from the sequenced samples.
all_variants.vcf.gz.tbi An index file for the gzipped VCF file.
consensus_status.txt A tab delimited file that reports whether a consensus sequence has been successfully prepared for a sample, or not.
wf-artic-report.html A report summarising these data. This HTML format report also includes the output of the Nextclade software that can be used for a visual inspection of, for example, primer drop out or other qualitative consensus sequence aspects.

Other files are included in the work-directory. This includes per sample VCF files of all genetic variants prior to filtering and other sequences.

Housekeeping and disk usage

The nextflow parameter, -work-dir, was introduced as a parameter to define where the workflow intermediate files are stored. This folder will accumulate a significant number of files that correspond to raw BAM files and other larger intermediates. We recommend this folder to be routinely cleared.

Updating the wf-artic software

Updated versions of the wf-artic software may be released and an alert to the availability of newer workflow versions will be noted by the Nextflow software at run-time.

To update the software:

nextflow pull epi2me-labs/wf-artic

It may be necessary to first delete the cached workflow files. This can be achieved with the command:

nextflow drop -f epi2me-labs/wf-artic

9. Reutilización y devolución de celdas de flujo

Material

Flow Cell Wash Kit (EXP-WSH004) (kit de lavado de celda de flujo)

El protocolo Flow Cell Wash Kit está disponible en la comunidad Nanopore.

CONSEJO

Una vez terminado el experimento, recomendamos lavar la celda de flujo cuanto antes. Si no es posible, se puede dejar en el dispositivo y lavar al día siguiente.

Aquí puede encontrar las instrucciones para devolver celdas de flujo.

IMPORTANTE

Ante cualquier duda o pregunta acerca del experimento de secuenciación, consulte la guía de resolución de problemas, Troubleshooting Guide, que se encuentra en la versión en línea de este protocolo.

10. Problemas durante la extracción de ADN/ARN y la preparación de bibliotecas

A continuación hay una lista de los problemas más frecuentes, con algunas posibles causas y soluciones propuestas.

También disponemos de una página de preguntas frecuentes, FAQ, en la sección Support de la comunidad Nanopore.

Si ha probado las soluciones propuestas y continúa teniendo problemas, póngase en contacto con el departamento de asistencia técnica, bien por correo electrónico (support@nanoporetech.com) o a través del Live Chat de la comunidad Nanopore.

Baja calidad de la muestra

Observación	Posible causa	Comentarios y acciones recomendadas
Baja pureza del ADN (la lectura del Nanodrop para ADN OD 260/280 es <1,8 y OD 260/230 es <2,0-2,2)	El método de extracción de ADN no proporciona la pureza necesaria	Los efectos de los contaminantes se muestran en la página Contaminants. Pruebe con un método de extracción alternativo que no provoque el arrastre de contaminantes. Considere realizar un paso adicional de limpieza SPRI.
Baja integridad del ARN (número de integridad del ARN <9,5 RIN o la banda ARNr se muestra como una mancha en el gel).	El ARN se degradó durante la extracción	Probar un método de extracción de ARN diferente. Encontrará más información sobre RIN en la página RNA Integrity Number. Asimismo, dispone de información adicional en la página DNA/RNA Handling.
El ARN tiene una longitud de fragmento más corta de lo esperado	El ARN se degradó durante la extracción	Probar un método de extracción de ARN diferente. Encontrará más información sobre RIN en la página RNA Integrity Number. Asimismo, dispone de información adicional en la página DNA/RNA Handling. Cuando se trabaje con ARN, recomendamos que el espacio de trabajo y el instrumental de laboratorio estén libres de ribonucleasas.

Escasa recuperación de ADN tras la limpieza con microesferas magnéticas AMPure

Observación	Posible causa	Comentarios y acciones recomendadas
Escasa recuperación	Pérdida de ADN debido a una proporción de microesferas magnéticas AMPure por muestra inferior a lo previsto.	1. Las microesferas magnéticas AMPure precipitan con rapidez; antes de añadirlas a la muestra hay que asegurarse de que estén bien resuspendidas. 2. Si la proporción de microesferas por muestra es inferior a 0.4:1, los fragmentos de ADN, sean del tamaño que sean, se perderán durante la limpieza.
Escasa recuperación	Los fragmentos de ADN son más cortos de lo esperado	Cuanto menor sea la proporción de microesferas magnéticas AMPure por muestra, más rigurosa será la selección de fragmentos largos frente a los cortos. Determinar siempre la longitud de la muestra de ADN en un gel de agarosa u otros métodos de electroforesis en gel, y, a continuación, calcular la cantidad adecuada de microesferas magnéticas que se debe utilizar.
Escasa recuperación tras la preparación de extremos	El paso de lavado utilizó etanol a <70 %	Cuando se utilice etanol a <70 %, el ADN se eluirá de las microesferas magnéticas. Asegúrese de utilizar el porcentaje correcto.

11. Issues during the sequencing run

A continuación hay una lista de los problemas más frecuentes, con algunas posibles causas y soluciones propuestas.

También disponemos de una página de preguntas frecuentes, FAQ, en la sección Support de la comunidad Nanopore.

Menos poros al inicio de la secuenciación que después de verificar la celda de flujo

Observación	Posible causa	Comentarios y acciones recomendadas
MinKNOW presentó al inicio de la secuenciación un número de poros inferior al indicado durante la comprobación de la celda de flujo	Se introdujo una burbuja de aire en la matriz de nanoporos	Tras comprobar el número de poros presente en la celda de flujo, es imprescindible quitar las burbujas que haya cerca del puerto de cebado. Si no se quitan, pueden desplazarse a la matriz de nanoporos y dañar de manera irreversible los nanoporos expuestos al aire. En este vídeo se muestran algunas buenas prácticas para evitar que esto ocurra.
MinKNOW presentó al inicio de la secuenciación un número de poros inferior al indicado durante la comprobación de la celda de flujo	La celda de flujo no está colocada correctamente	Detener el ciclo de secuenciación, quitar la celda de flujo del dispositivo e insertarla de nuevo. Comprobar que está firmemente asentada en el dispositivo y que ha alcanzado la temperatura deseada. Si procede, probar con una posición diferente del dispositivo (GriION/PromethION).
MinKNOW presentó al inicio de la secuenciación un número de poros inferior al indicado durante la comprobación de la celda de flujo	La presencia de contaminantes en la biblioteca ha dañado o bloqueado los poros	El número de poros resultante tras la comprobación de la celda de flujo se realiza usando el control de calidad de las moléculas de ADN presentes en el tampón de almacenamiento de la celda de flujo. Al inicio de la secuenciación, se utiliza la misma biblioteca para estimar el número de poros activos. Por este motivo, se estima que puede haber una variabilidad del 10 % en el número de poros detectados. Tener un número de poros considerablemente inferior al inicio de la secuenciación puede deberse a la presencia de contaminantes en la biblioteca que hayan dañado las membranas o bloqueado los poros. Para mejorar la pureza del material de entrada tal vez sea necesario usar métodos de purificación o extracción de ADN/ARN alternativos. Los efectos de los contaminantes están descritos en la página Contaminants. Se recomienda, probar con un método de extracción alternativo que no provoque el arrastre de contaminantes.

Error en el script de MinKNOW

Observación	Posible causa	Comentarios y acciones recomendadas
MinKNOW muestra el mensaje "Error en el script"		Reiniciar el ordenador y reiniciar MinKNOW. Si el problema continúa, reúna los archivos de registro MinKNOW log files y contacte con el servicio de asistencia técnica. Si no dispone de otro dispositivo de secuenciación, recomendamos que guarde la celda de flujo con la biblioteca cargada a 4 °C y contacte con el servicio de asistencia técnica para recibir recomendaciones de almacenamiento adicionales.

Pore occupancy below 40%

Observation	Possible cause	Comments and actions
Pore occupancy <40%	Not enough library was loaded on the flow cell	Ensure you load the recommended amount of good quality library in the relevant library prep protocol onto your flow cell. Please quantify the library before loading and calculate mols using tools like the Promega Biomath Calculator, choosing "dsDNA: µg to pmol"
Pore occupancy close to 0	The Ligation Sequencing Kit was used, and sequencing adapters did not ligate to the DNA	Make sure to use the NEBNext Quick Ligation Module (E6056) and Oxford Nanopore Technologies Ligation Buffer (LNB, provided in the sequencing kit) at the sequencing adapter ligation step, and use the correct amount of each reagent. A Lambda control library can be prepared to test the integrity of the third-party reagents.
Pore occupancy close to 0	The Ligation Sequencing Kit was used, and ethanol was used instead of LFB or SFB at the wash step after sequencing adapter ligation	Ethanol can denature the motor protein on the sequencing adapters. Make sure the LFB or SFB buffer was used after ligation of sequencing adapters.
Pore occupancy close to 0	No tether on the flow cell	Tethers are adding during flow cell priming (FLT/FCT tube). Make sure FLT/FCT was added to FB/FCF before priming.

Longitud de lectura más corta de lo esperado

Observación	Posible causa	Comentarios y acciones recomendadas
Longitud de lectura más corta de lo esperado	Fragmentación no deseada de la muestra de ADN	La longitud de lectura refleja la longitud del fragmento de la muestra de ADN. La muestra de ADN se puede fragmentar durante la extracción de la preparación de la biblioteca. 1. Consulte la sección de buenas prácticas de los métodos de extracción en la página Extraction Methods de la comunidad Nanopore. 2. Visualizar la distribución de la longitud de los fragmentos de las muestras de ADN en un gel de agarosa antes de proceder a la preparación de la biblioteca. En la imagen superior, la muestra 1 contiene alto peso molecular, mientras que la muestra 2 se ha fragmentado. 3. Durante la preparación de la biblioteca, evitar pipetear y agitar en vórtex cuando se mezclen los reactivos. Dar suaves golpes con el dedo o invertir el vial es suficiente.

Gran proporción de poros no disponibles

Observación	Posible causa	Comentarios y acciones recomendadas
Gran proporción de poros no disponibles (se muestran en azul oscuro en el panel de canales y en el gráfico de actividad de poros) Conforme pasa el tiempo, el gráfico de actividad de poros de arriba muestra una proporción creciente de poros no disponibles.	Hay contaminantes presentes en la muestra	Algunos contaminantes se pueden eliminar de los poros mediante la función de desbloqueo incorporada en MinKNOW. Si funciona, el estado de los poros cambiará a "sequencing pores" (secuenciación de poros). Si la porción poros no disponibles se mantiene elevada o aumenta, pruebe una de las siguientes opciones: 1. Realizar un enjuague de nucleasa con el kit de lavado Flow Cell Wash Kit (EXP-WSH004) 2. Realizar varios ciclos de PCR para intentar diluir cualquier contaminante que pueda estar causando problemas.

Gran proporción de poros inactivos

Observación	Posible causa	Comentarios y acciones recomendadas
Gran proporción de poros inactivos/no disponibles (se muestran en azul claro en el panel de canales y en el gráfico de actividad de poros. Los poros o membranas están dañados de manera irreversible)	Se han introducido burbujas de aire en la celda de flujo	Las burbujas de aire introducidas durante el cebado de la celda y la carga de la biblioteca pueden dañar los poros de forma permanente. Para conocer las buenas prácticas de cebado y carga de la celda de flujo, ver el vídeo Priming and loading your flow cell
Gran proporción de poros inactivos/no disponibles	Ciertos compuestos copurificados con ADN	Compuestos conocidos, incluidos los polisacáridos, se asocian generalmente con el ADN genómico de las plantas. 1. Consulte la página Plant leaf DNA extraction method. 2. Limpiar usando el kit QIAGEN PowerClean Pro. 3. Realizar una amplificación del genoma completo con la muestra original de ADNg utilizando el kit QIAGEN REPLI-g.
Gran proporción de poros inactivos/no disponibles	Hay contaminantes presentes en la muestra	Los efectos de los contaminantes se muestran en la página Contaminants. Probar con un método de extracción alternativo que no provoque el arrastre de contaminantes.

Reducción de la velocidad de secuenciación y del índice de calidad Qscore en una fase avanzada de la secuenciación

Observación	Posible causa	Comentarios y acciones recomendadas
Reducción de la velocidad de secuenciación y el índice de calidad Qscore en una fase avanzada de la secuenciación	En la química del kit 9 (p. ej., SQK-LSK109), cuando la celda de flujo está sobrecargada con la biblioteca se observa un consumo rápido de combustible (consulte el protocolo correspondiente a su biblioteca de ADN para ver las recomendaciones)	Añadir más combustible a la celda de flujo, siguiendo las instrucciones en el protocolo de MinKNOW. En futuros experimentos, cargar cantidades menores de biblioteca en la celda de flujo.

Fluctuación de la temperatura

Observación	Posible causa	Comentarios y acciones recomendadas
Fluctuación de la temperatura	La celda de flujo ha perdido contacto con el dispositivo	Comprobar que una almohadilla térmica cubra la placa metálica de la parte posterior de la celda de flujo. Reinsertar la celda de flujo y presionar para asegurarse de que las clavijas del conector estén bien conectadas al dispositivo. Si el problema continúa, contacte con el servicio de asistencia técnica.

Error al intentar alcanzar la temperatura deseada

Observación	Posible causa	Comentarios y acciones recomendadas
MinKNOW muestra el mensaje "Error al intentar alcanzar la temperatura deseada"	El dispositivo ha sido colocado en un lugar a una temperatura ambiente inferior a la media o en un lugar con escasa ventilación (lo que provoca el sobrecalientamiento de las celdas de flujo).	MinKNOW tiene un tiempo predeterminado para que las celdas de flujo alcancen la temperatura fijada. Una vez transcurrido ese tiempo, aparece un mensaje de error, pero el experimento de secuenciación continua. Secuenciar a una temperatura incorrecta puede llevar a una disminución en el rendimiento y a generar un índice de calidad Qscore menor. Corrija la ubicación del dispositivo, procure que esté a temperatura ambiente y tenga buena ventilación; a continuación, reinicie el proceso en MinKNOW. Encontrará más información sobre el control de temperatura del MinION en este enlace.

Guppy – no input .fast5 was found or basecalled

Observation	Possible cause	Comments and actions
No input .fast5 was found or basecalled	input_path did not point to the .fast5 file location	The --input_path has to be followed by the full file path to the .fast5 files to be basecalled, and the location has to be accessible either locally or remotely through SSH.
No input .fast5 was found or basecalled	The .fast5 files were in a subfolder at the input_path location	To allow Guppy to look into subfolders, add the --recursive flag to the command

Guppy – no Pass or Fail folders were generated after basecalling

Observation	Possible cause	Comments and actions
No Pass or Fail folders were generated after basecalling	The --qscore_filtering flag was not included in the command	The --qscore_filtering flag enables filtering of reads into Pass and Fail folders inside the output folder, based on their strand q-score. When performing live basecalling in MinKNOW, a q-score of 7 (corresponding to a basecall accuracy of ~80%) is used to separate reads into Pass and Fail folders.

Guppy – unusually slow processing on a GPU computer

Observation	Possible cause	Comments and actions
Unusually slow processing on a GPU computer	The --device flag wasn't included in the command	The --device flag specifies a GPU device to use for accelerate basecalling. If not included in the command, GPU will not be used. GPUs are counted from zero. An example is --device cuda:0 cuda:1, when 2 GPUs are specified to use by the Guppy command.

Device:

London Calling 2025

Explore products

Documentation

Nanopore Learning

PCR tiling of SARS-CoV-2 virus - automated Agilent (SQK-RBK110.96 with EXP-MRT001)

Introduction to the protocol

Automated library preparation

Sequencing and data analysis

Troubleshooting

Document versions

MinION: Protocol

PCR tiling of SARS-CoV-2 virus - automated Agilent (SQK-RBK110.96 with EXP-MRT001) V MRTA_9157_v110_revG_18May2022

Contents

Introduction to the protocol

Automated library preparation

Sequencing and data analysis

Troubleshooting

Descripción general

1. Overview of the protocol

IMPORTANTE

This protocol is a work in progress and some details are expected to change over time. Please make sure you always use the most recent version of the protocol and scripts.

Introduction to the protocol

Steps in the sequencing workflow:

Prepare for your experiment

Overview of library preparation workflow:

Sequencing and analysis

Timings

Nomenclature for automation protocol

Before starting

IMPORTANTE

Compatibility of this protocol

2. Equipment and consumables

Material

Consumibles

Instrumental

Equipo opcional

Rapid Barcoding Kit 96 (SQK-RBK110.96) contents

Midnight RT PCR Expansion (EXP-MRT001) contents

Midnight Primer sequences

Pool A

Pool B

Rapid barcode sequences

3. Computer requirements and software

Requisitos informáticos para el MinION Mk1B

Requisitos informáticos para el MinION Mk1C

Software for nanopore sequencing

MinKNOW

EPI2ME (optional)

Verificar la celda de flujo

4. Pre-PCR

Material

Consumibles

Instrumental

Run setup:

Turn on the Agilent Thermocube and set Position 4 to 4°C.

Thaw and keep the samples, LunaScript, Q5 Hot Start Master mix, Midnight Primer Pool A (MPA) and Midnight Primer Pool B (MPB) on ice.

IMPORTANTE

To minimise risk of contamination, we recommend handling the Lunascript and primers in a clean template-free PCR hood.

IMPORTANTE

Prior to use, ensure all reagents have been thoroughly mixed by performing 20-30 full-volume pipette mixes.

In the template-free pre-PCR hood, prepare the following Primer master mixes in 1.5 ml Eppendorf DNA LoBind tubes and mix thoroughly as follows:

In the template-free pre-PCR hood and using a clean Arvensis plate, prepare the reagent input plate as follows:

In a pre-PCR hood and using a clean Arvensis plate, prepare the RNA sample input plate as follows:

On the Agilent Bravo, select the 'cDNA and Multiplex (X) samples' protocol, where (X) indicates the number of samples to be processed.

Set the number of columns of samples and the PCR plate type.

Select 'Display Deck Layout'.

Add the labware, sample plate and reagent input plate as indicated on the form display.

Select 'Run Protocol'.

To start the run, select 'Ok' from the figure below:

After the Agilent Bravo has added the 2 µl of LunaScript to the samples, the robot will stop with the the following message:

Remove the sample plate containing the LunaScript from the Agilent Bravo, seal it and spin it down.

Place the sample plate in a Thermal cycler and incubate using the following program:

After placing the sample plate in the Thermal cycler, press "Continue" on the Agilent Bravo to start the addition of the Primer master mixes into a clean Arvensis plate.

Once the thermal cycler has completed the cDNA synthesis, remove the sample plate and spin down.

When prompted, place the sample plate back in the Agilent Bravo deck into position 4.

After the Agilent Bravo has added the 2.5 µl of RT to the Primer master mix plate/plates, the robot will stop with the the following message:

Remove the PCR plate (or plates if processing X96 samples) from the Agilent Bravo, seal it and spin it down.

Place in the thermal cycler and incubate using the following program, with the heated lid set to 105°C:

FIN DEL PROCESO

Once the PCR amplification is complete, remove the plate(s) from the thermal cycler and spin down. The plate(s) will be taken forward to the Post-PCR section of the protocol.