Main menu

Single-cell transcriptomics with cDNA prepared using 10X Genomics (SST_v9148_v111_revH_12Jan2022)


1. Overview of the protocol

This is a Legacy product

This kit is soon to be discontinued and we recommend all customers to upgrade to the latest chemistry for their relevant kit which is available on the Store. If customers require further support for any ongoing critical experiments using a Legacy product, please contact Customer Support via email: support@nanoporetech.com. For further information on please see the product update page.

PCR-cDNA Sequencing Kit features

This kit is highly recommended for users who:

  • would like to identify and quantify full-length transcripts
  • want to explore isoforms, splice variants and fusion transcripts using full-length cDNAs
  • would like to generate a large number of cDNA reads

Introduction to the single-cell transcriptomics protocol

This protocol describes how to carry out sequencing of cDNA from single cells using the PCR-cDNA Sequencing Kit (SQK-PCS111). You will need to have reverse-transcribed single cell mRNA into cDNA using the 10X Genomics Next GEM Single Cell 3' Kit (V3.1).

Steps in the sequencing workflow:

Prepare for your experiment

You will need to:

  • Have previously-prepared single-cell barcoded cDNA using the 10X Genomics Next GEM Single Cell 3' Kit (V3.1). The quality checks performed during the protocol are essential in ensuring experimental success.
  • Ensure you have your sequencing kit, the correct equipment and third-party reagents
  • Download the software for acquiring and analysing your data
  • Check your flow cell to ensure it has enough pores for a good sequencing run

Library preparation

You will need to:

  • Biotin tag your cDNAs and amplify by PCR
  • Pull down the amplicons on streptavidin beads, and amplify again by PCR
  • Attach sequencing adapters to the PCR products
  • Prime the flow cell, and load your cDNA library into the flow cell

Sequencing and analysis

You will need to:

  • Start a sequencing run using the MinKNOW software, which will collect raw data from the device and convert it into basecalled reads
  • Analyse the data further using a pipeline of your choice

Compatibility of this protocol

This protocol should only be used in combination with:

  • PCR-cDNA Sequencing Kit (SQK-PCS111)
  • R9.4.1 flow cells (FLO-MIN106)
  • Flow Cell Wash Kit (EXP-WSH004)

2. Equipment and consumables

Material
  • 10 ng de amplicones de ADNc producidos con los ensayos Chromium GEM-X Universal 3’ Gene Expression (V4) o Chromium Next GEM Universal 3’ Gene Expression (V3.1) de 10x Genomics
  • cDNA-PCR Sequencing Kit (SQK-PCS111)
  • Custom-ordered oligo at 10 μM: [Btn]Fwd_3580_partial_read1_defined (sequence provided below)
  • Oligo de encargo a 10 μM: Rev_PR2_partial_TSO_defined_for_5'_cDNA (secuencia indicada a continuación)

Consumibles
  • Streptavidina M280, 10 μg/μl (Invitrogen, 11205D)
  • Mezcla maestra 2X LongAmp Hot Start Taq (NEB, M0533)
  • Microesferas Agencourt AMPure XP (Beckman Coulter™, A63881)
  • Tris-HCl 1 M, pH 7,5
  • NaCl 5 M (Sigma, 71386)
  • EDTA 0,5 M, pH 8 (Thermo Scientific, R1021)
  • Agua sin nucleasas (p.ej. Thermo Scientific, AM9937)
  • Etanol al 70 % recién preparado en agua sin nucleasas
  • Kit Agilent Technologies DNA 12000
  • Tubos Eppendorf DNA LoBind de 1,5 ml
  • Tubos de PCR de pared fina, 0,2 ml
  • Tubos Falcon de 15 ml

Instrumental
  • Hula mixer (mezclador de rotación suave)
  • Gradilla magnética (p. ej., Invitrogen DynaMag-2 Magnet, 12321D)
  • Microcentrífuga
  • Mezclador vórtex
  • Termociclador
  • Pipeta y puntas P1000
  • Pipeta y puntas P200
  • Pipeta y puntas P100
  • Pipeta y puntas P20
  • Pipeta y puntas P10
  • Pipeta y puntas P2
  • Cubeta con hielo
  • Temporizador
  • Fluorímetro Qubit™ (o equivalente)
  • Bioanalizador Agilent (o equivalente)

For this protocol, you will need 10 ng amplified cDNA amplicons prepared using 10X Genomics Next GEM Single Cell 3' Kits (V3.1).

10X Genomics kits

Note: This protocol is compatible and fully supported with 10X Genomics Next GEM Single Cell 3' Kit (V3.1) and the Visium Spatial Gene Expression Kit (V1). Other versions of the kits are not supported.

The 10X Genomics Next GEM Single Cell 5' Kit (V2) is compatible with our Ligation sequencing V14 - Single-cell transcriptomics with 5' cDNA prepared using 10X Genomics on PromethION (SQK-LSK114) protocol.

Input DNA

How to QC your input DNA

It is important that the input DNA meets the quantity and quality requirements. Using too little or too much DNA, or DNA of poor quality (e.g. highly fragmented or containing RNA or chemical contaminants) can affect your library preparation.

For instructions on how to perform quality control of your DNA sample, please read the Input DNA/RNA QC protocol.

Chemical contaminants

Depending on how the DNA is extracted from the raw sample, certain chemical contaminants may remain in the purified DNA, which can affect library preparation efficiency and sequencing quality. Read more about contaminants on the Contaminants page of the Community.

cDNA-PCR Sequencing Kit (SQK-PCS111) contents

SQK-PCS111 1

Name Acronym Cap colour No. of vials Fill volume per vial (µl)
Strand Switching Primer II SSPII Violet 1 20 µl
RT Primer RTP Yellow 1 10 µl
cDNA RT Adapter CRTA Amber 1 10 µl
Rapid Adapter T RAP T Green 1 10 µl
Annealing Buffer AB Orange 1 10 µl
cDNA Primer cPRM White cap, grey label 1 40 µl
Elution Buffer EB Black 1 500 µl
Short Fragment Buffer SFB Clear 1 1,800 µl
Sequencing Buffer II SBII Red 1 500 µl
Loading Beads II LBII Pink 1 360 µl
Loading Solution LS White cap, pink label 1 400 µl
Flush Buffer FB Blue 6 1,170 µl
Flush Tether FLT White cap, purple label 1 200 µl

Custom-ordered oligo sequences

Order the following HPLC-purified oligos at 100 μM, and dilute to 10 μM in TE buffer for use in the Pre-pull-down step of the library prep.

Name Sequence
[Btn]Fwd_3580_partial_read1_defined 5'-/5Biosg/CAGCACTTGCCTGTCGCTCTATCTTC
CTACACGACGCTCTTCCGATCT-3'
Rev_PR2_partial_TSO_defined 5'-CAGCTTTCTGTTGGTGCTGATATTGCAAGCAGTGGTA
TCAACGCAGAG-3'

3. Computer requirements and software

MinION Mk1B IT requirements

Sequencing on a MinION Mk1B requires a high-spec computer or laptop to keep up with the rate of data acquisition. For more information, refer to the MinION Mk1B IT requirements document.

Software for nanopore sequencing

MinKNOW

The MinKNOW software controls the nanopore sequencing device, collects sequencing data in real time and processes it into basecalls. You will be using MinKNOW for every sequencing experiment. MinKNOW can also demultiplex reads into folders for each barcode found in Oxford Nanopore library preparation kits, and basecall/demultiplex data after a sequencing run has completed. MinKNOW use For instructions on how to run the MinKNOW software, please refer to the relevant section in the MinKNOW protocol.

EPI2ME (optional)

The EPI2ME cloud-based platform performs further analysis of basecalled data, for example alignment to the Lambda genome, barcoding, or taxonomic classification. You can the EPI2ME platform if you would like further analysis of your data post-basecalling. Please note that EPI2ME does not currently offer a workflow for single-cell transcriptomics analysis. EPI2ME installation and use For instructions on how to create an EPI2ME account and install the EPI2ME Desktop Agent, please refer to the EPI2ME Platform protocol.

Guppy (optional)

The Guppy command-line software can be used instead of MinKNOW for basecalling and demultiplexing reads into folders for each barcode found in Oxford Nanopore library preparation kits. You can use it if you would like to re-analyse old data, or integrate basecalling into your analysis pipeline. Guppy installation and use If you would like to use the Guppy software, please refer to the Guppy protocol.

Check your flow cell

We highly recommend that you check the number of pores in your flow cell prior to starting a sequencing experiment. This should be done within 12 weeks of purchasing for MinION/GridION/PromethION or within four weeks of purchasing Flongle Flow Cells. Oxford Nanopore Technologies will replace any flow cell with fewer than the number of pores in the table below, when the result is reported within two days of performing the flow cell check, and when the storage recommendations have been followed. To do the flow cell check, please follow the instructions in the Flow Cell Check document.

Flow cell Minimum number of active pores covered by warranty
Flongle Flow Cell 50
MinION/GridION Flow Cell 800
PromethION Flow Cell 5000

4. Pre-pull-down PCR

Material
  • 10 ng de amplicones de ADNc producidos con los ensayos Chromium GEM-X Universal 3’ Gene Expression (V4) o Chromium Next GEM Universal 3’ Gene Expression (V3.1) de 10x Genomics
  • Custom ordered-oligo at 10 μM: [Btn]Fwd_3580_partial_read1_defined (sequence provided in Equipment and Consumables)
  • Custom-ordered oligo at 10 μM: Rev_PR2_partial_TSO_defined (sequence provided in Equipment and Consumables)

Consumibles
  • Mezcla maestra 2X LongAmp Hot Start Taq (NEB, M0533)
  • Microesferas Agencourt AMPure XP (Beckman Coulter™, A63881)
  • Agua sin nucleasas (p. ej., ThermoFisher, AM9937)
  • Etanol al 70 % recién preparado en agua sin nucleasas
  • Tubos Eppendorf DNA LoBind de 1,5 ml
  • Tubos de PCR de pared fina, 0,2 ml

Instrumental
  • Termociclador
  • Microcentrífuga
  • Hula mixer (mezclador de rotación suave)
  • Gradilla magnética
  • Cubeta con hielo
  • Pipeta y puntas P1000
  • Pipeta y puntas P200
  • Pipeta y puntas P100
  • Pipeta y puntas P20
  • Pipeta y puntas P2

Set up the following biotin tagging reaction in a 0.2 ml thin-walled PCR tube:

Reagent Volume
cDNA template 10 ng, x μl
[Btn]Fwd_3580_partial_read1_defined, 10 μM 2 μl
Rev_PR2_partial_TSO_defined, 10 μM 2 μl
Nuclease-free water 21-x μl
LongAmp Hot Start Taq 2X Master Mix 25 μl
Total 50 μl

Amplify using the following cycling conditions:

Cycle step Temperature Ramp rate Time No. of cycles
Initial denaturation 94°C max 3 min 1
Denaturation

Annealing ramp-down

Annealing

Extension
94°C

66°C down to 58°C

58°C

65°C
max

0.2°C/s

max

max
30 sec

40 sec

50 sec

6 mins


4
Final extension 65°C max 10 min 1
Hold 4°C - ∞ -

Resuspend the AMPure XP beads by vortexing.

Transfer the sample to a clean 1.5 ml Eppendorf DNA LoBind tube.

Add 40 µl of resuspended AMPure XP beads to the reaction and mix by flicking the tube.

Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.

Prepare 500 μl of fresh 70% ethanol in nuclease-free water.

Spin down the samples and pellet the beads on a magnet until the eluate is clear and colourless. Keep the tubes on the magnet and pipette off the supernatant.

Keep the tube on the magnet and wash the beads with 200 µl of freshly prepared 70% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.

Repeat the previous step.

Briefly spin down and place the tubes back on the magnet. Pipette off any residual ethanol. Allow to dry for 30 seconds, but do not dry the pellet to the point of cracking.

Remove the tube from the magnetic rack and resuspend the pellet in 10 µl nuclease-free water. Spin down and incubate for 2 minutes at room temperature.

Pellet the beads on a magnet until the eluate is clear and colourless.

Remove and retain 10 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.

5. Pull-down

Consumibles
  • Tris-HCl 1 M, pH 7,5
  • NaCl 5 M (Sigma, 71386)
  • EDTA 0,5 M, pH 8 (Thermo Scientific, R1021)
  • Streptavidina M280, 10 μg/μl (Invitrogen, 11205D)
  • Tubos Falcon de 15 ml
  • Tubos Eppendorf DNA LoBind de 1,5 ml
  • Tubos de PCR de pared fina, 0,2 ml
Instrumental
  • Mezclador vórtex
  • Microcentrífuga
  • Hula mixer (mezclador de rotación suave)
  • Gradilla magnética
  • Cubeta con hielo
  • Pipeta y puntas P1000
  • Pipeta y puntas P200
  • Pipeta y puntas P100
  • Pipeta y puntas P20
  • Pipeta y puntas P2

Prepare 4 ml of 2X wash/bind buffer (10 mM Tris-HCl pH 7.5, 2 M NaCl, 1 mM EDTA).

Reagent Stock concentration Final concentration Volume
Tris-HCl pH 7.5 1 M 10 mM 40 μl
NaCl 5 M 2 M 1600 μl
EDTA 0.5 M 1 mM 8 μl
Nuclease-free water - - 2352 μl
Total - - 4000 μl

Transfer 3.5 ml of the 2X wash/bind buffer to a fresh 15 ml Falcon tube and add 3.5 ml of nuclease-free water to make 7 ml of 1X wash/bind buffer (5 mM Tris-HCl pH 7.5, 1 M NaCl, 0.5 mM EDTA).

Resuspend the M280 streptavidin beads (10 μg/μl) by vortexing.

Transfer 5 μl of the streptavidin beads to a clean 1.5 ml Eppendorf DNA LoBind tube.

Add 1 ml of 1X wash/bind buffer and vortex the beads with buffer for 5 seconds. Pellet the beads on a magnet for two minutes, then pipette off the supernatant.

Repeat the previous step two more times for a total of three washes.

Resuspend the beads in 10 μl of 2X wash/bind buffer to achieve a final bead concentration of 5 μg/μl.

It is critical that 2X buffer is used for this step. Using 1X buffer will result in inefficient binding.

Add 10 μl of 5 μg/μl prepared beads (50 μg beads total) to the tube with 10 μl of biotinylated cDNA.

Incubate on a Hula mixer (rotator mixer) for 20 minutes at room temperature.

Add 1 ml of 1X wash/bind buffer and vortex the DNA and beads with buffer for 5 seconds. Pellet the beads on a magnet for two minutes, then pipette off the supernatant. Take care to not aspirate any of the beads.

Repeat the previous step two more times for a total of three washes.

Add 200 μl of 10 mM Tris-HCl pH 7.5 and vortex the beads for 5 seconds.

Spin down and place the tube back on the magnet for three minutes. Pipette off the supernatant.

Remove the tube from the magnetic rack and resuspend the pellet in 20 μl of nuclease-free water. Vortex for 5 seconds and briefly spin down to collect the amplicon-bead conjugate.

6. Post-pull-down PCR

Material
  • cDNA Primer (cPRM)
  • Elution Buffer from the Oxford Nanopore kit (EB)

Consumibles
  • Mezcla maestra 2X LongAmp Hot Start Taq (NEB, M0533)
  • Agua sin nucleasas (p. ej., ThermoFisher, AM9937)
  • Microesferas Agencourt AMPure XP (Beckman Coulter™, A63881)
  • Etanol al 70 % recién preparado en agua sin nucleasas
  • Tubos de PCR de pared fina, 0,2 ml
  • Tubos Eppendorf DNA LoBind de 1,5 ml

Instrumental
  • Termociclador
  • Mezclador vórtex
  • Hula mixer (rotator mixer)
  • Cubeta con hielo
  • Pipeta y puntas P1000
  • Pipeta y puntas P200
  • Pipeta y puntas P100
  • Pipeta y puntas P20
  • Pipeta y puntas P10
  • Pipeta y puntas P2
  • Fluorímetro Qubit™ (o equivalente)

In a 0.2 ml thin-walled PCR tube, prepare the following PCR reaction:

Reagent Volume
cPRM 1 μl
Nuclease-free water 4 μl
LongAmp Hot Start Taq 2X Master Mix 25 μl
Total 30 μl

Resuspend the amplicon-bead conjugate by pipetting and then transfer 20 μl of the conjugate into the 0.2 ml thin-walled PCR tube containing the PCR reaction. Mix by pipetting.

Do not spin down the tube; transfer immediately to the thermal cycler and amplify using the following cycling conditions:

| Cycle step | Temperature | Time | No. of cycles | | ---------- | ---------- | ---------- | ---------- | ---------- | | Initial denaturation | 94°C | 3 min | 1 | | Denaturation

Annealing

Extension | 94°C

62°C

65°C | 15 s

15 s

6 min |

4 | | Final extension | 65°C | 10 min | 1 | | Hold | 4°C | ∞ | - |

Resuspend the AMPure XP beads by vortexing.

Transfer the sample to a clean 1.5 ml Eppendorf DNA LoBind tube.

Add 40 µl of resuspended AMPure XP beads to the reaction and mix by flicking the tube.

Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.

Prepare 500 μl of fresh 70% ethanol in nuclease-free water.

Spin down the sample and pellet on a magnet until supernatant is clear and colourless. Keep the tube on the magnet, and pipette off the supernatant.

Keep the tube on the magnet and wash the beads with 200 µl of freshly prepared 70% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.

Repeat the previous step.

Briefly spin down and place the tubes back on the magnet for the beads to pellet. Pipette off any residual ethanol. Allow to dry for 30 seconds, but do not dry the pellets to the point of cracking.

Remove the tube from the magnetic rack and resuspend the pellet in 15 µl Elution Buffer (EB).

Pellet the beads on the magnet until the eluate is clear and colourless.

Remove and retain 15 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.

Dispose of the pelleted beads

Quantify 1 µl of eluted sample using a Qubit fluorometer - recovery aim >100 ng total.

7. Adapter addition

Material
  • Elution Buffer from the Oxford Nanopore kit (EB)
  • Rapid Adapter T (RAP T)

Consumibles
  • Tubos Eppendorf DNA LoBind de 1,5 ml

Instrumental
  • Microcentrífuga
  • Cubeta con hielo
  • Pipeta y puntas P1000
  • Pipeta y puntas P200
  • Pipeta y puntas P100
  • Pipeta y puntas P20
  • Pipeta y puntas P10
  • Pipeta y puntas P2

Analyse 1 µl of sample using the Agilent Bioanalyzer. Determine the average amplicon size from this data, and use this to calculate the input sample volume for the next step.

Calculate the required sample volume for 35 fmol and dilute this into 12 μl of EB.

Add 0.5 μl of Rapid Adapter T (RAP T) to the amplified cDNA library.

Mix well by pipetting and spin down.

Incubate the reaction for 5 minutes at room temperature.

The prepared library is used for loading onto the flow cell. Store the library on ice until ready to load.

8. Priming and loading the SpotON flow cell

Material
  • Sequencing Buffer II (SBII)
  • Loading Beads II (LBII)
  • Flush Buffer (FB)
  • Flush Tether (FLT)

Consumibles
  • Tubos Eppendorf DNA LoBind de 1,5 ml
  • Agua sin nucleasas (p.ej. Thermo Scientific, AM9937)

Instrumental
  • MinION device
  • SpotON Flow Cell
  • Pipeta y puntas P1000
  • Pipeta y puntas P100
  • Pipeta y puntas P20
  • Pipeta y puntas P10
  • MinION/GridION Flow Cell Light Shield

Priming and loading a flow cell

We recommend all new users watch the 'Priming and loading your flow cell' video before your first run.

Using the Loading Solution

We recommend using the Loading Beads II (LBII) for loading your library onto the flow cell for most sequencing experiments. However, if you have previously used water to load your library, you must use Loading Solution (LS) instead of water. Note: some customers have noticed that viscous libraries can be loaded more easily when not using Loading Beads II.

Thaw the Sequencing Buffer II (SBII), Loading Beads II (LBII) or Loading Solution (LS, if using), Flush Tether (FLT) and Flush Buffer (FB) at room temperature before mixing the reagents by vortexing, and spin down the SBII and FLT at room temperature.

Mix the Sequencing Buffer II (SBII), Flush Buffer (FB), Flush Tether (FLT) and Loading Solution (LS, if using) tubes by vortexing. Spin down the SBII and FLT at room temperature.

Prepare the flow cell priming mix: Add 30 µl of thawed and mixed Flush Tether (FLT) directly to the tube of thawed and mixed Flush Buffer (FB), and mix by vortexing.

Open the MinION Mk1B lid and slide the flow cell under the clip.

Press down firmly on the flow cell to ensure correct thermal and electrical contact.

Flow Cell Loading Diagrams Step 1a

Flow Cell Loading Diagrams Step 1b

Complete a flow cell check to assess the number of pores available before loading the library.

This step can be omitted if the flow cell has been checked previously.

See the flow cell check instructions in the MinKNOW protocol for more information.

Slide the priming port cover clockwise to open the priming port.

Flow Cell Loading Diagrams Step 2

Take care when drawing back buffer from the flow cell. Do not remove more than 20-30 µl, and make sure that the array of pores are covered by buffer at all times. Introducing air bubbles into the array can irreversibly damage pores.

After opening the priming port, check for a small air bubble under the cover. Draw back a small volume to remove any bubbles:

  1. Set a P1000 pipette to 200 µl
  2. Insert the tip into the priming port
  3. Turn the wheel until the dial shows 220-230 µl, to draw back 20-30 µl, or until you can see a small volume of buffer entering the pipette tip

Note: Visually check that there is continuous buffer from the priming port across the sensor array.

Flow Cell Loading Diagrams Step 03 V5

Load 800 µl of the priming mix into the flow cell via the priming port, avoiding the introduction of air bubbles. Wait for five minutes. During this time, prepare the library for loading by following the steps below.

Flow Cell Loading Diagrams Step 04 V5

Thoroughly mix the contents of the Loading Beads II (LBII) by pipetting.

The Loading Beads II (LBII) tube contains a suspension of beads. These beads settle very quickly. It is vital that they are mixed immediately before use.

In a new tube, prepare the library for loading as follows:

Reagent Volume per flow cell
Sequencing Buffer II (SBII) 37.5 µl
Loading Beads II (LBII), mixed immediately before use, or Loading Solution (LS), if using 25.5 µl
DNA library 12 µl
Total 75 µl

Note: Load the library onto the flow cell immediately after adding the Sequencing Buffer II (SBII) and Loading Beads II (LBII) because the fuel in the buffer will start to be consumed by the adapter.

Complete the flow cell priming:

  1. Gently lift the SpotON sample port cover to make the SpotON sample port accessible.
  2. Load 200 µl of the priming mix into the flow cell priming port (not the SpotON sample port), avoiding the introduction of air bubbles.

Flow Cell Loading Diagrams Step 5

Flow Cell Loading Diagrams Step 06 V5

Mix the prepared library gently by pipetting up and down just prior to loading.

Add 75 μl of the prepared library to the flow cell via the SpotON sample port in a dropwise fashion. Ensure each drop flows into the port before adding the next.

Flow Cell Loading Diagrams Step 07 V5

Gently replace the SpotON sample port cover, making sure the bung enters the SpotON port and close the priming port.

Step 8 update

Flow Cell Loading Diagrams Step 9

Install the light shield on your flow cell as soon as library has been loaded for optimal sequencing output.

We recommend leaving the light shield on the flow cell when library is loaded, including during any washing and reloading steps. The shield can be removed when the library has been removed from the flow cell.

Place the light shield onto the flow cell, as follows:

  1. Carefully place the leading edge of the light shield against the clip. Note: Do not force the light shield underneath the clip.

  2. Gently lower the light shield onto the flow cell. The light shield should sit around the SpotON cover, covering the entire top section of the flow cell.

J2264 - Light shield animation Flow Cell FAW optimised

The MinION Flow Cell Light Shield is not secured to the flow cell and careful handling is required after installation.

Close the device lid and set up a sequencing run on MinKNOW.

9. Data acquisition and basecalling

Overview of nanopore data analysis

For a full overview of nanopore data analysis, which includes options for basecalling and post-basecalling analysis, please refer to the Data Analysis document.

How to start sequencing

The sequencing device control, data acquisition and real-time basecalling are carried out by the MinKNOW software. Please ensure MinKNOW is installed on your computer or device. There are multiple options for how to carry out sequencing:

1. Data acquisition and basecalling in real-time using MinKNOW on a computer

Follow the instructions in the MinKNOW protocol beginning from the "Starting a sequencing run" section until the end of the "Completing a MinKNOW run" section.

2. Data acquisition and basecalling in real-time using the MinION Mk1B/Mk1D device

Follow the instructions in the MinION Mk1B user manual or the MinION Mk1D user manual.

3. Data acquisition and basecalling in real-time using the MinION Mk1C device

Follow the instructions in the MinION Mk1C user manual.

4. Data acquisition and basecalling in real-time using the GridION device

Follow the instructions in the GridION user manual.

5. Data acquisition and basecalling in real-time using the PromethION device

Follow the instructions in the PromethION user manual or the PromethION 2 Solo user manual.

6. Data acquisition using MinKNOW on a computer and basecalling at a later time using MinKNOW

Follow the instructions in the MinKNOW protocol beginning from the "Starting a sequencing run" section until the end of the "Completing a MinKNOW run" section. When setting your experiment parameters, set the Basecalling tab to OFF. After the sequencing experiment has completed, follow the instructions in the Post-run analysis section of the MinKNOW protocol.

10. Downstream analysis

EPI2ME provides a Nextflow-based workflow for the analysis of single-cell sequencing data.

The workflow, wf-single-cell, processes the FASTQ format sequence data prepared by the MinKNOW software. The workflow screens each sequence read for 10X cell barcode information and assigns reads to a cell of origin. A subset of sequences from “true” cells are dynamically filtered on the basis of the number of assigned sequence reads. These sequences are mapped to the reference genome, and tables of both gene and transcript abundance are prepared for each cell. These "cell barcode x gene" or transcript abundance information are used to prepare the familiar UMAP plots that may show the stratification of the cell types present within the sample.

For more information on this workflow, follow the link to the GitHub documentation.

11. Flow cell reuse and returns

Material
  • Kit Flow Cell Wash (EXP-WSH004)

After your sequencing experiment is complete, if you would like to reuse the flow cell, please follow the Flow Cell Wash Kit protocol and store the washed flow cell at +2°C to +8°C.

The Flow Cell Wash Kit protocol is available on the Nanopore Community.

We recommend you to wash the flow cell as soon as possible after you stop the run. However, if this is not possible, leave the flow cell on the device and wash it the next day.

Alternatively, follow the returns procedure to send the flow cell back to Oxford Nanopore.

Instructions for returning flow cells can be found here.

If you encounter issues or have questions about your sequencing experiment, please refer to the Troubleshooting Guide that can be found in the online version of this protocol.

12. Issues during DNA/RNA extraction and library preparation

Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

We also have an FAQ section available on the Nanopore Community Support section.

If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

Low sample quality

Observation Possible cause Comments and actions
Low DNA purity (Nanodrop reading for DNA OD 260/280 is <1.8 and OD 260/230 is <2.0–2.2) The DNA extraction method does not provide the required purity The effects of contaminants are shown in the Contaminants document. Please try an alternative extraction method that does not result in contaminant carryover.

Consider performing an additional SPRI clean-up step.
Low RNA integrity (RNA integrity number <9.5 RIN, or the rRNA band is shown as a smear on the gel) The RNA degraded during extraction Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page.
RNA has a shorter than expected fragment length The RNA degraded during extraction Try a different RNA extraction method. For more info on RIN, please see the RNA Integrity Number document. Further information can be found in the DNA/RNA Handling page.

We recommend working in an RNase-free environment, and to keep your lab equipment RNase-free when working with RNA.

Low DNA recovery after AMPure bead clean-up

Observation Possible cause Comments and actions
Low recovery DNA loss due to a lower than intended AMPure beads-to-sample ratio 1. AMPure beads settle quickly, so ensure they are well resuspended before adding them to the sample.

2. When the AMPure beads-to-sample ratio is lower than 0.4:1, DNA fragments of any size will be lost during the clean-up.
Low recovery DNA fragments are shorter than expected The lower the AMPure beads-to-sample ratio, the more stringent the selection against short fragments. Please always determine the input DNA length on an agarose gel (or other gel electrophoresis methods) and then calculate the appropriate amount of AMPure beads to use. SPRI cleanup
Low recovery after end-prep The wash step used ethanol <70% DNA will be eluted from the beads when using ethanol <70%. Make sure to use the correct percentage.

13. Issues during the sequencing run

Below is a list of the most commonly encountered issues, with some suggested causes and solutions.

We also have an FAQ section available on the Nanopore Community Support section.

If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email (support@nanoporetech.com) or via LiveChat in the Nanopore Community.

Fewer pores at the start of sequencing than after Flow Cell Check

Observation Possible cause Comments and actions
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check An air bubble was introduced into the nanopore array After the Flow Cell Check it is essential to remove any air bubbles near the priming port before priming the flow cell. If not removed, the air bubble can travel to the nanopore array and irreversibly damage the nanopores that have been exposed to air. The best practice to prevent this from happening is demonstrated in this video.
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check The flow cell is not correctly inserted into the device Stop the sequencing run, remove the flow cell from the sequencing device and insert it again, checking that the flow cell is firmly seated in the device and that it has reached the target temperature. If applicable, try a different position on the device (GridION/PromethION).
MinKNOW reported a lower number of pores at the start of sequencing than the number reported by the Flow Cell Check Contaminations in the library damaged or blocked the pores The pore count during the Flow Cell Check is performed using the QC DNA molecules present in the flow cell storage buffer. At the start of sequencing, the library itself is used to estimate the number of active pores. Because of this, variability of about 10% in the number of pores is expected. A significantly lower pore count reported at the start of sequencing can be due to contaminants in the library that have damaged the membranes or blocked the pores. Alternative DNA/RNA extraction or purification methods may be needed to improve the purity of the input material. The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

MinKNOW script failed

Observation Possible cause Comments and actions
MinKNOW shows "Script failed"
Restart the computer and then restart MinKNOW. If the issue persists, please collect the MinKNOW log files and contact Technical Support. If you do not have another sequencing device available, we recommend storing the flow cell and the loaded library at 4°C and contact Technical Support for further storage guidance.

Pore occupancy below 40%

Observation Possible cause Comments and actions
Pore occupancy <40% Not enough library was loaded on the flow cell Ensure you load the recommended amount of good quality library in the relevant library prep protocol onto your flow cell. Please quantify the library before loading and calculate mols using tools like the Promega Biomath Calculator, choosing "dsDNA: µg to pmol"
Pore occupancy close to 0 The Ligation Sequencing Kit was used, and sequencing adapters did not ligate to the DNA Make sure to use the NEBNext Quick Ligation Module (E6056) and Oxford Nanopore Technologies Ligation Buffer (LNB, provided in the sequencing kit) at the sequencing adapter ligation step, and use the correct amount of each reagent. A Lambda control library can be prepared to test the integrity of the third-party reagents.
Pore occupancy close to 0 The Ligation Sequencing Kit was used, and ethanol was used instead of LFB or SFB at the wash step after sequencing adapter ligation Ethanol can denature the motor protein on the sequencing adapters. Make sure the LFB or SFB buffer was used after ligation of sequencing adapters.
Pore occupancy close to 0 No tether on the flow cell Tethers are adding during flow cell priming (FLT/FCT tube). Make sure FLT/FCT was added to FB/FCF before priming.

Shorter than expected read length

Observation Possible cause Comments and actions
Shorter than expected read length Unwanted fragmentation of DNA sample Read length reflects input DNA fragment length. Input DNA can be fragmented during extraction and library prep.

1. Please review the Extraction Methods in the Nanopore Community for best practice for extraction.

2. Visualise the input DNA fragment length distribution on an agarose gel before proceeding to the library prep. DNA gel2 In the image above, Sample 1 is of high molecular weight, whereas Sample 2 has been fragmented.

3. During library prep, avoid pipetting and vortexing when mixing reagents. Flicking or inverting the tube is sufficient.

Large proportion of unavailable pores

Observation Possible cause Comments and actions
Large proportion of unavailable pores (shown as blue in the channels panel and pore activity plot)

image2022-3-25 10-43-25 The pore activity plot above shows an increasing proportion of "unavailable" pores over time.
Contaminants are present in the sample Some contaminants can be cleared from the pores by the unblocking function built into MinKNOW. If this is successful, the pore status will change to "sequencing pore". If the portion of unavailable pores stays large or increases:

1. A nuclease flush using the Flow Cell Wash Kit (EXP-WSH004) can be performed, or
2. Run several cycles of PCR to try and dilute any contaminants that may be causing problems.

Large proportion of inactive pores

Observation Possible cause Comments and actions
Large proportion of inactive/unavailable pores (shown as light blue in the channels panel and pore activity plot. Pores or membranes are irreversibly damaged) Air bubbles have been introduced into the flow cell Air bubbles introduced through flow cell priming and library loading can irreversibly damage the pores. Watch the Priming and loading your flow cell video for best practice
Large proportion of inactive/unavailable pores Certain compounds co-purified with DNA Known compounds, include polysaccharides, typically associate with plant genomic DNA.

1. Please refer to the Plant leaf DNA extraction method.
2. Clean-up using the QIAGEN PowerClean Pro kit.
3. Perform a whole genome amplification with the original gDNA sample using the QIAGEN REPLI-g kit.
Large proportion of inactive/unavailable pores Contaminants are present in the sample The effects of contaminants are shown in the Contaminants Know-how piece. Please try an alternative extraction method that does not result in contaminant carryover.

Reduction in sequencing speed and q-score later into the run

Observation Possible cause Comments and actions
Reduction in sequencing speed and q-score later into the run For Kit 9 chemistry (e.g. SQK-LSK109), fast fuel consumption is typically seen when the flow cell is overloaded with library (please see the appropriate protocol for your DNA library to see the recommendation). Add more fuel to the flow cell by following the instructions in the MinKNOW protocol. In future experiments, load lower amounts of library to the flow cell.

Temperature fluctuation

Observation Possible cause Comments and actions
Temperature fluctuation The flow cell has lost contact with the device Check that there is a heat pad covering the metal plate on the back of the flow cell. Re-insert the flow cell and press it down to make sure the connector pins are firmly in contact with the device. If the problem persists, please contact Technical Services.

Failed to reach target temperature

Observation Possible cause Comments and actions
MinKNOW shows "Failed to reach target temperature" The instrument was placed in a location that is colder than normal room temperature, or a location with poor ventilation (which leads to the flow cells overheating) MinKNOW has a default timeframe for the flow cell to reach the target temperature. Once the timeframe is exceeded, an error message will appear and the sequencing experiment will continue. However, sequencing at an incorrect temperature may lead to a decrease in throughput and lower q-scores. Please adjust the location of the sequencing device to ensure that it is placed at room temperature with good ventilation, then re-start the process in MinKNOW. Please refer to this link for more information on MinION temperature control.

Guppy – no input .fast5 was found or basecalled

Observation Possible cause Comments and actions
No input .fast5 was found or basecalled input_path did not point to the .fast5 file location The --input_path has to be followed by the full file path to the .fast5 files to be basecalled, and the location has to be accessible either locally or remotely through SSH.
No input .fast5 was found or basecalled The .fast5 files were in a subfolder at the input_path location To allow Guppy to look into subfolders, add the --recursive flag to the command

Guppy – no Pass or Fail folders were generated after basecalling

Observation Possible cause Comments and actions
No Pass or Fail folders were generated after basecalling The --qscore_filtering flag was not included in the command The --qscore_filtering flag enables filtering of reads into Pass and Fail folders inside the output folder, based on their strand q-score. When performing live basecalling in MinKNOW, a q-score of 7 (corresponding to a basecall accuracy of ~80%) is used to separate reads into Pass and Fail folders.

Guppy – unusually slow processing on a GPU computer

Observation Possible cause Comments and actions
Unusually slow processing on a GPU computer The --device flag wasn't included in the command The --device flag specifies a GPU device to use for accelerate basecalling. If not included in the command, GPU will not be used. GPUs are counted from zero. An example is --device cuda:0 cuda:1, when 2 GPUs are specified to use by the Guppy command.
Oxford Nanopore Technologies, the Wheel icon, AmPORE-TB, EPI2ME, GridION, MinION, MinKNOW, PromethION, P2 Solo, and P2 are registered trademarks or the subject of trademark applications of Oxford Nanopore Technologies plc in various countries. Information contained herein may be protected by copyright, patents or patents pending of Oxford Nanopore Technologies plc. All other brands and names contained are the property of their respective owners. Oxford Nanopore Technologies products are RUO. Products labelled/branded as Oxford Nanopore Diagnostics may be RUO or may be regulated as in‐vitro diagnostic devices in some jurisdictions, please check individual product labelling. ONT plc is a member of the producer compliance scheme run by ERP UK Ltd, who manage the submission of documentation in support of WEEE compliance for ONT plc’s manufacture and supply of Electrical and Electronic equipment in the UK. ONT’s WEEE PRN is WEE/MM3828AA.

Last updated: 5/7/2026

Opciones de documento

MinION
Idioma:

Getting started

Buy a MinION starter pack Nanopore store Sequencing service providers Channel partners

Quick links

Intellectual property Cookie policy Corporate reporting Privacy policy Terms, conditions and policies Modern slavery policy Accessibility

About Oxford Nanopore

Contact us News Media resources & contacts Investor centre Careers BSI 27001 accreditationBSI 90001 accreditation
Spanish flag